A kit for identifying human gender

By designing highly specific PCR primer combinations, the problems of false negatives and difficulty in rapid identification in existing technologies have been solved, achieving efficient and accurate sex identification and simplifying the operation process.

CN115404271BActive Publication Date: 2026-03-24ZHONGSHAN OPHTHALMIC CENT SUN YAT SEN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-05-07
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Existing dual or multiplex PCR methods carry the risk of false negatives in sex identification, and it is difficult to accurately and quickly identify the sex of a sample in a single PCR reaction.

Method used

A PCR primer combination with good specificity, including first and second primer pairs, was designed to simultaneously amplify sex-specific genes and internal reference genes in the same reaction system, and to distinguish between males and females by electrophoretic analysis.

Benefits of technology

It achieves efficient and accurate gender identification, avoids false negative results, simplifies the operation process, and improves identification efficiency and accuracy, making it suitable for widespread application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003632507530000041
    Figure BDA0003632507530000041
  • Figure BDA0003632507530000051
    Figure BDA0003632507530000051
  • Figure BDA0003632507530000052
    Figure BDA0003632507530000052
Patent Text Reader

Abstract

The application provides a primer combination for PCR for identifying human gender, which is composed of a first primer pair and a second primer pair, wherein the first primer pair comprises nucleotide sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 7, and the second primer pair comprises nucleotide sequences as shown in SEQ ID NO: 13 and SEQ ID NO: 14. The primer combination for PCR for identifying human gender has good specificity and high amplification efficiency, and can be well applied to the identification of human gender. The identification method is simple in operation, high in identification efficiency, and has high sensitivity, specificity, accuracy and applicability. The accuracy of the identification method can reach 100%.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of gene identification, more particularly, to a primer, a kit and a method for identifying human gender. BACKGROUND

[0002] The PCR technology is currently the most widely used method for gender identification of human individuals and human cell strains. PCR, which stands for Polymerase Chain Reaction, is a process of in vitro replication of complementary daughter strand DNA to mother strand DNA template under the catalysis of DNA polymerase, through denaturation, annealing and extension steps, with specific primers as the extension starting point. The technology is a DNA in vitro synthesis amplification technology, which can quickly and specifically amplify the target DNA in vitro. The gender-specific gene (such as Y chromosome SRY gene) is amplified and detected by using this method, and the detection result is analyzed according to the different fragment sizes or signal strengths of the amplification products in male and female, so as to determine the gender of the individual being tested. At present, according to the different amplification methods and cycle parameters, the commonly used PCR gender identification methods can be divided into ordinary PCR method, double or multiple PCR method, nested PCR method, and fluorescent quantitative PCR method, etc.

[0003] Among them, the double or multiple PCR method is to design and synthesize a pair of gender-specific primers and at least one pair of housekeeping gene amplification internal reference primers, to amplify the internal reference primers in a PCR reaction system under certain conditions, to take the amplification product of the internal reference primers as a positive control for the occurrence of amplification reaction (if the internal reference primer band does not appear, it is considered that the PCR reaction does not occur, and the detection is invalid); under the premise that the internal reference primer band appears, the male-specific band appears for male, and the female-specific band appears for female.

[0004] The double or multiple PCR method for detecting gender can reduce the occurrence of false negative results, but the amplification reaction of two or more pairs of primers in one PCR reaction system increases the competition between primers, between primers, and between primers and templates, increases the difficulty of detection and analysis, and is not conducive to accurate and rapid detection of gender. This method avoids the occurrence of false negative results by setting internal reference primers, but only male or female gender-specific primers are added in one PCR reaction, and sometimes two PCR reactions are needed to determine whether the sample is from male or female. Therefore, it is a technical problem to be solved in the field to seek a simple and rapid one-time PCR method for identifying sample gender. SUMMARY

[0005] In order to solve the above-mentioned purpose, the present application provides a primer combination for PCR for identifying human gender, which has good specificity and high amplification efficiency, can be well applied to the identification of human gender, avoids the appearance of false negatives, and improves the accuracy of identification.

[0006] The first object of the present application is to provide a primer combination for PCR for identifying human gender, which comprises a first primer pair and a second primer pair, wherein the first primer pair comprises the nucleotide sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 7, and the second primer pair comprises the nucleotide sequences as shown in SEQ ID NO: 13 and SEQ ID NO: 14.

[0007] Generally speaking, the specificity of each additional nucleotide primer is increased by 4 times, so that the shortest primer length for most applications is 18 nucleotides. The upper limit of the primer length is not very important, and is mainly related to the reaction efficiency. Generally, the G+C content in the sequence of the primer is generally 40%-60%, and the GC content and Tm value of a pair of primers should be coordinated. The G+C content of the primers in the primer combination of the present application is controlled within a suitable range, and the base distribution is random, so that the melting temperature is moderate, facilitating amplification.

[0008] Preferably, the target fragment amplified by the first primer pair is the nucleotide sequence as shown in SEQ ID NO: 16, and the target fragment amplified by the second primer pair is the nucleotide sequence as shown in SEQ ID NO: 15.

[0009] The second object of the present application is to provide a method for identifying human gender, which specifically comprises the following steps: extracting DNA of a sample to be detected as a template, performing PCR amplification on the DNA by using a first primer pair and a second primer pair, performing electrophoresis analysis on the PCR product after the amplification reaction is completed, and identifying the result as male when two bands of the PCR product appear, and identifying the result as female when only one band appears.

[0010] The identification method is simple in operation, high in identification efficiency, and has high sensitivity, specificity, accuracy and applicability, and can be well applied to the identification of human gender, and is very suitable for wide popularization and application.

[0011] Preferably, if the DNA of the sample to be detected appears one band of 403 bp, it is female, and if the DNA of the sample to be detected appears bands of 403 bp and 248 bp at the same time, it is male.

[0012] Preferably, in the PCR reaction, the DNA concentration is 15 ng-15 pg / μl.

[0013] Preferably, in the PCR reaction, the primer concentration is 5-20 μmol / L.

[0014] A third object of the present application is to provide a gene for identifying human gender, which comprises a nucleotide sequence as shown in SEQ ID NO: 15 and a nucleotide sequence as shown in SEQ ID NO: 16. The selected object amplification fragment of the present application has better specificity, and the use of the object fragment in combination with the primer of the present application can improve the sensitivity and accuracy of amplification, and the highest sensitivity can amplify a DNA template with a DNA concentration of only 15 pg / μl.

[0015] A fourth object of the present application is to provide a kit for identifying human gender, comprising a primer combination for identifying the above-mentioned gene.

[0016] Preferably, the primer combination comprises a first primer pair and a second primer pair, the first primer pair comprising nucleotide sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 7, and the second primer pair comprising nucleotide sequences as shown in SEQ ID NO: 13 and SEQ ID NO: 14.

[0017] A fifth object of the present application is to provide the primer combination of the PCR for identifying human gender or the use of the above-mentioned gene in identifying human gender.

[0018] Compared with the prior art, the present application has the following beneficial effects: (1) the primer combination of the PCR for identifying human gender of the present application has good specificity and high amplification efficiency, and can be well applied to the identification of human gender; (2) the identification method of the present application is simple and efficient, and has high sensitivity, specificity, accuracy and applicability; (3) the accuracy of the identification method of the present application can reach 100%. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 The electropherogram of the PCR amplification result of primer pair 1 designed for the present application.

[0020] Figure 2 The electropherogram of the PCR amplification result of primer pair 2 designed for the present application.

[0021] Figure 3 The electropherogram of the PCR amplification result of primer pair 3 designed for the present application.

[0022] Figure 4 The electropherogram of the PCR amplification result of primer pair 4 designed for the present application.

[0023] Figure 5 The electropherogram of the PCR amplification result of primer pair 5 designed for the present application.

[0024] Figure 6The electrophoretogram of PCR amplification result of primer pair 6 designed for the present application.

[0025] Figure 7 The electrophoretogram of PCR amplification result of primer pair 7 designed for the present application.

[0026] Figure 8 The electrophoretogram of PCR amplification result of primer pair 8 designed for the present application.

[0027] Figure 9 The electrophoretogram of PCR amplification result of primer pair 9 designed for the present application.

[0028] Figure 10 The electrophoretogram of PCR amplification result of primer pair 10 designed for the present application.

[0029] Figure 11 The result of verification experiment of primer pair 8 designed for the present application.

[0030] Figure 12 The result of PCR band display of 48 human peripheral blood samples

[0031] Figure 13 The electrophoretogram of PCR amplification result of primer pair 8 designed for the present application.

[0032] Figure 14 The electrophoretogram of PCR amplification result of primer pair 8 designed for the present application. DETAILED DESCRIPTION

[0033] In order to more clearly and concisely show the technical solutions, objects and advantages of the present application, the technical solutions of the present application will be described in detail below with specific examples. Unless otherwise specified, the reagents involved in the examples of the present application are all commercially available products, which can be purchased through commercial channels.

[0034] Example 1 Identification of X, Y chromosome fragments, screening, primer design and optimization

[0035] According to the selected fragments on Y and X chromosomes, the present application designs primers. Seven primers (three forward sequences and four reverse sequences) are designed on Y chromosome, and seven primers (three forward sequences and four reverse sequences) are designed on X chromosome. The specific primer sequences are as follows in Table 1:

[0036] Table 1 Designed primer sequences

[0037]

[0038]

[0039] According to the designed primer sequence and the size of the target product, 10 pairs of primers (each pair including a forward primer and a reverse primer on X; a forward primer and a reverse primer on Y) are designed, and the specific combinations and corresponding product sizes are shown in Table 2.

[0040] Table 2: Designed primer pair combinations

[0041]

[0042]

[0043] 1) Preparation of DNA template: Peripheral blood of healthy men and women is taken, and blood DNA is extracted using a whole blood genomic DNA rapid extraction kit to obtain male and female DNA, respectively. The male and female DNA is diluted to seven concentrations of 50 ng / μl, 5 ng / μl, 0.5 ng / μl, 50 pg / μl, 5 pg / μl, 2.5 pg / μl, and 0.5 pg / μl, respectively.

[0044] 2) Ordinary PCR: The above seven concentrations of DNA are used as templates, and the above ten pairs of primer combinations are added simultaneously to perform PCR amplification; the reaction system is performed according to the instructions of the Easy Taqmix kit: the PCR reaction uses a 20 μl system, and the DNA template amount of each reaction system is 50 ng, 5 ng, 0.5 ng, 50 pg, 5 pg, 2.5 pg, and 0.5 pg, respectively; the amount of forward and reverse primers is 10 μmol, the amount of Easy Taqmix is 10 μl, and the volume is made up to 20 μl with RNase-free and DNase-free water. The PCR reaction program is shown in Table 3.

[0045] Table 3: PCR reaction program

[0046] 1 95℃ 3:00 2 95℃ 0:30 3 55℃ 0:30 4 72℃ 0:30 5 GoTo step 2 37× 6 72℃ 3:00 7 4℃ ∞

[0047] 3) Result analysis and determination

[0048] The PCR amplification results are shown in Table 4: Figures 1-10 Under the conditions of template amounts of 50 ng, 5 ng, 0.5 ng, 50 pg, 5 pg, 2.5 pg, and 0.5 pg, the primer pair for amplifying the A fragment and the primer pair for amplifying the B fragment of the present application have obvious amplification effects on the template DNA in the same reaction system, and the female is a single band a, and the male has a band b based on the band a. As shown in the figure, Figure 8)It can be seen that the primer pair 8 amplifies a 403bp band for female, and if 403bp and 248bp bands appear simultaneously, it is male. The band is clear and definite, and there is less mixed band, and at 50pg, clear band is amplified. Therefore, the primer pair 8 selected in the application is used for detecting the accuracy and sensitivity of identification, and the amplification of the A fragment on the X chromosome and the B fragment on the Y chromosome is carried out, so that the detection result is reliable, and the sample source individual gender can be accurately identified in one PCR reaction.

[0049] Example 2

[0050] The following detection uses the primer pair 8 as the detection primer pair, and the primer sequence and the amplification product fragment for amplification are as follows:

[0051] 1. Selected amplified target fragment:

[0052] The selected A fragment on the human X chromosome is used as the target fragment for amplification, and the nucleotide sequence is as follows:

[0053] CATTCCAGCTTCACCATTGGCTttcctgacacagagcctactcagtggaa

[0054] aacgccttgctgtcatgcgttccaagaaggtgatggtgccatacaacatg

[0055] tagcagcaggagcaaaaccaagcatctctcccgggctttgtggtttcctc

[0056] cgctggtatcacaaagctggagggagactgcagggaaaggcacactctcc

[0057] aaggtaactctgagaactgctttgaggagcaggagaaaatcatctgagta

[0058] tcaaaatactaggtcttctggaaacagaatgtaacacagagcttgttata

[0059] caggtgatacactgaggaggtgctctcaggagaaactcagatggggttat

[0060] caggcaaaacaagggaaaagaagataccaaggAGTCTCAGCCTGATCCCA

[0061] CAG (SEQ ID NO: 15).

[0062] A single fragment of human Y chromosome was selected as B fragment as the target fragment for amplification, and its nucleotide sequence is as follows:

[0063] GTTTGCGCAAGGAATTCGCTGCagcatataaaactttcaggaccctgaaa

[0064] tacagaactgcaaagaaacggcctaagatggttgaatgctctttattttt

[0065] ctttaatttagacatgttcaaacgttcaatgtcttacatacttagttatg

[0066] taagtaaggtagcgcttacttcattatgcatttcaatactcaaaaaaaat

[0067] tcctttgtgaaatgttgaaatattttTCTAATCTGTTTCACGAGCTTC

[0068] (SEQ ID NO: 16).

[0069] 2. Selection of primers

[0070] According to the above amplification results, the primer pair 8 is selected to amplify the fragments A and B, and the information is shown in Table 4.

[0071] Table 4 Primer information

[0072]

[0073] 3. Verification of the effect of the primers and the target gene of the application on gender identification

[0074] 1) Preparation of DNA template: peripheral blood of healthy male and female was taken, and blood DNA was extracted by using a whole blood genomic DNA rapid extraction kit to obtain male and female DNA respectively. The male and female DNA was diluted to 2 ng / μl respectively.

[0075] 2) Conventional PCR: Using the three DNA concentrations mentioned above as templates, primer pairs (13,14) for the X chromosome A fragment and (5,7) for the Y chromosome B fragment were added simultaneously for PCR amplification. The reaction system was performed according to the Easy Taqmix kit instructions: 20 μl of PCR reaction solution was used, with 2 ng of DNA template, 10 μmol of both forward and reverse primers, and 10 μl of Easy Taqmix. The volume was brought to 20 μl with RNase- and DNase-free purified water. The PCR reaction procedure is shown in Table 5 below.

[0076] Table 5: PCR reaction procedure

[0077]

[0078]

[0079] 3) Results Analysis and Judgment

[0080] Therefore, (as shown) Figure 11 The target gene fragment B selected in this invention is a male-specific gene, which exists only in the male genome. Therefore, the band designed for fragment B can only be amplified to 248 bp. Fragment A is a human-specific gene, which exists in both the male and female genomes. Therefore, in a reaction system where both pairs of primers are present, primer B cannot amplify a band because the female sample does not contain fragment B.

[0081] Example 3 Accuracy Experiment

[0082] Forty-eight human peripheral blood samples were collected for testing. DNA template preparation followed the method described in Example 2. The sex of these samples was determined by PCR using primer pair 8 of this invention, verifying the accuracy of the primers and the selected target gene. The DNA concentration in the samples was 2 ng / μl in this experiment, and the PCR process followed Example 1. The results are shown in Table 6 and... Figure 12 As shown:

[0083] Table 6: PCR target band display results of 48 human peripheral blood samples ( Figure 12 )

[0084]

[0085]

[0086] Note: "+" in the table indicates that the target band can be amplified.

[0087] From the above table 6 and Figure 12As can be seen, the present invention achieves a 100% success rate and 100% accuracy rate when the DNA template concentration is 2 ng / μl.

[0088] Example 4 Sensitivity Experiment

[0089] Peripheral blood samples (male and female) were collected for testing and divided into control and experimental groups. The control group used primers from patent application number 90102940.8 for PCR to identify the sex of the samples. The experimental group used primer pair 8 and the method from Example 2 for PCR to identify the sex of the samples. The DNA concentrations in the control and experimental groups were set as follows: 15 ng / μl, 1.5 ng / μl, 0.15 ng / μl, 15 pg / μl, 1.5 pg / μl, and 0.15 pg / μl, respectively. The results are shown in Table 7. Figure 13 , 14 As shown:

[0090] Table 7: Results of PCR target band display at different concentrations ( Figure 13 , 14 )

[0091]

[0092] Note: In the table, "+" indicates that the target band can be amplified, and "-" indicates that the target band cannot be amplified.

[0093] From the above table and Figure 13 , 14 It can be seen that when the DNA template concentration is 0.15 pg / μl, the primers used to identify the male fragment in the control group failed to amplify the target band in male samples. Similarly, at concentrations of 15 ng / μl and 1.5 ng / μl, the primers used to identify the female fragment in the control group failed to amplify the target band in female samples. At concentrations of 0.15 ng / μl, 15 pg / μl, 1.5 pg / μl, and 0.15 pg / μl, the control group could still amplify the male fragment in female samples, but the identification results were unclear. However, the primer set of this invention could still amplify the target band, even at a DNA template concentration of 15 pg / μl, and the target band was clearly and distinctly amplified with few extraneous bands. This demonstrates that the selection of the target gene and the design of the primers both affect the sensitivity of amplification. In the control group, primers used to amplify human-specific genes could only amplify a 124bp target band, while primers used in this invention could amplify a 403bp target band, which is more stable and improves sensitivity compared to the control group. Since male-specific genes exist only in the male genome and not in the female genome, the amplified target fragment can be appropriately shortened, thus shortening the reaction time and saving reaction time.

[0094] In summary, the primers, kits, and methods provided by this invention can accurately identify the sex of human individuals and human cell lines. They are simple to operate, highly sensitive, highly specific, produce clear results, and require little DNA sample, thus showing promising application prospects.

[0095] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention. sequence list <110> Zhongshan Ophthalmic Center of Sun Yat-sen University <120> A reagent kit for identifying human sex <160> 16 <170> PatentIn version 3.3 <210> 1 <211> twenty two <212> DNA <213> Artificial sequence <400> 1 ggaatgttgc tggcaagaca ct 22 <210> 2 <211> twenty one <212> DNA <213> Artificial sequence <400> 2 gtggacttta cgaaccaacc t 21 <210> 3 <211> twenty two <212> DNA <213> Artificial sequence <400> 3 gatgagcaac agttgtgaca gt 22 <210> 4 <211> twenty one <212> DNA <213> Artificial sequence <400> 4 gcaccaaagg tcatttgtgg t 21 <210> 5 <211> twenty two <212> DNA <213> Artificial sequence <400> 5 gtttgcgcaa ggaattcgct gc 22 <210> 6 <211> twenty one <212> DNA <213> Artificial sequence <400> 6 gaagtaagcg ctaccttact t 21 <210> 7 <211> twenty two <212> DNA <213> Artificial sequence <400> 7 gaagctcgtg aaacagatta ga 22 <210> 8 <211> twenty one <212> DNA <213> Artificial sequence <400> 8 gtgcacccaa ccgtagtcca t 21 <210> 9 <211> twenty two <212> DNA <213> Artificial sequence <400> 9 gatcatgata cctgcccaac at 22 <210> 10 <211> twenty three <212> DNA <213> Artificial sequence <400> 10 cactggagtc tgcatctccc aat 23 <210> 11 <211> twenty three <212> DNA <213> Artificial sequence <400> 11 ctgcagatct cagagtcttc tgt 23 <210> 12 <211> twenty one <212> DNA <213> Artificial sequence <400> 12 gagtacggat tatcctcagc t 21 <210> 13 <211> twenty two <212> DNA <213> Artificial sequence <400> 13 cattccagct tcaccattgg ct 22 <210> 14 <211> twenty one <212> DNA <213> Artificial sequence <400> 14 ctgtgggatc aggctgagac t 21 <210> 15 <211> 403 <212> DNA <213> Artificial sequence <400> 15 cattccagct tcaccattgg ctttcctgac acagagccta ctcagtggaa aacgccttgc 60 tgtcatgcgt tccaagaagg tgatggtgcc atacaacatg tagcagcagg agcaaaacca 120 agcatctctc ccgggctttg tggtttcctc cgctggtatc acaaagctgg agggagactg 180 cagggaaagg cacactctcc aaggtaactc tgagaactgc tttgaggagc aggagaaaat 240 catctgagta tcaaaatact aggtcttctg gaaacagaat gtaacacaga gcttgttata 300 caggtgatac actgaggagg tgctctcagg agaaactcag atggggttat caggcaaaac 360 aagggaaaag aagataccaa ggagtctcag cctgatccca cag 403 <210> 16 <211> 248 <212> DNA <213> Artificial Sequence <400> 16 gtttgcgcaa ggaattcgct gcagcatata aaactttcag gaccctgaaa tacagaactg 60 caaagaaacg gcctaagatg gttgaatgct ctttattttt ctttaattta gacatgttca 120 aacgttcaat gtcttacata cttagttatg taagtaaggt agcgcttact tcattatgca 180 tttcaatact caaaaaaaat tcctttgtga aatgttgaaa tatttttcta atctgtttca 240 cgagcttc 248

Claims

1. A primer combination for PCR to identify human sex, characterized in that, The primer pair includes a first primer pair and a second primer pair, wherein the first primer pair is a nucleotide sequence as shown in SEQ ID NO:5 and SEQ ID NO:7, and the second primer pair is a nucleotide sequence as shown in SEQ ID NO:13 and SEQ ID NO:

14.

2. The primer combination as described in claim 1, characterized in that, The target fragment amplified by the first primer pair is the nucleotide sequence shown in SEQ ID NO:16; the target fragment amplified by the second primer pair is the nucleotide sequence shown in SEQ ID NO:

15.

3. A method for determining a person's gender, characterized in that, Includes the following steps: DNA was extracted from the sample to be tested and used as a template. The DNA was then amplified by PCR using the first primer pair and the second primer pair as described in claim 1. After the amplification reaction was completed, the PCR products were analyzed by electrophoresis. The results showed that when two bands appeared in the PCR product, the result was male, and when only one band appeared, the result was female.

4. The method for determining a person's gender as described in claim 3, characterized in that, If a 403bp band appears in the DNA of the sample being tested, the sample is female; if both 403bp and 248bp bands appear, the sample is male.

5. The method for determining a person's gender as described in claim 3, characterized in that, In the PCR reaction, the DNA concentration was 15 ng to 15 pg / μl.

6. The method for determining a person's gender as described in claim 3, characterized in that, In the PCR reaction, the primer concentration is 5–20 μmol / L.

7. A reagent kit for identifying human sex, characterized in that, Includes primer combinations for PCR identification of human sex as described in any one of claims 1-2.

8. The application of the primer combination for identifying human sex as described in claim 1 in the identification of human sex.

Citation Information

Patent Citations

  • High sensitive identification process for human sex

    CN1049602A