A Mycobacterium and Fungal Gene-Specific Primer Set and a Sequencing Method for Mycobacterium and Fungal Infections
By developing gene-specific primer sets for mycobacterium and fungi, and combining nanopore sequencing technology, the problem of the existing technology being unable to detect Mycobacterium tuberculosis, non-tuberculosis and invasive fungi is solved, and rapid and accurate pathogen detection is achieved, improving the efficiency and accuracy of clinical diagnosis.
Patent Information
- Application Number
- CN202210954187.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2022-07-29
- Filing Date
- 2022-08-10
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2042-08-10
AI Technical Summary
The prior art cannot effectively detect Mycobacterium tuberculosis, non-tuberculosis and invasive fungi, resulting in clinical diagnosis and delay in treatment.
A gene-specific primer set of mycobacterium and fungi was developed. Combined with nanopore sequencing technology, high-throughput detection through multiplex PCR technology and Barcode tag primers, 6 mycobacterium and 11 fungi can be detected simultaneously.
It achieves simple, fast, comprehensive and accurate testing, which can guide the clinical distinction between tuberculosis, non-tuberculosis and invasive fungal infections, and improves diagnostic efficiency and accuracy.
Smart Images

Figure CN115478114B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of nanopore sequencing technology, and in particular to a primer set specific for mycobacterium and fungal genes and a sequencing method for mycobacterium and fungal infections. Background Art
[0002] Patients with pulmonary diseases caused by Mycobacterium tuberculosis, nontuberculous mycobacteria, and invasive fungal infections have high clinical similarity, manifested as cough, expectoration, and fever. Radiologically, they can all show pulmonary shadows or pulmonary cavities, which bring certain difficulties to clinical diagnosis and treatment. The traditional gold standard for microbial detection is pathogen culture. However, the culture time of mycobacteria and fungi is long, and the culture medium is relatively demanding, making it difficult to achieve immediate diagnosis and potentially delaying the treatment effect. In recent years, many molecular diagnostic techniques, such as real-time fluorescence quantitative PCR technology and metagenomic sequencing technology (Metagenomics next-generation sequencing, mNGS), have also been widely used in clinical diagnosis. However, for patients with pulmonary diseases, although real-time fluorescence quantitative PCR can diagnose Mycobacterium tuberculosis, there are no effective diagnostic measures for the diagnosis of nontuberculous mycobacteria and fungi; although metagenomic sequencing technology can also comprehensively distinguish Mycobacterium tuberculosis, nontuberculous mycobacteria, and fungal infections, it involves high detection costs and has certain limitations for the detection of low-abundance pathogens. Currently, there is a lack of an economic, efficient, rapid, and accurate means in clinical practice to distinguish Mycobacterium tuberculosis, nontuberculous mycobacteria, and fungal infections. Currently, there is no effective distinction in clinical practice for the pathogenic bacteria causing pulmonary shadows due to tuberculosis, nontuberculosis, and invasive fungi, and the detection and distinction of these bacterial species are related to different treatment methods.
[0003] Nanopore sequencing technology is a new generation of sequencing technology that has emerged in recent years. It is a third-generation sequencing technology (also known as the fourth-generation sequencing technology) that combines high throughput, high speed, ultra-long read lengths, and low costs. Based on these advantages, nanopore sequencing technology has great prospects in the rapid diagnosis of pathogenic microorganisms. The current nanopore sequencing technology cannot detect Mycobacterium tuberculosis, nontuberculous mycobacteria, and invasive fungi. Summary of the Invention
[0004] In order to overcome the deficiency that the existing nanopore sequencing technology cannot detect Mycobacterium tuberculosis, nontuberculous mycobacteria, and invasive fungi, the present invention provides a primer set specific for mycobacterium and fungal genes and a sequencing method using the primer set, which has the advantages of simplicity, rapidity, comprehensiveness, and accuracy, and is beneficial to guiding the clinical distinction of tuberculosis, nontuberculosis, and invasive fungal infections.
[0005] In order to achieve the above object, the present invention adopts the following technical solutions:
[0006] A set of Mycobacterium and fungal gene-specific primers, including specific gene IS6100, hsp65, rpoB, gyrA, L1A1, RPB1, Tub2, CaM, URA5, CAP10, mtLSU, Kex-1 or MP1 primer sets. Among them, the primer sequences of IS6100 include the nucleotide sequence shown in SEQ01 and the nucleotide sequence shown in SEQ02; or the primer set of hsp65 includes the nucleotide sequence shown in SEQ03 and the nucleotide sequence shown in SEQ04; or the primer set of rpoB includes the nucleotide sequence shown in SEQ05 and the nucleotide sequence shown in SEQ06; or the primer set of gyrA includes the nucleotide sequence shown in SEQ07 and the nucleotide sequence shown in SEQ08; or the primer set of L1A1 includes the nucleotide sequence shown in SEQ09 and the nucleotide sequence shown in SEQ10; or the primer set of RPB1 includes the nucleotide sequence shown in SEQ11 and the nucleotide sequence shown in SEQ12; or the primer set of Tub2 includes the nucleotide sequence shown in SEQ13 and the nucleotide sequence shown in SEQ14; or the primer set of CaM includes the nucleotide sequence shown in SEQ15 and the nucleotide sequence shown in SEQ16; or the primer set of URA5 includes the nucleotide sequence shown in SEQ17 and the nucleotide sequence shown in SEQ18; or the primer set of CAP10 includes the nucleotide sequence shown in SEQ19 and the nucleotide sequence shown in SEQ20; or the primer set of mtLSU includes the nucleotide sequence shown in SEQ21 and the nucleotide sequence shown in SEQ20; or the primer set of Kex-1 includes the nucleotide sequence shown in SEQ23 and the nucleotide sequence shown in SEQ24; or the MP1 primer set includes the nucleotide sequence shown in SEQ25 and the nucleotide sequence shown in SEQ26.
[0007] Preferably, the Mycobacterium includes Mycobacterium tuberculosis and non-tuberculous mycobacteria, and the non-tuberculous mycobacteria include: Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium kansasii.
[0008] Preferably, the fungi include Candida and Aspergillus.
[0009] Preferably, the Candida includes Candida albicans, Candida glabrata, Candida tropicalis, Candida parapsilosis.
[0010] Preferably, the Aspergillus includes Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, and Aspergillus terreus; the Cryptococcus includes Cryptococcus gattii, Cryptococcus neoformans, Talaromyces marneffei, and Pneumocystis jirovecii.
[0011] The present invention also discloses a sequencing method for detecting Mycobacterium and fungal infections using a Mycobacterium and fungal gene-specific primer set, comprising the following steps:
[0012] 1) Design primers covering the Mycobacterium-specific typing genes IS6100, hsp65, rpoB, and gyrA; primers covering the Candida-specific typing genes L1A1 and RPB1;
[0013] 2) Add the base filling sequence TTTCTGTTGGTGCTGATATTG to the 5' end of each forward primer - F, and add the base filling sequence ACTTGCCTGTCGCTCTATCTTC to the 5' end of each reverse primer - R to obtain amplification primers containing the binding sites for the second-round PCR primers;
[0014] 3) Dilute the amplification primers with the binding sites for the second-round PCR primers, and mix the forward and reverse primers of each gene; then form a primer pool from the mixed primers;
[0015] 4) Synthesize Barcode tag primers suitable for the second-round PCR, dilute all the dry Barcode primers, and mix the forward and reverse primers with the same Barcode to form a Barcode primer pool.
[0016] Preferably, it further includes step 5), and step 5) is to extract genomic DNA.
[0017] Preferably, it further includes step 6), and step 6) is to perform the first-round amplification with the primer pool and purify.
[0018] Preferably, it further includes step 7), and step 7) is to perform the second-round amplification with the Barcode primers and purify.
[0019] Preferably, it further includes step 8), and step 8) is to construct a sequencing library and purify.
[0020] The beneficial effects of the present invention are as follows: (1) The invention has the advantages of simplicity, rapidity, comprehensiveness, and accuracy, which is conducive to guiding the clinical differentiation of tuberculosis, non-tuberculosis, and invasive fungal infections. (2) The present invention uses multiplex PCR technology to amplify the target genes of the pathogenic bacteria to be detected in one reaction, and combines the nanopore sequencing platform to perform high-throughput detection on the specific gene amplicons, and can simultaneously detect 6 species of Mycobacterium and 11 species of fungi. Brief Description of the Drawings
[0021] Figure 1 It is a schematic diagram of the library construction process of the present invention;
[0022] Figure 2 It is an agarose gel electrophoresis gel image of 4 positive samples and 1 negative control after two rounds of amplification;
[0023] Figure 3 It is a qPCR identification map of 4 samples with different Mycobacterium tuberculosis copy numbers.
[0024] In the figure, NC represents water. Specific implementation manners
[0025] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.
[0026] Example 1: 1) Design specific primers for IS6100, hsp65, rpoB, gyrA, L1A1, RPB1, Tub2, CaM, URA5, CAP10, mtLSU, Kex-1, MP1 genes covering 6 mycobacteria (including Mycobacterium tuberculosis; non-tuberculous mycobacteria include: Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium kansasii, but not limited to the above non-tuberculous mycobacteria) and 12 fungi (Candida includes: Candida albicans, Candida glabrata, Candida tropicalis, Candida parapsilosis, but not limited; Aspergillus includes: Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus terreus, but not limited; Cryptococcus includes: Cryptococcus gattii, Cryptococcus neoformans; Talaromyces marneffei; Pneumocystis jirovecii). The specific primer sequence information is shown in Table 1.
[0027] Table 1. Gene-specific primers for mycobacteria and fungi
[0028]
[0029]
[0030] 2) Add the base filling sequence of TTTCTGTTGGTGCTGATATTG to the 5' end of each forward primer - F, and add the base filling sequence of ACTTGCCTGTCGCTCTATCTTC to the 5' end of each reverse primer - R to obtain amplification primers containing the binding sites of the second-round PCR primers. The specific primer sequences are shown in Table 2.
[0031] Table 2. Amplification primers for Mycobacterium tuberculosis drug resistance-related genes
[0032]
[0033]
[0034] 3) Dilute all the primers in Table 2 above to 100 μM, and mix the forward and reverse primers of each gene in equal proportions. Next, form a primer pool with the mixed primers. The primer concentration ratios of IS6100, hsp65, rpoB, gyrA, L1A1, RPB1, Tub2, CaM, URA5, CAP10, mtLSU, Kex-1, and MP1 in the primer pool are 0.5:1:1.2:1:0.9:1.5:1:1.2:1.5:1:0.8:1.2:1. Although the results of the present invention can also be achieved by mixing primers in different ratios, this ratio of mixing is a preference.
[0035] 4) Synthesize Barcode label primers suitable for the second round of PCR. Each Barcode primer corresponds to a sample, so that each sample carries a different Barcode label. Dilute all the Barcode dry powder primers to 10 μM, and mix the forward and reverse primers of the same Barcode in equal proportions to form a Barcode primer pool. The specific primer sequences are shown in Table 3.
[0036] Primer Name Primer Sequence (5'-3') Primer Sequence barcode01-F GGTGCTGAAGAAAGTTGTCGGTGTCTTTGTGTTAACCTTTCTGTTGGTGCTGATATTGC SEQ53 barcode01-R GGTGCTGAAGAAAGTTGTCGGTGTCTTTGTGTTAACCTACTTGCCTGTCGCTCTATCTT SEQ54 barcode02-F GGTGCTGTCGATTCCGTTTGTAGTCGTCTGTTTAACCTTTCTGTTGGTGCTGATATTGC SEQ55 barcode02-R GGTGCTGTCGATTCCGTTTGTAGTCGTCTGTTTAACCTACTTGCCTGTCGCTCTATCTT SEQ56 barcode03-F GGTGCTGGAGTCTTGTGTCCCAGTTACCAGGTTAACCTTTCTGTTGGTGCTGATATTGC SEQ57 barcode03-R GGTGCTGGAGTCTTGTGTCCCAGTTACCAGGTTAACCTACTTGCCTGTCGCTCTATCTT SEQ58 barcode04-F GGTGCTGTTCGGATTCTATCGTGTTTCCCTATTAACCTTTCTGTTGGTGCTGATATTGC SEQ59 barcode04-R GGTGCTGTTCGGATTCTATCGTGTTTCCCTATTAACCTACTTGCCTGTCGCTCTATCTT SEQ60 barcode05-F GGTGCTGCTTGTCCAGGGTTTGTGTAACCTTTTAACCTTTCTGTTGGTGCTGATATTGC SEQ61 barcode05-R GGTGCTGCTTGTCCAGGGTTTGTGTAACCTTTTAACCTACTTGCCTGTCGCTCTATCTT SEQ62 barcode06-F GGTGCTGTTCTCGCAAAGGCAGAAAGTAGTCTTAACCTTTCTGTTGGTGCTGATATTGC SEQ63 barcode06-R GGTGCTGTTCTCGCAAAGGCAGAAAGTAGTCTTAACCTACTTGCCTGTCGCTCTATCTT SEQ64 barcode07-F GGTGCTGGTGTTACCGTGGGAATGAATCCTTTTAACCTTTCTGTTGGTGCTGATATTGC SEQ65 barcode07-R GGTGCTGGTGTTACCGTGGGAATGAATCCTTTTAACCTACTTGCCTGTCGCTCTATCTT SEQ66 barcode08-F GGTGCTGTTCAGGGAACAAACCAAGTTACGTTTAACCTTTCTGTTGGTGCTGATATTGC SEQ67 barcode08-R GGTGCTGTTCAGGGAACAAACCAAGTTACGTTTAACCTACTTGCCTGTCGCTCTATCTT SEQ68 barcode09-F GGTGCTGAACTAGGCACAGCGAGTCTTGGTTTTAACCTTTCTGTTGGTGCTGATATTGC SEQ69 barcode09-R GGTGCTGAACTAGGCACAGCGAGTCTTGGTTTTAACCTACTTGCCTGTCGCTCTATCTT SEQ70 barcode10-F GGTGCTGAAGCGTTGAAACCTTTGTCCTCTCTTAACCTTTCTGTTGGTGCTGATATTGC SEQ71 barcode10-R GGTGCTGAAGCGTTGAAACCTTTGTCCTCTCTTAACCTACTTGCCTGTCGCTCTATCTT SEQ72 barcode11-F GGTGCTGGTTTCATCTATCGGAGGGAATGGATTAACCTTTCTGTTGGTGCTGATATTGC SEQ73 barcode11-R GGTGCTGGTTTCATCTATCGGAGGGAATGGATTAACCTACTTGCCTGTCGCTCTATCTT SEQ74 barcode12-F GGTGCTGCAGGTAGAAAGAAGCAGAATCGGATTAACCTTTCTGTTGGTGCTGATATTGC SEQ75 barcode12-R GGTGCTGCAGGTAGAAAGAAGCAGAATCGGATTAACCTACTTGCCTGTCGCTCTATCTT SEQ76
[0037] Example 2
[0038] Step 1: Enrich the specific genes of 6 mycobacteria and 12 fungi in the sample by the first round of multiplex PCR.
[0039] 1) Perform PCR amplification on DNA samples (mixed nucleic acids of Mycobacterium tuberculosis, Mycobacterium avium, and Aspergillus fumigatus) with 4 different copy numbers of Mycobacterium tuberculosis ( Figure 1 ) using the mixed primer pool (plus 1 PCR negative control): The total reaction system is 50 μl, including 25 μl of 2×Phusion HF Buffer PCR Mastermix (NEB), 5 μl of the optimized primer pool, 50 ng of genomic DNA, and ddH2O to make up to 50 μl. The reaction program is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 65°C for 60 s, decreasing 1°C for each cycle, extension at 72°C for 15 s, for 10 cycles; denaturation at 95°C for 15 s, annealing at 62°C for 60 s, extension at 72°C for 15 s, for 20 cycles; after the cycle ends, extend at 72°C for 5 min and store at 4°C.
[0040] 2) Add 30 μl of AMPure XP Beads to the 50 μl of multiplex PCR product, pipette and mix well, and then let it stand at room temperature for 5 min to allow the magnetic beads to fully bind to the PCR product;
[0041] Place the purification system on a magnetic stand and wait for 2 - 5 min until the magnetic beads are completely adsorbed on one side of the magnetic stand, and then use a pipette to remove the supernatant;
[0042] Add 200 μl of freshly prepared 80% ethanol. After standing for 30 s on a magnetic stand, discard the supernatant and repeat the washing once to fully remove impurities.
[0043] Use a small-range pipette to fully remove the residual ethanol. Open the lid and air-dry at room temperature for 5 min until the magnetic beads are dry.
[0044] Remove the purification tube from the magnetic stand, add 25 μl of ddH₂O to elute the DNA, pipette and mix well to make the magnetic beads in a completely suspended state, and let stand at room temperature for 3 min to fully elute the DNA.
[0045] Place the purification tube back on the magnetic stand and let stand for 3 min. Wait until the magnetic beads are completely adsorbed on one side of the magnetic stand, and pipette 23 μl of the eluate for the second-round amplification.
[0046] Step 2: Second-round PCR amplification
[0047] 1) Perform second-round PCR amplification with Barcode label primers (BC01 - BC05) to label different samples with different tags for convenient mixed loading and sequencing. The reaction system is 50 μl, including 25 μl of 2×Phusion HF Buffer PCR Mastermix (NEB), 2 μl of Barcode primer, and 23 μl of the product after the first-round amplification and purification. The reaction program is: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 15 s, annealing at 62 °C for 15 s, extension at 72 °C for 30 s, for 6 cycles; after the cycles, extension at 72 °C for 5 min, and store at 4 °C.
[0048] 2) The magnetic bead purification method is the same as that in Step 1. When finally eluting the DNA, use 30 μl of ddH₂O for elution, and take 27 μl for library construction.
[0049] 3) Measure the concentration of the purified product using Qubit 4.0. The concentrations are: 76.5 ng / μl for Sample 1, 73.2 ng / μl for Sample 2, 52.9 ng / μl for Sample 3, 26.1 ng / μl for Sample 4, and 0.38 ng / μl for Sample 5.
[0050] Step 3: Library construction
[0051] 1) Library pooling: Pool the 5 purified products after the second-round amplification at 100 ng per sample (add 10 μl if less than 100 ng), and then supplement the total volume to 50 μl with ddH₂O.
[0052] 2) End repair and 3'-end polyadenylation: The total reaction system is 65 μl, including 50 μl of the mixed DNA solution and 15 μl of the end repair mix (Vazyme). The reaction program is: react at 30 °C for 15 min, terminate the reaction at 65 °C for 15 min, and store at 4 °C.
[0053] 3) Purification of the end repair product: Add 39 μl of AMPure XP Beads to 65 μl of the PCR product. Then, the purification method is the same as the magnetic bead purification method in step 1. Finally, elute the DNA with 30 μl of ddH2O and take 25 μl for the adapter ligation reaction.
[0054] 4) Ligation of nanopore sequencing adapters: The total reaction system is 50 μl, including 25 μl of the end repair and purified product, 10 μl of 5× Ligation Buffer (NEB), 8 μl of T4 Rapid DNA Ligase (NEB), 1 μl of Adapter Mix (Nanopore), and 6 μl of ddH2O. The reaction program is: react at 20 °C for 15 min and store at 4 °C.
[0055] 5) Purification of the ligation product: Add 30 μl of AMPure XP Beads to 50 μl of the ligation product, pipette and mix well, then let it stand at room temperature for 5 min to allow the magnetic beads to fully bind to the PCR product. Place the purification system on a magnetic stand and wait for 2 - 5 min until the magnetic beads are completely adsorbed on one side of the magnetic stand. Use a pipette to remove the supernatant. Add 200 μl of SFB (provided by the Nanopore LSK109 kit, do not use LFB), let it stand on the magnetic stand for 30 s and then discard the supernatant, repeat once. Pipette out the remaining SFB, open the lid and let it air dry at room temperature for about 5 min. When the magnetic beads are dry, add 15 μl of ddH2O to elute the DNA. Pipette and mix well, let it stand at room temperature for 3 min, and pipette 13 μl to obtain the final library.
[0056] 6) Measure the concentration of the final library using Qubit: 15.6 ng / μl.
[0057] Step 4: Nanopore sequencing Use the MinION sequencer from Nanopore (sequencing kit: SQK-LSK109, sequencing chip: R9)
[0058] 1) The R9 chip should be induced for chip activity at least 5 min before adding the sample to completely replace the preservation solution in the chip with the sequencing buffer.
[0059] 2) The library loading method is carried out according to the official instructions of Oxford Nanopore.
[0060] 3) Sequencer settings: Select the sequencing kit SQK-LSK109, select trimbarcode, and select the High accuracy mode for nanopore sequencing.
[0061] Example 3
[0062] The database analysis and comparison process includes:
[0063] After the sequencing data is downloaded, the nanopore sequencer automatically converts the sequencing results to generate a sequencing file in fastq format for subsequent analysis.
[0064] 1) Data quality control: Perform quality control analysis on the downloaded data. Select Qscore≥9 in the quality control process to remove low-quality reads and adapter sequences;
[0065] 2) Filter sequences with a length less than 450bp or greater than 750bp to obtain target sequences that meet the expected design;
[0066] 3) Align the target sequences with the Mycobacterium and fungal genomic sequences in the database;
[0067] 4) Generate the detected species and the number of sequences, as shown in Table 4.
[0068] Table 4. Distribution of detection results for 5 samples
[0069]
[0070] The present invention performed specific gene detection of Mycobacterium and fungi on 4 positive samples with different copy numbers ( Figure 2 , Figure 3 ). The lower the copy number of the sample, the higher the concentration of the product of the second-round PCR, and the higher the number of detected sequences and the number of uniquely aligned sequences.
[0071] To verify the accuracy of the detection results of the present invention for Mycobacterium tuberculosis, non-tuberculous mycobacteria, and fungal positive samples. In this example, 18 different positive samples were detected using the present invention. These samples have all been verified by first-generation sequencing and real-time fluorescence quantitative PCR. The verification results are shown in Table 5.
[0072] Table 5. Accuracy verification results for 18 samples
[0073]
[0074]
[0075] To verify the specificity of the detection results of the present invention for Mycobacterium tuberculosis, non-tuberculous mycobacteria, and fungi. In this example, 17 samples that were negative for Mycobacterium tuberculosis, non-tuberculous mycobacteria, and fungi but had other pathogenic bacteria were detected using the present invention. These samples have all been verified by first-generation sequencing, and the verification situation is shown in Table 6. In the specificity verification results of the 17 samples, it was found that the cross-verification results were ideal and no false positive results were found.
[0076] Table 6. Specificity verification results of 17 samples
[0077] Sample number Verification method and result Detection result of the present invention Number of sequences 1 Sanger Streptococcus pneumoniae Negative 0 2 Sanger Staphylococcus aureus Negative 0 3 Sanger Haemophilus influenzae Negative 0 4 Sanger Nocardia Negative 0 5 Sanger Escherichia coli Negative 0 6 Sanger Staphylococcus epidermidis Negative 0 7 Sanger Pseudomonas aeruginosa Negative 0 8 Sanger Pseudomonas aeruginosa Negative 0 9 Sanger Acinetobacter baumannii Negative 0 10 Sanger Stenotrophomonas maltophilia Negative 0 11 Sanger Chlamydia psittaci Negative 0 12 Sanger Streptococcus pyogenes Negative 0 13 Sanger Legionella pneumophila Negative 0 14 qPCR Human parainfluenza virus Negative 0 15 qPCR Influenza A virus Negative 0 16 qPCR Influenza B virus Negative 0 17 qPCR Adenovirus Negative 0
[0078] The above results indicate that mixing these primers together in the present invention can also ensure the efficacy of each primer.
[0079] The above is only the preferred embodiment of the present invention, and thus does not limit the patent protection scope of the present invention. Any equivalent structural transformation made by using the content of the specification and drawings of the present invention, directly or indirectly applied to other related technical fields, shall be similarly included in the protection scope of the present invention.
Claims
1. A Mycobacterium and fungal gene-specific primer set, characterized in that, Comprising specific gene IS6100, hsp65, rpoB, gyrA, L1A1, RPB1, Tub2, CaM, URA5, CAP10, mtLSU, Kex-1 and MP1 primer sets, wherein the primer sequences of IS6100 comprise the nucleotide sequence shown in SEQ01 and the nucleotide sequence shown in SEQ02; the primer set of hsp65 comprises the nucleotide sequence shown in SEQ03 and the nucleotide sequence shown in SEQ04; the primer set of rpoB comprises the nucleotide sequence shown in SEQ05 and the nucleotide sequence shown in SEQ06; the primer set of gyrA comprises the nucleotide sequence shown in SEQ07 and the nucleotide sequence shown in SEQ08; the primer set of L1A1 comprises the nucleotide sequence shown in SEQ09 and the nucleotide sequence shown in SEQ10; the primer set of RPB1 comprises the nucleotide sequence shown in SEQ11 and the nucleotide sequence shown in SEQ12; the primer set of Tub2 comprises the nucleotide sequence shown in SEQ13 and the nucleotide sequence shown in SEQ14; the primer set of CaM comprises the nucleotide sequence shown in SEQ15 and the nucleotide sequence shown in SEQ16; the primer set of URA5 comprises the nucleotide sequence shown in SEQ17 and the nucleotide sequence shown in SEQ18; the primer set of CAP10 comprises the nucleotide sequence shown in SEQ19 and the nucleotide sequence shown in SEQ20; the primer set of mtLSU comprises the nucleotide sequence shown in SEQ21 and the nucleotide sequence shown in SEQ20; the primer set of Kex-1 comprises the nucleotide sequence shown in SEQ23 and the nucleotide sequence shown in SEQ24; the MP1 primer set comprises the nucleotide sequence shown in SEQ25 and the nucleotide sequence shown in SEQ26.
2. The mycobacterium and fungus gene specific primer set according to claim 1, characterized in that, The mycobacteria include Mycobacterium tuberculosis and non-tuberculous mycobacteria, and the non-tuberculous mycobacteria include: Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium kansasii.
3. The mycobacterium and fungus gene specific primer set according to claim 1, characterized in that, The fungi include Candida, Aspergillus and Cryptococcus.
4. The Mycobacterium and fungal gene-specific primer set according to claim 3, characterized in that, The Candida includes Candida albicans, Candida glabrata, Candida tropicalis, Candida parapsilosis.
5. A Mycobacterium and fungal gene-specific primer set according to claim 4, characterized in that, The Aspergillus includes Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus terreus; the Cryptococcus includes Cryptococcus gattii, Cryptococcus neoformans, Talaromyces marneffei, Pneumocystis jirovecii.
6. Use of the mycobacterium and fungus gene specific primer set according to any one of claims 1 to 5 in the preparation of a product for detecting mycobacterium and fungus, characterized in that, Comprising the following steps: 1) Design specific genes IS6100, hsp65, rpoB, gyrA, L1A1, RPB1, Tub2, CaM, URA5, CAP10, mtLSU, Kex-1, MP1 primers that cover 6 mycobacteria and 12 fungi, and the primer sequences are as described in Claim 1; among them, the mycobacteria include Mycobacterium tuberculosis and non-tuberculous mycobacteria, and the non-tuberculous mycobacteria include: Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium kansasii; the fungi include Candida, Aspergillus, and Cryptococcus; the Candida includes Candida albicans, Candida glabrata, Candida tropicalis, Candida parapsilosis; the Aspergillus includes Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus terreus; the Cryptococcus includes Cryptococcus gattii, Cryptococcus neoformans, Talaromyces marneffei, Pneumocystis jirovecii; 2) Add the base filling sequence of TTTCTGTTGGTGCTGATATTG to the 5' end of each forward primer - F, and add the base filling sequence of ACTTGCCTGTCGCTCTATCTTC to the 5' end of each reverse primer - R to obtain amplification primers containing the binding sites for the second - round PCR primers; 3) Dilute the amplification primers with the binding sites for the second - round PCR primers, and mix the forward and reverse primers of each gene; then form a primer pool with the mixed primers; 4) Synthesize Barcode label primers suitable for the second - round PCR, dilute all the dry powder Barcode primers, and mix the forward and reverse primers with the same Barcode to form a Barcode primer pool.
7. The application according to claim 6, characterized in that, It further includes step 5), and the step 5) is to extract genomic DNA.
8. The application according to claim 6, characterized in that, It further includes step 6), and the step 6) is to perform the first - round amplification with the primer pool and purify.
9. The application according to claim 6, characterized in that It further includes step 7), and the step 7) is to perform the second - round amplification with the Barcode primers and purify.
10. The application according to claim 6, characterized in that, It further includes step 8), and the step 8) is to construct a sequencing library and purify.
Citation Information
Patent Citations
Mycobacterium tuberculosis drug resistance type identification method based on nanopore sequencer
CN113493848A
Rapid mycobacterium identification method based on nanopore sequencer
CN113667728A