Primer probe combination, kit and method for detecting human alk, ros1 gene fusion

By combining primer and probe combinations with a digital PCR system, the problem of not being able to simultaneously detect human ALK and ROS1 gene fusion mutations in existing technologies has been solved, achieving highly specific and sensitive gene fusion detection and ensuring the accuracy and reliability of the detection results.

CN115466788BActive Publication Date: 2026-02-10HUNAN SHENGZHOU BIOTECHNOLOGY CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202210752586.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-06-28
Publication Date
2026-02-10
Estimated Expiration
2042-06-28

AI Technical Summary

Technical Problem

Currently, there are no detection kits or systems that can simultaneously detect fusion mutations in the human ALK and ROS1 genes, making it difficult for existing technologies to provide accurate medication guidance.

Method used

A primer-probe combination is provided, including primer-probe combination A for specific detection of EML4-ALK fusion gene, primer-probe combination B for ROS1 fusion gene, and primer-probe combination C for internal reference gene. Combined with RT-dPCR reaction system and digital PCR system, a one-step reverse transcription digital PCR reaction and analysis are performed.

Benefits of technology

It achieves high specificity and sensitivity in the detection of ALK and ROS1 gene fusions, improves signal-to-noise ratio and accuracy, prevents false negative results caused by nucleic acid extraction and reaction failures, and has excellent linearity, making it easy to interpret results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003718804470000011
    Figure BDA0003718804470000011
  • Figure BDA0003718804470000021
    Figure BDA0003718804470000021
  • Figure BDA0003718804470000031
    Figure BDA0003718804470000031
Patent Text Reader

Abstract

The present application relates to the field of C12Q1 / 6851, and more particularly, the present application relates to a primer probe combination, a kit and a method for detecting human ALK and ROS1 gene fusion. The primer probe combination comprises at least a primer probe combination A which specifically detects at least one EML4-ALK fusion gene; a primer probe combination B which specifically detects at least one ROS1 fusion gene; and a primer probe combination C which specifically detects an internal reference gene. The primer probe combination and the detection method of the present application have high specificity and sensitivity, improve the signal-to-noise ratio, have good resolution and accuracy, and have excellent linear relationship, so that the result can be easily judged.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of C12Q1 / 6851, and more specifically, to primer-probe combinations, kits, and methods for detecting human ALK and ROS1 gene fusions. Background Technology

[0002] The EML4-ALK fusion gene is a crucial driver gene in lung cancer. When the ROS1 gene fuses with other genes, it activates ROS1 tyrosine kinase activity, leading to malignant transformation of cells. Specific detection of ALK and ROS1 gene fusion mutations can provide valuable guidance for patient medication. Chinese patent CN 113373233 A provides a reaction system for detecting the EML4-ALK fusion gene, including a primer-probe mixture, and Chinese patent CN 105506140 B provides primers and fluorescent probes for detecting the ROS1 fusion gene. However, currently, no kit or detection system has been found that can simultaneously detect human ALK and ROS1 gene fusion mutations. Summary of the Invention

[0003] To address some problems existing in the prior art, the first aspect of the present invention provides a primer-probe combination, comprising at least primer-probe combination A, which specifically detects at least one EML4-ALK fusion gene; primer-probe combination B, which specifically detects at least one ROS1 fusion gene; and primer-probe combination C, which specifically detects an internal reference gene.

[0004] In one embodiment, the primer-probe composition A comprises one or more of the following: (a) forward primers Av1F1, Av1F2, Av1F3, Av2F1, Av2F2, Av2F3, Av2F4, Av3F1, Av3F2, Av3F3, Av3F4, Av3F5, Av3F6, Av4F1, Av4F2, Av5F1, Av5F2, Av5F3, Av5F4, Av6F1, Av6F2, Av6F3, Av6F4, Av7F1, Av7F2, Av7F3; (b) one or more of the following reverse primers: AR1, AR2, AR3, AR4, AR5, AR6; and (c) one or more of the following probes: pALKt1, pALKt2, pALKt3.

[0005] Preferably, the nucleotide sequence of the forward primer (a) in this application is shown in Table 1 below.

[0006] Table 1

[0007]

[0008]

[0009] Preferably, the nucleotide sequence of the reverse primer in (b) of this application is shown in Table 2 below.

[0010] Table 2

[0011] name nucleotide sequence AR1 CAGCTTGTACTCAGGGCTC AR2 GCTCAGCTTGTACTCAGGG AR3 TTGTACTCAGGGCTCTGCA AR4 TAGTTGGGGTTGTAGTCGGT AR5 GCTTGCTCAGCTTGTACTC AR6 GCTCCATCTGCATGGCT

[0012] Preferably, the nucleotide sequence of probe (c) in this application is shown in Table 3 below.

[0013] Table 3

[0014] name nucleotide sequence pALKt1 5' Fluorescent label -TTGCTCAGCTTGTACTCAGGGC-3' Quenching group pALKt2 5' Fluorescent label -TACCGCCGGAAGCACCAG-3' Quenching group pALKt3 5' Fluorescent label -GAGCCCTGAGTACAAGCTGA-3' Quenching group

[0015] In one embodiment, the primer-probe composition B includes (d) forward primers CD74-C6F1, CD74-C6F2, SLC34A2-E4F1, SLC34A2-E4F2, SLC34A2-E4F3, SLC34A2-E13F1, SLC34A2-E13F2, SDC4-E2F1, SDC4-E2F2, SDC4-E4F1, SDC4-E4F2, SDC4-E4F3, and EZR-E1. One or more of 0F1, EZR-E10F2, EZR-E10F3, TMP3-E8F1, and TMP3-E8F2; (e) one or more of the reverse primers R32R1, R34R1, and R35R1; and (f) one or more of the probes pR32t1, pR32t2, pR32t3, pR32t4, pR32t5, pR34t1, pR34t2, pR34t3, pR35t1, pR35t2, and pR35t3.

[0016] Preferably, the nucleotide sequence of the (d) forward primer is shown in Table 4 below.

[0017] Table 4

[0018] name nucleotide sequence CD74-C6F1 GAGCAAAAGCCCACTGAC CD74-C6F2 GCAAAAGCCCACTGACGCT SLC34A2-E4F1 TCTTAGTAGCGCCTTCCAG SLC34A2-E4F2 TGCTCCCTGGATATTCTTA SLC34A2-E4F3 TACTTTTTCGTGTGCTCCCT SLC34A2-E13F1 CATAACCATTAGCAGAGAGGC SLC34A2-E13F2 TAACATAACCATTAGCAGAGAGGC SDC4-E2F1 ATCTGATGACTTTGAGCTGTC SDC4-E2F2 CTGATGACTTTGAGCTGTCTGG SDC4-E4F1 GAGAACGGAGGTCCTGGCAG SDC4-E4F2 CTTTGAGAGAACGGAGGTC SDC4-E4F3 CAGGGCAGCAACATCTTTGA EZR-E10F1 GGAGAAGACAAAGAAGGCA EZR-E10F2 AGACAAAGAAGGCAGAGAGA EZR-E10F3 GAGTTGATGCTGCGGCTG TMP3-E8F1 CAAGCTGGAAAAGACAATTGAT TMP3-E8F2 GACCCGTGCTGAGTTTG

[0019] Preferably, the nucleotide sequence of the (e) reverse primer is shown in Table 5 below.

[0020] Table 5

[0021] name nucleotide sequence R32R1 AGCTTTCTCCCACTGTATTG R34R1 CTTCTATGCCAGACAAAGGT R35R1 TGTCTTCGTTTATAAGCACTGT

[0022] Preferably, the nucleotide sequence of probe (f) is shown in Table 6 below.

[0023] Table 6

[0024]

[0025]

[0026] In one embodiment, the internal reference gene is the housekeeping gene GAPDH and / or MRPS-18C.

[0027] Preferably, the primer-probe combination C includes a GAPDH detection primer probe and / or an MRPS-18C detection primer probe.

[0028] The GAPDH detection primer and probe information described in this application is shown in Table 7 below.

[0029] Table 7

[0030]

[0031] The primer and probe information for MRPS-18C detection in this application is shown in Table 8 below.

[0032] Table 8

[0033]

[0034] The fluorescent marker is not specifically limited in this application, and those skilled in the art can make conventional choices. In a preferred embodiment, the fluorescent marker is selected from any one of FAM, HEX, VIC, ROX, and Cy5.

[0035] The quenching group is not specifically limited in this application, and those skilled in the art can make conventional choices. In one embodiment, the quenching group is selected from any one of BHQ1, BHQ2, BHQ3, and MGB.

[0036] A second aspect of this invention provides a method for detecting human ALK and ROS1 gene fusions based on a PCR platform, comprising: using the primer-probe combination for detection. Specifically, the genotypes for specifically detecting EML4-ALK fusions are: EML(E13)-ALK(E20), EML(E6)-ALK(E20), EML(E20)-ALK(E20), EML(E15)-ALK(E20), EML(E14)-ALK(E20), EML(E2)-ALK(E20); and the genotypes for specifically detecting ROS1 fusions are: CD74(E6)-ROS1(E32), ... 34); SLC34A2(E4)-ROS1(E32), SLC34A2(E4)-ROS1(E34), SLC34A2(E13)-ROS1(E34); SDC4(E2)-Ros1(E32), SD C4(E2)-Ros1(E34), SDC4(E4)-Ros1(E32), SDC4(E4)-Ros1(E34); EZR(E10)-Ros1(E34); TPM3(E8)-ROS1(E35).

[0037] In one embodiment, the primer-probe combination is used in conjunction with an RT-dPCR reaction system and a digital PCR system to perform a one-step reverse transcription digital PCR reaction and digital PCR analysis.

[0038] In one embodiment, the RT-dPCR reaction system includes reverse transcriptase, RNase inhibitor, hot-start DNA polymerase, dNTPs, MgCl2, buffer components, and surfactant components. Specifically, the RT-dPCR reaction system is a commercially available kit developed by Shanghai Little Turtle Technology Co., Ltd., product name: Reverse Transcription Digital PCR Universal Kit (A010).

[0039] In one embodiment, the digital PCR system includes a digital PCR droplet preparer, a digital PCR chip, a digital PCR amplifier, and a digital PCR analyzer.

[0040] In one embodiment, the method for detecting human ALK and ROS1 gene fusions based on a PCR platform includes the following steps:

[0041] A. Thoroughly mix the nucleic acid sample to be tested, the primer and probe combination, and the RT-dPCR reaction system;

[0042] B. Using a digital PCR droplet preparation instrument, prepare the mixture from step A into microdroplets and store them in a digital PCR chip;

[0043] C. Perform PCR amplification on a digital PCR amplification instrument using the digital PCR chip containing microdroplets from step B;

[0044] D. Analyze the digital PCR chip after PCR amplification in step C on a digital PCR analyzer;

[0045] E. If any channel in the analysis results of step D matches the primer-probe combination channel in step A, it is considered positive, and the nucleic acid sample to be tested can be determined to be positive for EML4-ALK gene fusion or ROS1 gene fusion corresponding to that channel.

[0046] A third aspect of the present invention provides a kit comprising 5×RT-dPCR Buffer, RT-dPCR enzyme, an EML4-ALK and ROS1 gene fusion detection system comprising primer and probe combinations according to any one of claims 1-7, a positive control, a negative control, a digital PCR chip, oil phase A and oil phase B for digital PCR, an oil tank plate, an eight-tube strip, an eight-tube strip cap, pipette tips, and a waste container.

[0047] The limit of detection (LOD) of the kit in this application is 20 copies / mL.

[0048] It should be noted that the nucleic acid sample to be tested in this application is RNA.

[0049] The primer-probe combination in this application is used to detect EML4-ALK and ROS1 gene fusion mutations in cell-free DNA of plasma from lung cancer patients or suspected patients.

[0050] Compared with the prior art, the present invention has the following advantages:

[0051] (1) The primer-probe combination and detection method of this application have high specificity and sensitivity, improve the signal-to-noise ratio, have good resolution and accuracy, and have excellent linearity, making it easy to judge the results.

[0052] (2) The primer-probe combination of this application includes primer-probe combination C, which is used to monitor the nucleic acid extraction process of the sample and the quality control of the reaction to prevent false negative results caused by nucleic acid extraction failure and reaction reagent amplification failure. Attached Figure Description

[0053] Figure 1 This is a line graph of the EML4-ALK gene fusion in Example 1;

[0054] Figure 2 This is a graph showing the results of digital PCR detection for linear detection of the EML4-ALK gene in Example 1;

[0055] Figure 3 This is a linear graph of ROS1 gene fusion in Example 1;

[0056] Figure 4 This is a graph showing the results of digital PCR detection for linear detection of ROS1 gene fusion in Example 1;

[0057] Figure 5 This is a line graph of the EML4-ALK gene fusion in Example 2;

[0058] Figure 6 This is a line graph of ROS1 gene fusion in Example 2;

[0059] Figure 7 This is a linear graph of the EML4-ALK gene fusion in Example 3;

[0060] Figure 8 This is a linear graph of ROS1 gene fusion in Example 3;

[0061] Figure 9 This is a line graph of the EML4-ALK gene fusion in Example 4;

[0062] Figure 10 This is a line graph of ROS1 gene fusion in Example 4; Detailed Implementation

[0063] The present invention will be described below through specific embodiments, but is not limited to the specific embodiments given below.

[0064] Example

[0065] The method for detecting human ALK and ROS1 gene fusions based on a PCR platform is as follows:

[0066] A. Nucleic acid extraction was performed using a 2000 μL plasma sample;

[0067] B. Thoroughly mix the RNA nucleic acid sample to be tested, the primer and probe combination, and the RT-dPCR reaction system (Universal Reverse Transcription Digital PCR Kit (A010)); as follows:

[0068] (1) Melt the 5×RT-dPCR Buffer, RT-dPCR enzyme, ALK gene and ROS1 gene fusion detection system at room temperature, vortex to mix, and briefly centrifuge to collect the reaction solution at the bottom of the tube. Aliquot 15μL into N+2 PCR tubes in an eight-tube array. The composition of the reaction solution in this step is shown in Table 9 below;

[0069] Table 9

[0070]

[0071] *N represents the number of samples to be tested; 3 represents one positive control, one negative control, and an extra sample is taken to avoid volume loss due to sample addition errors.

[0072] (2) Take 15 μL of each of the nucleic acid samples extracted in step A and add them to the prepared PCR tubes;

[0073] Take out the ALK gene and ROS1 gene fusion positive control and the extracted negative control, thaw them at room temperature and mix them by shaking, then centrifuge briefly, and add 15 μL of each to the remaining two PCR tubes containing the premixed solution.

[0074] Seal the eight-tube pack with the sample added; then mix well, centrifuge, remove air bubbles from the reaction solution, and set aside for later use.

[0075] C. Using a digital PCR droplet preparation instrument, prepare the mixture in step B into microdroplets and store them in a digital PCR chip;

[0076] D. Perform PCR amplification on a digital PCR amplification instrument using the digital PCR chip containing microdroplets from step C;

[0077] The amplification reaction steps are shown in Table 10 below;

[0078] Table 10

[0079]

[0080] E. Analyze the digital PCR chip after PCR amplification in step D on a digital PCR analyzer;

[0081] F. If any channel in the analysis results of step E matches the primer-probe combination channel in step B, it is considered positive, and the nucleic acid sample to be tested can be determined to be positive for EML4-ALK gene fusion or ROS1 gene fusion corresponding to that channel.

[0082] The primer-probe combination includes primer-probe combination A, primer-probe combination B, and primer-probe combination C. Primer-probe combination C includes GAPDH detection primers and MRPS-18C detection primers. The sequences of primer-probe combination A, primer-probe combination B, and primer-probe combination C are detailed in Tables 11-14.

[0083] Example 1:

[0084] Primer-probe combination:

[0085] Table 11.

[0086]

[0087]

[0088]

[0089] The linearity graphs of EML4-ALK gene fusion, EML4-ALK gene linearity detection digital PCR results, ROS1 gene fusion linearity graphs, and ROS1 gene fusion linearity detection digital PCR results obtained from the performance evaluation of this kit are shown below. Figure 1-4 . Figure 1 The test results show that R 2 =0.9995; Figure 3 The test results show that R 2 =0.99983.

[0090] Example 2:

[0091] Primer-probe combination:

[0092] Table 12.

[0093]

[0094]

[0095] Linear plots of EML4-ALK gene fusion and ROS1 gene fusion obtained from performance evaluation of the kit for this combination are shown below. Figure 5 and 6 . Figure 5 The test results show that R 2 =0.99981; Figure 6 The test results show that R 2 =0.99989.

[0096] Example 3:

[0097] Primer-probe combination:

[0098] Table 13.

[0099]

[0100]

[0101]

[0102] Linear plots of EML4-ALK gene fusion and ROS1 gene fusion obtained from performance evaluation of the kit for this combination are shown below. Figure 7 and 8 . Figure 7 The test results show that R 2 =0.99976; Figure 8 The test results show that R 2 =0.99993.

[0103] Example 4:

[0104] Primer-probe combination:

[0105] Table 14.

[0106]

[0107]

[0108] Linear plots of EML4-ALK gene fusion and ROS1 gene fusion obtained from performance evaluation of the kit for this combination are shown below. Figure 9 and 10 . Figure 9 The test results show that R 2 =0.99987; Figure 10 The test results show that R 2 =0.99984. sequence list <110> Hunan Shengzhou Biotechnology Co., Ltd. <120> Primer-probe combinations, kits, and methods for detecting human ALK and ROS1 gene fusions <130> 2 <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 19 <212> DNA <213> Artificial sequence <400> 1 CTCTCTGCTCCTCCTGTTC 1 6 11 16 <210> 2 <211> 19 <212> DNA <213> Artificial sequence <400> 1 GTCAGCCGCATCTTCTTTT 1 6 11 16 <210> 3 <211> 15 <212> DNA <213> Artificial sequence <400> 1 CGCAGGCCGGATGTG 1 6 11 <210> 4 <211> 17 <212> DNA <213> Artificial sequence <400> 20 GGCCATCCACAGTCTTC 1 6 11 16 <210> 5 <211> twenty one <212> DNA <213> Artificial sequence <400> 1 ATACGACCAAATCCGTTGACT 1 6 11 16 20 <210> 6 <211> 19 <212> DNA <213> Artificial sequence <400> 1 CCCAATACGACCAAATCCG 1 6 11 16 <210> 7 <211> 14 <212> DNA <213> Artificial sequence <400> 1 TGGCTCGGCTGGCG 1 6 11 <210> 8 <211> 14 <212> DNA <213> Artificial sequence <400> 1 CTCGGCCCGCAGCG 1 6 11 <210> 9 <211> 19 <212> DNA <213> Artificial sequence <400> 1 AGTTGACACACTTGGTAAC 1 6 11 16 <210> 10 <211> 19 <212> DNA <213> Artificial sequence <400> 1 CTGTCAGCCTTACACATCC 1 6 11 16 <210> 11 <211> 20 <212> DNA <213> Artificial sequence <400> 1 GGAGGAAGAAGTTGACACAC 1 6 11 16 <210> 12 <211> 20 <212> DNA <213> Artificial sequence <400> 1 CTCATTGCTGGATACCTGTTG 1 6 11 16 <210> 13 <211> 20 <212> DNA <213> Artificial sequence <400> 1 ATTGCTGGATACCTGTTGTG 1 6 11 16 <210> 14 <211> 20 <212> DNA <213> Artificial sequence <400> 20 TCCTCATTGCTGGATACCT 1 6 11 16 <210> 15 <211> 20 <212> DNA <213> Artificial sequence <400> 1 ACTCACACGGTGCTTTGGAG 1 6 11 16 <210> 16 <211> twenty two <212> DNA <213> Artificial sequence <400> 1 TGAGGACCTGCCCATTTCAATG 1 6 11 16 21 <210> 17 <211> 18 <212> DNA <213> Artificial sequence <400> 1 CCTGGGAAAGGACCTAAA 1 6 11 16 <210> 18 <211> 18 <212> DNA <213> Artificial sequence <400> 1 CACCTGGGAAAGGACCTA 1 6 11 16 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <400> 1 CTACTGTAGAGCCCACACCT 1 6 11 16 <210> 20 <211> twenty one <212> DNA <213> Artificial sequence <400> 1 TCTAACTCGGGAGACTATGAA 1 6 11 16 21 <210> twenty one <211> twenty one <212> DNA <213> Artificial sequence <400> 1 TAACTCGGGAGACTATGAAAT 1 6 11 16 21 <210> twenty two <211> twenty two <212> DNA <213> Artificial sequence <400> 1 ACTCGGGAGACTATGAAATATT 1 6 11 16 21 <210> twenty three <211> 20 <212> DNA <213> Artificial sequence <400> 1 ACATCACACACCTTGACTGG 1 6 11 16 <210> twenty four <211> 20 <212> DNA <213> Artificial sequence <400> 20 TACCAAAACTGCAGACAAGC 1 6 11 16 <210> 25 <211> twenty two <212> DNA <213> Artificial sequence <400> 1 TAAAGATGTCATCATCAACCAA 1 6 11 16 21 <210> 26 <211> twenty two <212> DNA <213> Artificial sequence <400> 1 AGCATAAAGATGTCATCATCAA 1 6 11 16 21 <210> 27 <211> 18 <212> DNA <213> Artificial sequence <400> 1 ATCATCAACCAAGCAAAA 1 6 11 16 <210> 28 <211> 20 <212> DNA <213> Artificial sequence <400> 20 AACTCGCGAAAAAAACAGCC 1 6 11 16 <210> 29 <211> 18 <212> DNA <213> Artificial sequence <400> 1 AATGTCAACTCGCGAAAA 1 6 11 16 <210> 30 <211> twenty one <212> DNA <213> Artificial sequence <400> 1 AAATAATTCTGTGGGATCATG 1 6 11 16 21 <210> 31 <211> 20 <212> DNA <213> Artificial sequence <400> 1 CTGGAGGAGGGAAAGACAGA 1 6 11 16 <210> 32 <211> 20 <212> DNA <213> Artificial sequence <400> 20 GATCATGTGGCCTCAGTGAA 1 6 11 16 <210> 33 <211> 18 <212> DNA <213> Artificial sequence <400> 1 ATGTGGCCTCAGTGAAAA 1 6 11 16 <210> 34 <211> 18 <212> DNA <213> Artificial sequence <400> 1 GATCATGTGGCCTCAGTG 1 6 11 16 <210> 35 <211> 17 <212> DNA <213> Artificial sequence <400> 1 GCTGACCACCCACCTGC 1 6 11 16 <210> 36 <211> 17 <212> DNA <213> Artificial sequence <400> 20 AGCTGACCACCCACCTG 1 6 11 16 <210> 37 <211> 20 <212> DNA <213> Artificial sequence <400> 1 CCTGTGTAGTGCTTCAAGGG 1 6 11 16 <210> 38 <211> 20 <212> DNA <213> Artificial sequence <400> 1 CACACCTGGGAAAGGACCTA 1 6 11 16 <210> 39 <211> 18 <212> DNA <213> Artificial sequence <400> 1 CTGTAGAGCCCACACCTG 1 6 11 16 <210> 40 <211> twenty one <212> DNA <213> Artificial sequence <400> 20 ATGATCTGAATCCTGAAAGAG 1 6 11 16 21 <210> 41 <211> twenty three <212> DNA <213> Artificial sequence <400> 1 CATGATCTGAATCCTGAAAGAGA 1 6 11 16 21 <210> 42 <211> twenty two <212> DNA <213> Artificial sequence <400> 1 ATTAACTGGAGGAGGGAAAGAC 1 6 11 16 21 <210> 43 <211> 19 <212> DNA <213> Artificial sequence <400> 1 CAGCTTGTACTCAGGGCTC 1 6 11 16 <210> 44 <211> 19 <212> DNA <213> Artificial sequence <400> 1 GCTCAGCTTGTACTCAGGG 1 6 11 16 <210> 45 <211> 19 <212> DNA <213> Artificial sequence <400> 1 TTGTACTCAGGGCTCTGCA 1 6 11 16 <210> 46 <211> 20 <212> DNA <213> Artificial sequence <400> 20 TAGTTGGGGTTGTAGTCGGT 1 6 11 16 <210> 47 <211> 19 <212> DNA <213> Artificial sequence <400> 1 GCTTGCTCAGCTTGTACTC 1 6 11 16 <210> 48 <211> 17 <212> DNA <213> Artificial sequence <400> 1 GCTCCATCTGCATGGCT 1 6 11 16 <210> 49 <211> twenty two <212> DNA <213> Artificial sequence <400> 1 TTGCTCAGCTTGTACTCAGGGC 1 6 11 16 21 <210> 50 <211> 18 <212> DNA <213> Artificial sequence <400> 1 TACCGCCGGAAGCACCAG 1 6 11 16 <210> 51 <211> 20 <212> DNA <213> Artificial sequence <400> 1 GAGCCCTGAGTACAAGCTGA 1 6 11 16 <210> 52 <211> 18 <212> DNA <213> Artificial sequence <400> 1 GAGCAAAAGCCCACTGAC 1 6 11 16 <210> 53 <211> 19 <212> DNA <213> Artificial sequence <400> 1 GCAAAAGCCCACTGACGCT 1 6 11 16 <210> 54 <211> 19 <212> DNA <213> Artificial sequence <400> 1 TCTTAGTAGCGCCTTCCAG 1 6 11 16 <210> 55 <211> 19 <212> DNA <213> Artificial sequence <400> 1 TGCTCCCTGGATATTCTTA 1 6 11 16 <210> 56 <211> 20 <212> DNA <213> Artificial sequence <400> 20 TACTTTTTCGTGTGCTCCCT 1 6 11 16 <210> 57 <211> twenty one <212> DNA <213> Artificial sequence <400> 1 CATAACCATTAGCAGAGAGGC 1 6 11 16 21 <210> 58 <211> twenty four <212> DNA <213> Artificial sequence <400> 1 TAACATAACCATTAGCAGAGAGGC 1 6 11 16 21 <210> 59 <211> twenty one <212> DNA <213> Artificial sequence <400> 1 ATCTGATGACTTTGAGCTGTC 1 6 11 16 20 <210> 60 <211> twenty two <212> DNA <213> Artificial sequence <400> 1 CTGATGACTTTGAGCTGTCTGG 1 6 11 16 20 <210> 61 <211> 20 <212> DNA <213> Artificial sequence <400> 1 GAGAACGGAGGTCCTGGCAG 1 6 11 16 <210> 62 <211> 19 <212> DNA <213> Artificial sequence <400> 1 CTTTGAGAGAACGGAGGTC 1 6 11 16 <210> 63 <211> 20 <212> DNA <213> Artificial sequence <400> 1 CAGGGCAGCAACATCTTTGA 1 6 11 16 <210> 64 <211> 19 <212> DNA <213> Artificial sequence <400> 1 GGAGAAGACAAAGAAGGCA 1 6 11 16 <210> 65 <211> 20 <212> DNA <213> Artificial sequence <400> 1 AGACAAAGAAGGCAGAGAGA 1 6 11 16 <210> 66 <211> 18 <212> DNA <213> Artificial sequence <400> 20 GAGTTGATGCTGCGGCTG 1 6 11 16 <210> 67 <211> twenty two <212> DNA <213> Artificial sequence <400> 1 CAAGCTGGAAAAGACAATTGAT 1 6 11 16 20 <210> 68 <211> 17 <212> DNA <213> Artificial sequence <400> 1 GACCCGTGCTGAGTTTG 1 6 11 16 <210> 69 <211> 20 <212> DNA <213> Artificial sequence <400> 1 AGCTTTCTCCCACTGTATTG 1 6 11 16 <210> 70 <211> 20 <212> DNA <213> Artificial sequence <400> 20 CTTCTATGCCAGACAAAGGT 1 6 11 16 <210> 71 <211> twenty two <212> DNA <213> Artificial sequence <400> 1 TGTCTTCGTTTATAAGCACTGT 1 6 11 16 20 <210> 72 <211> 27 <212> DNA <213> Artificial sequence <400> 1 GAGTCCCAAATAAACCAGGCATTCCCA 1 6 11 16 20 25 <210> 73 <211> 16 <212> DNA <213> Artificial sequence <400> 1 CCAAATAAACCAGGCA 1 6 11 16 <210> 74 <211> twenty four <212> DNA <213> Artificial sequence <400> 20 AGTCCCAAATAAACCAGGCATTCC 1 6 11 16 20 <210> 75 <211> twenty two <212> DNA <213> Artificial sequence <400> 1 TGGAGTCCCAAATAAACCAGGC 1 6 11 16 20 <210> 76 <211> twenty two <212> DNA <213> Artificial sequence <400> 1 TGCCTGGTTTATTTGGGACTCC 1 6 11 16 20 <210> 77 <211> 19 <212> DNA <213> Artificial sequence <400> 1 TGTAACAACCAGAAATATT 1 6 11 16 <210> 78 <211> 25 <212> DNA <213> Artificial sequence <400> 20 TTCTGGTTGTTACAATCCCACTGAC 1 6 11 16 20 <210> 79 <211> twenty three <212> DNA <213> Artificial sequence <400> 1 TGGTTGTTACAATCCCACTGACC 1 6 11 16 20 <210> 80 <211> 27 <212> DNA <213> Artificial sequence <400> 1 CCTTCCTTGGCACTTTTTTGATTCTTT 1 6 11 16 20 25 <210> 81 <211> 25 <212> DNA <213> Artificial sequence <400> 1 CCCTTCCTTGGCACTTTTTTGATTC 1 6 11 16 20 <210> 82 <211> 19 <212> DNA <213> Artificial sequence <400> 20 AGTGCCAAGGAAGGGGTGA 1 6 11 16

Claims

1. A primer-probe combination, characterized in that, It consists of primer-probe combination A, primer-probe combination B, and primer-probe combination C; Primer-probe combination A specifically detects at least one EML4-ALK fusion gene; Primer-probe combination B specifically detects at least one ROS1 fusion gene; Primer-probe combination C specifically detects the internal reference gene; The primer-probe composition A includes Av1F2, Av2F3, Av3F5, Av4F2, Av5F2, Av6F4, Av7F3, AR4, and pALKt3; The nucleotide sequences of Av1F2 are: CACCTGGGAAAGGACCTA; Av2F3 is: ACTCGGGAGACTATGAAATATT; Av3F5 is: AACTCGCGAAAAAAACAGCC; Av4F2 is: CTGGAGGAGGGAAAGACAGA; Av5F2 is: ATGTGGCCTCAGTGAAAA; Av6F4 is: CTGTAGAGCCCACACCTG; Av7F3 is: ATTAACTGGAGGAGGGAAAGAC; AR4 is: TAGTTGGGGTTGTAGTCGGT; and pALKt3 has a 5' fluorescent label -GAGCCCTGAGTACAAGCTGA-3' quencher group. The primer-probe composition B includes CD74-C6F2, SLC34A2-E4F3, SLC34A2-E13F1, SDC4-E2F1, SDC4-E4F3, EZR-E10F1, TMP3-E8F1, R32-R1, R34-R1, R35-R1, pR32t1, pR34t3, and pR35t1; The nucleotide sequences for CD74-C6F2 are: GCAAAAGCCCACTGACGCT; SLC34A2-E4F3 are: TACTTTTTCGTGTGCTCCCT; SLC34A2-E13F1 are: CATAACCATTAGCAGAGAGGC; SDC4-E2F1 are: ATCTGATGACTTTGAGCTGTC; SDC4-E4F3 are: CAGGGCAGCAACATCTTTGA; EZR-E10F1 are: GGAGAAGACAAAGAAGGCA; and TMP3-E8F1 are: CAAGCTGGAAAAGACAATT. GAT; R32R1 nucleotide sequence is AGCTTTCTCCCACTGTATTG; R34R1 nucleotide sequence is CTTCTATGCCAGACAAAGGT; R35R1 nucleotide sequence is TGTCTTCGTTTATAAGCACTGT; pR32t1 nucleotide sequence is 5' fluorescently labeled -GAGTCCCAAATAAACCAGGCATTCCCA-3' quencher group; pR34t3 nucleotide sequence is 5' fluorescently labeled -TGGTTGTTACAATCCCACTGACC-3' quencher group; pR35t1 nucleotide sequence is 5' fluorescently labeled -CCTTCCTTGGCACTTTTTTGATTCTTT-3' quencher group; The primer-probe composition C includes nucleotide sequences such as GAPDH-F1 as shown in SEQ ID NO.1, GAPDH-R2 as shown in SEQ ID NO.5, and pGAPt1 as shown in SEQ ID NO.

7.

2. A reagent kit, characterized in that, Includes 5×RT-dPCR Buffer, RT-dPCR enzyme, EML4-ALK and ROS1 gene fusion detection system containing the primer and probe combination described in claim 1, positive control, negative control, digital PCR chip, oil phase A and oil phase B for digital PCR, oil tank plate, eight-tube array, eight-tube array cap, pipette tip, and waste container.

Citation Information

Patent Citations

  • ROS1 fusion gene ARMS real-time PCR genotyping kit

    CN105506140B

  • Reaction system for detecting EML4-ALK fusion gene based on digital PCR and applications of reaction system

    CN113373233A

  • Primer / probe combination and kit for detecting gene fusion mutation and use method of kit

    CN108950018A

  • Plasma-based detection of anaplastic lymphoma kinase (ALK) nucleic acids and alk fusion transcripts and uses thereof in diagnosis and treatment of cancer

    CN109563547A

  • Multiplex PCR detection of ALK, RET, and ROS fusions

    CN110691852A