A multiplex fluorescent detection primer probe set and kit for novel coronavirus omicron variant

Abstract

The application provides a multiplex fluorescence detection primer probe set and kit for the novel coronavirus omicron variant. The application has the following technical effects: 1. Low cost, the total reagent cost of a single specimen is 12 yuan. 2. Short detection time and simple operation, the experimental operation required by the application is more simple, and general reagents plus the primer probe working solution of the application can be detected on a machine, and can simultaneously judge SARS-CoV-2 infection and whether the omicron variant infection, the total detection time is about 1.5 hours. Simple operation process, conventional fluorescence detection instrument equipment, and the grass-roots unit can also carry out. 3. High sensitivity, which can be applied to environmental specimen detection, environmental specimen quantity is large, and virus load is low, which causes great difficulty to detection work. Due to the low virus load of the environmental sample, it is difficult to carry out high-throughput sequencing, and the method of the application can also be qualitative to the omicron variant when detecting the environmental sample.

Description

TECHNICAL FIELD

[0001] The application relates to a multiplex fluorescence detection primer probe set and kit for a new coronavirus omicron variant, and belongs to the technical field of biology. BACKGROUND

[0002] Currently, it is found that, compared with wild strains or other VOCs, the omicron variant has more mutations and a fast mutation speed (there are currently four types of BA.1, BA.2, BA.3 and BA.1.1, and all have been detected in China), and is likely to have stronger infectivity and immune escape ability than the Delta mutant strain, reduce the efficacy of vaccines and neutralizing antibodies, and increase the risk of reinfection, which poses new challenges to global epidemic prevention and control. Therefore, rapid detection of omicron variant infection and timely prevention and control have become urgent problems to be solved. However, the current mainstream detection method is high-throughput sequencing, which is high in economic cost and long in time. At the same time, individual fluorescence detection kits are low in throughput, high in cost and complex in operation, and need to detect the new coronavirus positive in advance, and then use the kit for special omicron variant detection. For the above reasons, many grassroots detection units are difficult to carry out omicron detection at the first time, which delays the valuable prevention and control time and the formulation of prevention and control strategies.

[0003] The currently marketed omicron fluorescence detection kit detects specific several mutation sites, is expensive, costs about 10000 yuan for 50 people, and the reagent cost of a single specimen is 200 yuan. In addition, the high-throughput sequencing method is more expensive, and the reagent cost of a single specimen is 2000 yuan.

[0004] The existing omicron fluorescence kit is complex in operation. The SARS-CoV-2 fluorescence detection needs to be carried out first, and when the SARS-CoV-2 fluorescence is positive, the kit is used to detect the omicron variant site, and when the fluorescence of several mutation sites is positive, it can be determined that the specimen is infected with the omicron variant. The total detection time is about 4 hours. The high-throughput sequencing time is as long as 20 hours.

[0005] Chinese patent CN202111497771.2 provides a new coronavirus omicron mutation sequence detection technology based on multiplex fluorescence quantitative ARMS-PCR technology and its application, which mainly detects the specific mutation types of the S gene of the current omicron variant, such as sequence position 23599, sequence change T>G, sequence position 23048, sequence change G>A, sequence position 23202, sequence change C>A, sequence position 22898, sequence change G>A, in a single tube or multiple tubes.

[0006] Although the Chinese patent CN202111497771.2 provides a technical solution for detecting Omicron mutant sequences based on multiplex fluorescent quantitative ARMS-PCR technology, it still has the following technical problems: 1) it detects individual mutant sites in the S region, while the S region is the most active gene region of SARS-CoV-2 mutation, and the mutation rate of Omicron is much higher than that of other variants, so when the nucleotide of the target site is mutated, detecting only a single site may cause false negatives; 2) the patent application date is December 2021, at which time there are few Omicron variants, and only one type of BA.1, but by February 10, 2022, there have been four types of BA.1, BA.2, BA.3 and BA.1.1 globally, with significant variations between each type, making it difficult to guarantee the effectiveness of the technology; 3) it is necessary to first detect SARS-CoV-2 positive using other kits, and then use the kit to determine whether it is an Omicron infection, which is cumbersome and expensive. SUMMARY

[0007] The purpose of the present application is to overcome the shortcomings of the prior art and provide a multiplex fluorescent detection primer probe set and kit for the Omicron variant of the new coronavirus.

[0008] The inventors of the present application have designed a multiplex fluorescent detection primer probe set and kit for the Omicron variant, which can simultaneously detect three gene fragments of SARS-CoV-2, namely the ORF1a / b gene and N gene for judging SARS-CoV-2 infection, and the S gene for judging Omicron variant infection. Among them, the ORF1a / b gene and N gene primers for judging SARS-CoV-2 infection are designed by researchers from the U.S. Centers for Disease Control and Prevention and the University of Anglia, Rose Gold, and the S gene primers for detecting Omicron variant infection are designed by the inventors. The S-F primer is located at the 22976-22996 nucleotide site of the whole genome, the S-R primer is located at the 23058-23078 nucleotide site of the whole genome, and the S-Probe primer is located at the 22998-23023 nucleotide site of the whole genome.

[0009] In the present application, the nucleotide sequence of the multiplex fluorescent detection primer probe set for the Omicron variant of the new coronavirus is shown in the following table:

[0010] Name Sequence Modification ORF1a / b-F GGATCAAGAATCCTTTGGTGG ORF1a / b-R GTCACAAAATCCTTTAGGATTTGGA ORF1a / b-Probe CATCGTGTTGTCTGTACTGCCGTTGCC 5'FAM / BHQ1 3' N-F GACCCCAAAATCAGCGAAAT N-R TCTGGTTACTGCCAGTTGAATCTG N-Probe ACCCCGCATTACGTTTGGTGGACC 5'VIC / BHQ1 3' S-F ACTGAAATCTATCAGGCCGGT S-R CAACACCATAAGTGGGTCGGA S-Probe ACAAACCTTGTAATGGTGTTGCAGGT 5'CY5 / BHQ2 3'

[0011] Among them,

[0012] The fluorescent probe is an oligonucleotide probe, and a fluorescent group is connected to the 5' end of the probe, and a quenching group is connected to the 3' end of the probe. The detection ORF1a / b gene fluorescent group is FAM, and the quenching group is BHQ1. The detection N gene fluorescent group is VIC, and the quenching group is BHQ1. The detection S gene fluorescent group is CY5, and the quenching group is BHQ2.

[0013] The application also provides a multiplex fluorescent detection kit for the Omicron variant of the new coronavirus, comprising the multiplex fluorescent detection primer probe set for the Omicron variant of the new coronavirus described above.

[0014] Further, the kit further comprises a multiplex fluorescent detection reagent, which can be a multiplex fluorescent detection reagent commonly used in the market, such as the HiScript II U+One Step qRT-PCR Probe Kit reagent produced by Nanjing Novozyme.

[0015] The application also provides a preparation method of the primer probe set working solution of the application, comprising the following steps:

[0016] 1) The synthesized primer probe dry powder is prepared into a working concentration of 10 micromoles per liter by adding RNase-free water.

[0017] 2) The primer probe sets for detecting the ORF1a / b gene, the N gene and the S gene are respectively configured into three kinds of probe primer mixtures according to the volume ratio of the upstream primer: the downstream primer: the probe is 2:2:1; in the application, the volume ratio of the upstream primer: the downstream primer: the probe is 400:400:200 (muL).

[0018] 3) Finally, the three kinds of probe primer mixtures are mixed in equal volume to prepare the primer probe working solution.

[0019] In detection, the commonly used multiplex fluorescent detection reagent plus the primer probe working solution of the application can be detected on the machine, and can simultaneously judge SARS-CoV-2 infection and whether the Omicron variant infection.

[0020] The object of the present application is achieved by the following technical solutions: PCR primers and fluorescent Taqman probes are designed for the gene-conserved sequence of specific omicron variants. A nucleotide probe with fluorescent dye groups at both ends is added to the conventional PCR, wherein the fluorescent group is at the 5' end and the quencher group is at the 3' end, forming an energy transfer structure. When the probe is complete, the fluorescent group is inhibited by the quencher group and no fluorescence is generated. When the probe binds to the target sequence, the upstream primer will extend to this position, and under the action of exonuclease, the probe is hydrolyzed, the fluorescent group releases the fluorescence signal and is collected and detected by the instrument, thereby prompting the presence of the target sequence. The inventor also adds fluorescent probe primer sequences for judging SARS-CoV-2 infection of ORF1a / b gene and N gene, thereby forming a combination, which uses the real-time, high-sensitivity and good specificity of fluorescent PCR technology to intuitively and quickly judge SARS-CoV-2 infection and omicron variant infection at the end of the reaction or even before the end. In addition, the S gene fluorescent group selects CY5 and the quencher group selects BHQ2 instead of BHQ1, which improves the stability and amplification efficiency.

[0021] The multiplex fluorescent detection primer probe set and kit for omicron variants of the present application have the following technical effects:

[0022] 1. Low cost.

[0023] In the primer synthesis, only the probe is slightly more expensive, there are 6 primers and 3 probes for the three genes, the synthesis of each primer only costs dozens of yuan, the probe costs about 1500 yuan, and the total synthesis cost is about 5000 yuan. According to the calculation of the lowest 1 OD amount, 1200 specimens can be detected, and the cost of each specimen is about 4 yuan. The reagent kit is a general multiplex fluorescent detection kit, and 100 people cost about 800 yuan, and the cost of each specimen is about 8 yuan. Therefore, the total reagent cost of a single specimen is 12 yuan. The currently marketed omicron fluorescent detection kit detects specific several mutation sites, and the cost is expensive, 50 people cost about 10000 yuan, and the reagent cost of a single specimen is 200 yuan, which is 16 times that of the present application. In addition, the cost of high-throughput sequencing method is higher, and the reagent cost of a single specimen is 2000 yuan. In the present application, the HiScript II U+One Step qRT-PCR Probe Kit reagent kit produced by Nanjing Nuowei is selected. The reagent kit is for 100 people, and the inventor reduces the original amount by one-third, and the result still has no obvious change, so the 100-person reagent kit can detect 300 specimens, and the actual cost is lower.

[0024] 2. Short detection time and simple operation

[0025] The existing Omicron fluorescent kit is complex in operation. The fluorescence detection of SARS-CoV-2 needs to be carried out first, and when the SARS-CoV-2 fluorescence is positive, the kit is used to detect the Omicron mutation site, and when the fluorescence of several mutation sites is positive, it can be determined that the sample is infected with the Omicron variant, and the total detection time is about 4 hours. Compared with the fluorescent kit for detecting the Omicron mutation site, the present application needs simpler experimental operation, and the general reagent plus the primer probe working solution of the present application can be detected on the machine, and SARS-CoV-2 infection and whether the Omicron variant infection can be judged at the same time, and the total detection time is about 1.5 hours. The high-throughput sequencing time is as long as 20 hours. In terms of result judgment, it is one glance, and only the cycle number (Ct value) of three channels needs to be observed. Simple operation process, conventional fluorescence detection instrument equipment, and the grass-roots unit can also carry out.

[0026] 3. High sensitivity, good specificity, good repeatability, and capable of being applied to environmental sample detection

[0027] The present application is designed based on the S region sequence of all Omicron genotypes appearing in the world at present, and theoretically can detect all types of Omicron variants. In practical application, the inventors have detected all Omicron variants in Jiangsu (including BA.1, BA.2 and BA.1.1 three types), and at the same time, Alpha (B.1.1.7) variant and Delta (B.1.617.2) variant are used as controls, and the results show that the sensitivity and specificity are both 100%. In the rechecking of new coronavirus samples every week, it is found that the results are completely consistent with the sequencing results, showing good stability and repeatability. In addition, the most important place to reflect the sensitivity advantage is the detection of environmental samples. The amount of environmental samples is large, and the viral load is low, which causes great difficulty in detection work. Due to the low viral load of environmental samples, it is difficult to carry out high-throughput sequencing, but the current situation is that there is environmental pollution basically where there is an infected person, and it is impossible to sequence whether it is an Omicron variant infection. The method of the present application can detect the Omicron variant infection when detecting environmental samples, and the detection results are completely consistent with the results of epidemiological tracing investigation, and the sensitivity and specificity are both 100%. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 The detection results of the sample of the patient of the Alpha variant B.1.1.7 type.

[0029] Figure 2 The detection results of the sample of the patient of the Delta variant B.1.617.2 type.

[0030] Figure 3 The detection results of the sample of the patient of the Omicron variant BA.1 type.

[0031] Figure 4 Detection results of patient samples of BA.2 type of Omicron variant.

[0032] Figure 5 Detection results of patient samples of BA.1.1 type of Omicron variant.

[0033] Figure 6 Detection results of environmental samples 1 (Delta variant infection).

[0034] Figure 7 Detection results of environmental samples 2 (Omicron variant infection).

[0035] Figure 8 Specificity verification results (influenza virus, enterovirus, rotavirus and norovirus).

[0036] Figure 9 Comprehensive comparison results of patient samples of Delta variant B.1.617.2 type, patient samples of Omicron variant BA.1.1 type and environmental samples of Omicron variant infection. DETAILED DESCRIPTION

[0037] The following are specific embodiments of the present application and further describe the technical solutions of the present application in conjunction with the accompanying drawings, but the present application is not limited to these embodiments.

[0038] Example 1

[0039] 1. Design of primer probe:

[0040] The inventors searched and downloaded literature on fluorescent detection of the new coronavirus since 2020, synthesized corresponding probe primers for experimental detection, and finally selected the ORF1a / b gene primer designed by the US CDC and the N gene primer designed by researchers at the University of Anglia, Rose Gold, UK, among 11 sets of amplification primers for ORF1a / b and N genes, which had the best amplification effect.

[0041] The Omicron variant detection primer designed by the inventors was designed by downloading all genotypes of Omicron sequences (including BA.1, BA.2, BA.3 and BA.1.1 four types), and analyzing 26 gene fragments. Finally, 20 pairs of primer probes were designed in the S region, and 10 pairs of primer probes were designed in the N region. The above primer probes were subjected to specific comparison analysis by NCBI BLAST online database. The primers with high PCR efficiency, high sensitivity, good specificity, and good stability were screened, and finally one pair of S region primers and corresponding probe sequences for judging Omicron variant infection were obtained. At the same time, the quencher group was replaced by BH2 from BH1 to improve its stability and amplification efficiency.

[0042] Table 1 Primer probe sequence of multiplex fluorescent detection of Omicron variant

[0043]

[0044]

[0045] 2. The kit for multiplex fluorescent detection of Omicron variant

[0046] The kit for multiplex fluorescent detection of Omicron variant comprises the primer probe set and the multiplex fluorescent detection reagent. The multiplex fluorescent detection reagent can be selected from the multiplex fluorescent detection reagents currently available on the market. In the present application, the HiScript II U+One Step qRT-PCR Probe Kit produced by Nanjing Novozyme is selected.

[0047] The primer probe set is configured as a primer probe working solution, and the configuration method is as follows:

[0048] 1) The primer probe synthesis dry powder is prepared into a working concentration of 10 micromoles per liter by adding RNase-free water.

[0049] 2) The primer probe mixture is configured according to the volume ratio of upstream primer: downstream primer: probe, which is 2:2:1. In the present application, the volume ratio is 400:400:200 (μL).

[0050] 3) Finally, the three mixtures are mixed in equal volume to prepare the primer probe working solution.

[0051] In the detection, the general multiplex fluorescent detection reagent is added to the prepared primer probe working solution, and the machine detection can be performed, and the SARS-CoV-2 infection and the Omicron variant infection can be simultaneously judged.

[0052] 3. The detection process is as follows:

[0053] 3.1 System configuration

[0054] The experimental system is configured in the system configuration room. The multiplex fluorescent detection reagent kit currently available on the market can be selected. In the present application, the HiScript II U+One Step qRT-PCR Probe Kit produced by Nanjing Novozyme is selected. The system configuration is shown in Table 2:

[0055] Table 2 PCR reaction system

[0056]

[0057]

[0058] After the system is prepared, shake well, centrifuge, and aliquot 10 μL per person into a PCR reaction tube.

[0059] 3.2 Sample processing

[0060] Add 2.5 μL of the nucleic acid sample to be tested, positive control and negative control to the prepared PCR reaction tube in the sample chamber, with a final volume of 12.5 μL, cover the tube cap, shake and centrifuge. The sample is a new coronavirus nucleic acid owned by the inventor's laboratory, including three types of Omicron variants BA.1, BA.2 and BA.1.1, other types including Alpha variant B.1.1.7 and Delta variant B.1.617.2, and patient specimens and external environment specimens. In addition, it also includes nucleic acid samples for specific detection of influenza virus, enterovirus, rotavirus and norovirus. The positive control is a sequencing successful Omicron variant BA.1 nucleic acid. The negative control is RNase-free water.

[0061] 3.3 PCR amplification

[0062] Place the PCR reaction tube into the ABI QuantStudio Q5 fluorescent quantitative PCR instrument for amplification and detection, without selecting ROX correction. The fluorescent groups are FAM, VIC and CY5. The cycle parameters are set as shown in Table 3:

[0063] Table 3 Reaction program

[0064]

[0065] 3.4. Result analysis

[0066] The negative control has no fluorescent curve, and the positive control has three smooth curves. The specimen fluorescent curve is smooth and the cycle number (Ct value) is less than 38, which is determined as positive, otherwise it is negative. When only one of FAM and VIC is Ct≤38, whether CY5 is Ct≤38 or not, retesting is required. The specific determination results are shown in Table 4:

[0067] Table 4 Result determination

[0068]

[0069]

[0070] (1) The detection results of the patient sample of the Alpha variant B.1.1.7 type, FAM and VIC channels appear curves and Ct≤38, indicating SARS-CoV-2 infection, but not Omicron variant. See Figure 1

[0071] (2) Delta variant B.1.617.2 type patient sample detection results, FAM and VIC channels appear curve and Ct≤38, indicating SARS-CoV-2 infection, but not Omicron variant. See Figure 2

[0072] (3) Omicron variant BA.1 type patient sample detection results, FAM, VIC and CY5 channels appear curve and Ct≤38, indicating SARS-CoV-2 infection, and is Omicron variant. See Figure 3

[0073] (4) Omicron variant BA.2 type patient sample detection results, FAM, VIC and CY5 channels appear curve and Ct≤38, indicating SARS-CoV-2 infection, and is Omicron variant. See Figure 4

[0074] (5) Omicron variant BA.1.1 type patient sample detection results, FAM, VIC and CY5 channels appear curve and Ct≤38, indicating SARS-CoV-2 infection, and is Omicron variant. See Figure 5

[0075] (6) Environmental sample detection results 1 (Delta variant infection), FAM and VIC channels appear curve and Ct≤38, indicating SARS-CoV-2 infection, but not Omicron variant. See Figure 6

[0076] (7) Environmental sample detection results 2 (Omicron variant infection), FAM, VIC and CY5 channels appear curve and Ct≤38, indicating SARS-CoV-2 infection, and is Omicron variant. See Figure 7

[0077] (8) Specific verification (influenza virus, enterovirus, rotavirus and norovirus), FAM, VIC and CY5 channels have no curve, indicating that the primer combination of the application does not react with other virus nucleic acids. See Figure 8

[0078] (9) The comprehensive comparison results of patient samples of Delta variant B.1.617.2 type, patient samples of Omicron variant BA.1.1 type and environmental samples infected with Omicron variant, the FAM and VIC channels of patient samples of Delta variant B.1.617.2 type appear curves and Ct≤38, indicating SARS-CoV-2 infection; the FAM, VIC and CY5 channels of patient samples of Omicron variant BA.1.1 type and environmental samples infected with Omicron variant appear curves and Ct≤38, indicating SARS-CoV-2 infection and Omicron variant. See Figure 9

[0079] The above examples are only for illustrating the technical concept and characteristics of the present application, and the purpose is to enable those skilled in the art to understand the content of the present application and implement it, and cannot limit the protection scope of the present application. Any equivalent changes or modifications made in accordance with the spirit and essence of the present application shall be covered within the protection scope of the present application. SEQUENCE LISTING <110> Jiangsu Center for Disease Control and Prevention (Jiangsu Provincial Institute for Public Health) <120> A multiplex fluorescent detection primer probe set and kit for Omicron variant of new coronavirus <160> 9 <170> SIPOSequenceListing 1.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <400> 1 ggatcaagaa tcctttggtg g 21 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <400> 2 gtcacaaaat cctttaggat ttgga 25 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <400> 3 catcgtgttg tctgtactgc cgttgcc 27 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 gaccccaaaa tcagcgaaat 20 <210> 5 <211> twenty four <212> DNA <213> Artificial Sequence <400> 5 tctggttact gccagttgaa tctg 24 <210> 6 <211> twenty four <212> DNA <213> Artificial Sequence <400> 6 accccgcatt acgtttggtg gacc 24 <210> 7 <211> twenty one <212> DNA <213> Artificial Sequence <400> 7 actgaaatct atcaggccgg t 21 <210> 8 <211> twenty one <212> DNA <213> Artificial Sequence <400> 8 caacaccata agtgggtcgg a 21 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <400> 9 GAAAGAAGTT GGAACATTTG GGTGATTAAA CTTAACATAT TAATCTCGTT ACGCGAAGA GCTGAC

Claims

1. A multiplex fluorescent detection primer and probe set targeting the Omeprone variant of SARS-CoV-2, characterized in that, The nucleotide sequences of the primer-probe set are shown in the table below: The probe is an oligonucleotide fluorescent probe, with a fluorescent group attached to the 5' end and a quenching group attached to the 3' end. The probe for detecting the ORF1a / b gene has a fluorescent group FAM attached to its 5' end and a quencher group BHQ1 attached to its 3' end. The probe for detecting the N gene has a fluorescent group VIC attached to its 5' end and a quencher group BHQ1 attached to its 3' end. The probe for detecting the S gene has a fluorescent group CY5 attached to its 5' end and a quencher group BHQ2 attached to its 3' end.

2. A multiplex fluorescent detection kit for the Omeprone variant of SARS-CoV-2, characterized in that, Includes the primer-probe set as described in claim 1.

3. The reagent kit according to claim 2, characterized in that, It also includes multiplex fluorescent detection reagents.

4. A method for preparing a primer-probe working solution comprising the primer-probe set as described in claim 1, characterized in that, Includes the following steps: 1) Prepare a working concentration of 10 μmol / L by adding RNase-free water to the synthetic dry powder of each primer and probe. 2) Three primer-probe sets for detecting ORF1a / b, N, and S genes were prepared into three probe-primer mixtures in a volume ratio of upstream primer: downstream primer: probe of 2:2:

1. 3) Finally, the three probe primer mixtures were mixed in equal volumes to prepare the primer probe working solution.

Images