Anti-FAP single domain antibody, Fc fusion protein, immunoconjugate and their applications

By developing Fc fusion proteins and immunoconjugates that fuse anti-FAP single domain antibodies with Fc proteins, the problems of antibody drugs in tumor penetration and short half-life are solved, and effective targeted treatment and inhibition of tumors are achieved.

CN115505044BActive Publication Date: 2025-07-04NANJING PET TRACER +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202110701457.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-06-23
Publication Date
2025-07-04
Estimated Expiration
2041-06-23

AI Technical Summary

Technical Problem

The large molecular weight of existing antibody drugs leads to poor tumor permeability and short half-life, which cannot effectively inhibit tumor growth. In addition, small-sized antibody fragments lack the complete Fc domain, which cannot induce antibody-dependent cytotoxicity and complement-dependent cytotoxicity.

Method used

Fc fusion proteins fused with anti-FAP single domain antibodies to Fc proteins and conjugate them to form immunoconjugates for tumor-targeted therapy.

Benefits of technology

It improves the tumor permeability and half-life of the antibody, enhances the cytotoxic effect of the antibody, and effectively inhibits tumor growth.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115505044B_ABST
    Figure CN115505044B_ABST
Patent Text Reader

Abstract

The present invention discloses anti-FAP single-domain antibodies, Fc fusion proteins, immunoconjugates and their applications. The present invention constructs a single-domain antibody library specific to the FAP antigen, and screens out highly specific and highly active anti-FAP single-domain antibodies F80-3C4 and F80-4G3 therefrom. Among them, the amino acid sequence of the single-domain antibody F80-3C4 is shown as SEQ ID NO.4, and the amino acid sequence of the single-domain antibody F80-4G3 is shown as SEQ ID NO.9. The present invention further fuses the single-domain antibody with the Fc protein to obtain an Fc fusion protein; in addition, an immunoconjugate is obtained by conjugating the single-domain antibody and the Fc fusion protein with a functional molecule. The anti-FAP single-domain antibody, Fc fusion protein and immunoconjugate provided by the present invention can effectively inhibit the growth of tumors, and can also be used in the preparation of drugs for immunotherapy of FAP-related diseases including tumors or reagents for diagnosing tumors.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to single-domain antibodies, and in particular to anti-FAP single-domain antibodies, Fc fusion proteins constructed with such single-domain antibodies and Fc proteins, immunoconjugates, and their applications in the diagnosis or treatment of tumors, belonging to the field of anti-FAP single-domain antibodies and their applications. Background Art

[0002] Fibroblast Activation Protein (FAP) exists in tumor stromal fibroblasts and functions on the cell surface. It is a membrane serine peptidase and is one of the members of the type II serine protease family, having dipeptidyl peptidase and collagenase activities, and has dual functions in tumor growth. The proteolytic enzyme activity of FAP can enhance the invasiveness of tumor cells to the extracellular matrix, and can also promote tumor growth and proliferation. Therefore, molecular imaging targeting FAP, as well as pathological diagnosis as a tumor stromal marker, tumor gene therapy or immunotherapy, will become possible.

[0003] Active FAP is a 170 kDa homodimer, including two N-terminal glycosylated subunits of 97 kDa. It is a type II transmembrane glycoprotein with a large C-terminal extracellular region. FAP has 5 potential N-glycosylation sites, 13 cysteine residues, 3 highly conserved serine protease catalytic regions, a hydrophobic transmembrane fragment, and a small cytoplasmic tail region (6 amino acids). FAP is expressed in the cell membranes and cytoplasm of stromal fibroblasts of more than 90% of epithelial tumors, including colon cancer, breast cancer, ovarian cancer, bladder cancer, lung cancer. It can also transiently stay in some normal fetal mesenchymal tissues, continuously exist in the activated stroma of epithelial tumors and some sarcomas, and can also be expressed in gastric cancer stroma, some bone and soft tissue sarcoma cells, granulation tissue of wound healing, damaged stroma of idiopathic pulmonary fibrosis, pancreatic cells, and prostate cancer. FAP-positive cells are close to the endothelial cells of tumor capillaries and surround tumor nodules, but are usually not expressed in normal adult tissues, benign and pre-cancerous epithelial lesions.

[0004] Studies have suggested that FAP has a tumor growth-promoting effect. Experiments on human breast cancer cell lines by Goodman et al. showed that the cell lines (MDA-MB-435 and MDA-MB-436) normally expressed FAP. Breast cancer cells with high FAP expression were less dependent on exogenous serum growth factors and could acquire independence from normal growth regulation. Independence from normal growth regulation is an important feature that distinguishes malignant cells from normal cells. The research group led by Huang et al. demonstrated that the human breast cancer cell line MDA-MB-231 lacked normal expression, and the tumor growth in the high-expression mouse tumor model was faster and had more blood vessels. It was also found that the growth rate of cells expressing FAP was the same as that of cells not expressing FAP. This indicates that FAP can significantly promote tumor growth only in the microenvironment of the mammary fat pad in vivo. This study for the first time demonstrated the angiogenesis function of FAP, that is, FAP promotes breast cancer angiogenesis at least in part. These findings suggest that FAP expression is beneficial for altering the microenvironment of breast cancer cells. Prior art also found that when neovascularization occurred in the rat cornea, many biochemical factors in the corneal stroma changed. FAP-positive corneal cells appeared in the stroma, and these newly appeared cells grew together with the endothelial cells of the new blood vessels, which again demonstrated the vascular function of FAP.

[0005] Currently, the large molecular weight of antibody drugs is considered one of the main factors preventing them from exerting their drug effects. To improve the penetration of antibodies into tumors, gene modification of the antibody form is now often carried out to reduce its molecular weight or only retain its scFV structure. Single-chain fragments (single-chain antibodies) are usually rapidly cleared from the bloodstream, mostly due to their low molecular weight (molecular weight < 60 kDa, the glomerular filtration threshold). Therefore, single-chain antibodies usually have a serum half-life of less than 10 minutes. So the overall performance of these molecules is still not optimal. In addition, most antibody fragments of smaller size lack the complete fragment crystallizable (Fc) domain and thus cannot induce antibody-dependent cell cytotoxicity (ADCC) and complement-dependent cell cytotoxicity (CDC), the two main mechanisms involved in eliminating tumor tissue after antigen binding.

[0006] In 1993, Hamers-Casterman et al. from the Free University of Brussels first reported that in camel blood, in addition to the traditional IgG antibodies, there is another type of antibody, which has a different molecular structure from the traditional mammalian antibody IgG. This antibody lacks both the light chain of the traditional antibody and the CH1 region of the heavy chain constant region, and is called the heavy chain antibody (HcAb). The variable region of the heavy chain antibody consists of the variable region of the antibody heavy chain, which is similar to the Fab of the traditional antibody. This variable region can specifically bind to antigens, so the heavy chain antibody can perform the same functions as the traditional antibody. The smallest unit antigen-binding fragment containing only a single domain is called a single-domain antibody (sdAbs). Single-domain antibodies usually consist of only 110–130 amino acids and have a molecular weight of only 12–15 kDa, which is much smaller than the traditional macromolecular antibody (150–160 kDa) and its Fab fragment (about 50 kDa), but can have a similar or higher specific antigen affinity to the traditional antibody. The inherent characteristics of single-domain antibodies, such as small molecular weight, stable physicochemical properties, high affinity, and easy recombinant expression and preparation, have attracted much attention since their discovery.

[0007] Although single-domain antibodies provide a new breakthrough for antibody research, there are still some problems. For example, the half-life of single-domain antibodies is short. Although it is suitable for molecular imaging, if used as a drug for treatment, it may be metabolized by the system prematurely.

[0008] The deletion of FAP indirectly inhibits the proliferation of tumor cells, accelerates the accumulation of collagen, reduces the myofibroblast component, and decreases the intratumoral vascular density. Therefore, FAP is an important target for tumor targeted therapy. If a highly specific anti-FAP single-domain antibody is obtained, it can effectively inhibit tumor growth by targeting and blocking the stromal and vascular supply of tumors. Summary of the Invention

[0009] One of the objectives of the present invention is to provide a group of anti-FAP single-domain antibodies and their encoding genes;

[0010] Another objective of the present invention is to provide an Fc fusion protein obtained by fusing an anti-FAP single-domain antibody with an Fc protein and its encoding gene;

[0011] A third objective of the present invention is to provide an immunoconjugate obtained by conjugating the anti-FAP single-domain antibody described above with a functional molecule, or an immunoconjugate obtained by conjugating the Fc fusion protein described above with a functional molecule;

[0012] A fourth objective of the present invention is to provide the application of the anti-FAP single-domain antibody, Fc fusion protein, and immunoconjugate in the preparation of reagents or drugs for detecting or treating tumors.

[0013] The present invention first provides anti-FAP single domain antibodies, and the anti-FAP single domain antibodies are single domain antibody F80-3C4 or single domain antibody F80-4G3; wherein, the amino acid sequence of single domain antibody F80-3C4 comprises three complementary determining regions, and the amino acid sequences of the three complementary determining regions are shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 respectively;

[0014] As a preferred specific embodiment of the present invention, the amino acid sequence of single domain antibody F80-3C4 is selected from any one of the amino acid sequences in (1)-(3): (1) the amino acid sequence shown as SEQ ID NO.4; or (2) a protein mutant obtained by deleting, substituting, inserting and / or adding one or more amino acids in the amino acid sequence shown as SEQ ID NO.4, and this protein mutant has the same function as the protein before mutation; or (3) an amino acid sequence having at least 75% identity with the amino acid sequence shown as SEQ ID NO.4.

[0015] The amino acid sequence of single domain antibody F80-4G3 comprises three complementary determining regions, and the amino acid sequences of the three complementary determining regions are shown as SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8 respectively.

[0016] As a preferred specific embodiment of the present invention, the amino acid sequence of single domain antibody F80-4G3 is selected from any one of the amino acid sequences in (1)-(3): (1) the amino acid sequence shown as SEQ ID NO.9; or (2) a protein mutant obtained by deleting, substituting, inserting and / or adding one or more amino acids in the amino acid sequence shown as SEQ ID NO.9, and this protein mutant has the same function as the protein before mutation; or (3) an amino acid sequence having at least 75% identity with the amino acid sequence shown as SEQ ID NO.9.

[0017] The present invention further provides the coding gene of the single domain antibody, wherein, the nucleotide sequence of the coding gene of single domain antibody F80-3C4 is selected from any one of (1)-(3):

[0018] (1) The polynucleotide sequence shown in SEQ ID NO.5; or (2) A polynucleotide sequence capable of hybridizing with the complementary sequence of the polynucleotide sequence shown in SEQ ID NO.5 under stringent hybridization conditions; or (3) A polynucleotide sequence having at least 75% identity with the polynucleotide sequence shown in SEQ ID NO.5; preferably, a polynucleotide sequence having at least 80% identity with the polynucleotide sequence shown in SEQ ID NO.5; more preferably, a polynucleotide sequence having at least 85% identity with the polynucleotide sequence shown in SEQ ID NO.5; even more preferably, a polynucleotide sequence having at least 95% identity with the polynucleotide sequence shown in SEQ ID NO.5; most preferably, a polynucleotide sequence having more than 99% identity with the polynucleotide sequence shown in SEQ ID NO.5;

[0019] The nucleotide sequence of the encoding gene of the single-domain antibody F80-4G3 is selected from any one of (1)-(3) below:

[0020] (1) The polynucleotide sequence shown in SEQ ID NO.10; or (2) A polynucleotide sequence capable of hybridizing with the complementary sequence of the polynucleotide sequence shown in SEQ ID NO.10 under stringent hybridization conditions; or (3) A polynucleotide sequence having at least 75% identity with the polynucleotide sequence shown in SEQ ID NO.10; preferably, a polynucleotide sequence having at least 80% identity with the polynucleotide sequence shown in SEQ ID NO.10; more preferably, a polynucleotide sequence having at least 85% identity with the polynucleotide sequence shown in SEQ ID NO.10; even more preferably, a polynucleotide sequence having at least 95% identity with the polynucleotide sequence shown in SEQ ID NO.10; most preferably, a polynucleotide sequence having more than 99% identity with the polynucleotide sequence shown in SEQ ID NO.10.

[0021] The present invention further provides an Fc fusion protein obtained by fusing the anti-FAP single-domain antibody described above with Fc; wherein, the Fc gene sequence can be derived from the Fc gene sequences of IgG, IgA, IgM or from human IgG1, IgG2, IgG3 or IgG4.

[0022] As a preferred specific embodiment of the present invention, the amino acid sequence of the fusion protein obtained by fusing the anti-FAP single-domain antibody F80-3C4 with Fc is selected from any one of the following amino acid sequences (1)-(3):

[0023] (1) The amino acid sequence shown in SEQ ID NO.11; (2) A protein mutant obtained by deleting, substituting, inserting, and / or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO.11, and this protein mutant has the same function as the protein before mutation; (3) An amino acid sequence having at least 75% identity with the amino acid sequence shown in SEQ ID NO.11.

[0024] As a preferred specific embodiment of the present invention, the amino acid sequence of the fusion protein obtained by fusing the anti-FAP single domain antibody F80-3C4 with Fc is selected from any one of the following amino acid sequences (1)-(3):

[0025] (1) The amino acid sequence shown in SEQ ID NO.13; (2) A protein mutant obtained by deleting, substituting, inserting, and / or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO.13, and this protein mutant has the same function as the protein before mutation; (3) An amino acid sequence having at least 75% identity with the amino acid sequence shown in SEQ ID NO.13.

[0026] The present invention also provides the coding gene of the Fc fusion protein.

[0027] As a preferred specific embodiment of the present invention, the nucleotide sequence of the coding gene of the fusion protein obtained by fusing the anti-FAP single domain antibody F80-3C4 with Fc is selected from any one of (1)-(3):

[0028] (1) The polynucleotide sequence shown in SEQ ID NO.12;

[0029] Or (2) A polynucleotide sequence that can hybridize with the complementary sequence of the polynucleotide sequence shown in SEQ ID NO.12 under stringent hybridization conditions;

[0030] Or (3) A polynucleotide sequence having at least 75% identity with the polynucleotide sequence shown in SEQ ID NO.12; preferably, a polynucleotide sequence having at least 80% identity with the polynucleotide sequence shown in SEQ ID NO.12; more preferably, a polynucleotide sequence having at least 85% identity with the polynucleotide sequence shown in SEQ ID NO.12; even more preferably, a polynucleotide sequence having at least 95% identity with the polynucleotide sequence shown in SEQ ID NO.12; most preferably, a polynucleotide sequence having at least 99% identity with the polynucleotide sequence shown in SEQ ID NO.12.

[0031] As a preferred specific embodiment of the present invention, the nucleotide sequence of the coding gene of the fusion protein obtained by fusing the anti-FAP single-domain antibody F80-3C4 with Fc is selected from any one of (1)-(3):

[0032] (1) The polynucleotide sequence shown in SEQ ID NO.14;

[0033] or (2) a polynucleotide sequence capable of hybridizing with the complementary sequence of the polynucleotide sequence shown in SEQ ID NO.14 under stringent hybridization conditions;

[0034] or (3) a polynucleotide sequence having at least 75% identity with the polynucleotide sequence shown in SEQ ID NO.14; preferably, a polynucleotide sequence having at least 80% identity with the polynucleotide sequence shown in SEQ ID NO.14; more preferably, a polynucleotide sequence having at least 85% identity with the polynucleotide sequence shown in SEQ ID NO.14; even more preferably, a polynucleotide sequence having at least 95% identity with the polynucleotide sequence shown in SEQ ID NO.14; most preferably, a polynucleotide sequence having at least 99% identity with the polynucleotide sequence shown in SEQ ID NO.14.

[0035] The present invention also provides an expression vector containing the coding gene of the single-domain antibody, and an expression vector containing the coding gene of the Fc fusion protein; the expression vector can be a prokaryotic expression vector, a eukaryotic expression vector or other expression vectors.

[0036] The present invention also discloses a recombinant host cell containing the above expression vector. Among them, the host cell is a prokaryotic expression cell, a eukaryotic expression cell, a fungal cell or a yeast cell, and the eukaryotic expression cell is preferably a CHO cell.

[0037] In addition, an immunoconjugate can also be obtained by conjugating the anti-FAP single-domain antibody, the fusion protein obtained by fusing the anti-FAP single-domain antibody with the Fc protein with a functional molecule; wherein, the functional molecule includes but is not limited to one or more of a small molecule drug, a cytotoxic agent, a bioactive protein, a radioisotope or a fluorescent dye.

[0038] The obtained immunoconjugate can be used to prepare a reagent for tumor molecular imaging diagnosis or a drug for treating tumors; or the obtained immunoconjugate is used to prepare a drug for diagnosing or treating FAP-related diseases.

[0039] As used herein, the term "fluorescent dye" refers to a compound that emits visible or infrared light after excitation by electromagnetic radiation of a short and suitable wavelength. The fluorescent dyes are selected from xanthines, acridines, oxazines, cyanines, styryl dyes, Evans blue, coumarins, porphyrins, metal ligand-complexes, fluorescent proteins, nanocrystals, perylenes, boron dipyrromethene and phthalocyanines, as well as conjugates and combinations of dyes of these classes.

[0040] As used herein, "radioisotope" is an element that emits α, β, and / or γ radiation. For example, an anti-FAP single domain antibody, an Fc fusion protein, or an immunoconjugate is labeled with 64 Cu, 67 Ga, 68 Ga, 89 Zr, 18 F, 86 Y, 90 Y, 111 In, 99m Tc, 125 I, 124 I or other radioisotopes to obtain a molecular imaging diagnostic agent for PET (positron emission tomography) or SPECT; or an anti-single domain antibody, an Fc fusion protein, or an immunoconjugate is labeled with 90 Y, 177 Lu, 125 I, 131 I, 211 At, 111 In, 152 Sm, 166 Ho, 186 Re, 188 Re, 67 Cu, 212 Pb, 225 Ac, 213 Bi, 212 Bi, 223 Ra, 227 Th or other radioisotopes for use as a therapeutic agent for FAP-related diseases.

[0041] In addition, the radioisotope can directly label the immunoconjugate formed by the anti-FAP single-domain antibody or the Fc fusion protein; it can also indirectly label the anti-FAP single-domain antibody and the Fc fusion protein through a chelating agent, and the chelating agent includes but is not limited to 1,4,7,10-tetraazacyclododecane-N,N',N,N'-tetraacetic acid (DOTA), ethylenediaminetetraacetic acid (EDTA), 1,4,7-triazacyclononane-1,4,7-triacetic acid (NOTA), N-N''-bis[2-hydroxy-5-(carboxyethyl)benzyl]diethylamine-N,N''-diacetic acid (HBED-CC), 2-(4,7-bis(carboxymethyl)-1,4,7-triazanon-1-yl)glutaric acid (NODAGA), 2-(4,7,10-tris(carboxymethyl)-1,4,7,10-tetraazacyclododecane-1-yl)glutaric acid (DOTAGA), triethylenetetramine (TETA), iminodiacetic acid, diethylenetriamine-N,N,N',N',N''-pentaacetic acid (DTPA), bis-(carboxymethylimidazole)glycine, 6-hydrazinopyridine-3-carboxylic acid (HYNIC), N'-{5-[acetyl(hydroxy)amino]pentyl}-N-[5-({4-[(5-aminopentyl)(hydroxy)amino]-4-oxobutanoyl}amino)pentyl]N-hydroxysuccinamide (DFO), etc., any one or several of them.

[0042] The present invention further provides the application of the anti-FAP single-domain antibody, the coding gene of the anti-FAP single-domain antibody, the Fc fusion protein obtained by fusing the anti-FAP single-domain antibody with the Fc protein, and the immunoconjugate in the preparation of reagents or drugs for diagnosing or treating FAP-related diseases.

[0043] Preferably, the FAP-related diseases include but are not limited to cancer, chronic inflammation, atherosclerosis, fibrosis, tissue remodeling or scar disease; preferably, the cancer is selected from breast cancer, pancreatic cancer, small intestine cancer, colon cancer, rectal cancer, lung cancer, head and neck cancer, ovarian cancer, hepatocellular carcinoma, esophageal cancer, hypopharyngeal cancer, nasopharyngeal cancer, laryngeal cancer, myeloma cells, bladder cancer, cholangiocarcinoma, clear cell renal cell carcinoma, neuroendocrine tumor, oncogenic osteomalacia, sarcoma, CUP (primary unknown cancer), thymic carcinoma, glioma, glioblastoma, astrocytoma, cervical cancer or prostate cancer, etc.

[0044] Furthermore, the present invention provides a pharmaceutical composition for treating tumors, which is composed of an anti-FAP single-domain antibody and a pharmaceutically acceptable carrier and / or excipient; or is composed of an Fc fusion protein obtained by fusing an anti-FAP single-domain antibody with an Fc protein and a pharmaceutically acceptable carrier and / or excipient; or is composed of an immunoconjugate obtained by conjugating an anti-FAP single-domain antibody with a functional molecule and a pharmaceutically acceptable carrier and / or excipient; or is composed of an immunoconjugate obtained by conjugating an Fc fusion protein with a functional molecule and a pharmaceutically acceptable carrier and / or excipient.

[0045] The present invention further provides a detection kit for diagnosing or treating FAP-related diseases, which detection kit contains any one or more of the anti-FAP single-domain antibody, the fusion protein obtained by fusing the anti-FAP single-domain antibody with an Fc protein, the immunoconjugate obtained by conjugating the anti-FAP single-domain antibody with a functional molecule, or the immunoconjugate obtained by conjugating the Fc fusion protein obtained by fusing the anti-FAP single-domain antibody with an Fc protein with a functional molecule.

[0046] Term Definitions Related to the Present Invention

[0047] As used herein, the term "single-domain antibody (sdAb)" refers to a fragment containing a single variable domain in an antibody, also known as a Nanobody. Like a complete antibody, it can selectively bind to a specific antigen. Compared with the mass of a complete antibody of 150-160 kDa, a single-domain antibody is much smaller, about only 12-15 kDa. The first single-domain antibody was artificially engineered from the heavy-chain antibody of a camel and is called the "VHH segment".

[0048] As used herein, the term "identity" of a sequence can be used interchangeably with "sameness" and refers to the degree of similarity between sequences determined by a sequence alignment software such as BLAST. Methods and software for sequence alignment are well known to those skilled in the art. A modified nucleotide sequence can be obtained by substitution, deletion, and / or addition of one or several (such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or more) amino acids or bases to a known sequence. For example, by conventional means (such as conservative substitution, etc.), one or more of the amino acid or nucleotide sequences shown in SEQ ID NO: 1-198 of the present invention can be modified to obtain sequences having a sequence identity greater than 80%, greater than 85%, greater than 90%, greater than 95%, or greater than 99% with these and having substantially the same properties, which are all within the protection scope of the present invention. Preferably, the present invention obtains sequence identity by conservative substitution, but is not limited to conservative substitution.

[0049] The term "complementary" as used herein refers to two nucleotide sequences comprising anti-parallel nucleotide sequences that can pair with each other after forming hydrogen bonds between complementary base residues of the anti-parallel nucleotide sequences. It is known in the art that when the sequences are viewed in the 5' to 3' direction, the nucleotide sequences of two complementary strands are reverse complementary to each other. It is also known in the art that two sequences that can hybridize to each other under a given set of conditions do not necessarily have to be 100% completely complementary.

[0050] The term "amino acid sequence" refers to the order in which amino acids are linked together to form a peptide chain (or polypeptide), and the amino acid sequence can only be read in one direction. There are more than 100 different types of amino acids, 20 of which are commonly used. The present invention does not exclude the presence of other substances on the amino acid chain, such as modifications by sugars, lipids, etc., and the present invention is not limited to the 20 commonly used amino acids.

[0051] The term "nucleotide sequence" refers to the arrangement order of bases in DNA or RNA, i.e., the arrangement order of A, T, G, C in DNA, or the arrangement order of A, U, G, C in mRNA, and also includes the arrangement order of bases in rRNA, tRNA, and mRNA. It should be understood that the antibody genes claimed in the present invention, in addition to DNA sequences, also cover RNA (rRNA, tRNA, mRNA) and their complementary sequences.

[0052] The substitutions described in the present invention may be conservative substitutions, that is, specific amino acid residues are replaced with residues having similar physicochemical characteristics. Non-limiting examples of conservative substitutions include substitutions between amino acid residues containing aliphatic groups (such as mutual substitutions between Ile, Val, Leu, or Ala), substitutions between polar residues (such as mutual substitutions between Lys and Arg, Glu and Asp, Gln and Asn), etc. Mutants formed by deletion, substitution, insertion, and / or addition of amino acids can be prepared by performing site-directed mutagenesis on the DNA encoding the wild-type protein, such as a well-known technique (see, for example, Nucleic Acid Research, Vol. 10, No. 20, p. 6487-6500, 1982, which is incorporated herein by reference in its entirety).

[0053] The term "stringent hybridization conditions" means conditions of low ionic strength and high temperature known in the art. Typically, under stringent conditions, a probe hybridizes to its target sequence with a detectable level that is higher (e.g., at least 2-fold above background) than that to other sequences. Stringent hybridization conditions are sequence-dependent and will vary in different environmental conditions, with longer sequences hybridizing specifically at higher temperatures. A target sequence that is 100% complementary to the probe can be identified by controlling the stringency of hybridization or washing conditions. Exhaustive guidance for nucleic acid hybridization can be found in the relevant literature (Tijssen, Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays, 1993). More specifically, the stringent conditions are typically selected to be about 5 - 10 °C below the thermal melting point (Tm) of the specific sequence at a specified ionic strength and pH. The Tm is the temperature at which 50% of the probe complementary to the target hybridizes to the target sequence at equilibrium (at a specified ionic strength, pH, and nucleic acid concentration) (since the target sequence is present in excess, 50% of the probe is occupied at equilibrium at the Tm). Stringent conditions can be those in which the salt concentration is less than about 1.0 M sodium ion concentration at pH 7.0 to 8.3, typically about 0.01 to 1.0 M sodium ion concentration (or other salts), and the temperature is at least about 30 °C for short probes (including, but not limited to, 10 to 50 nucleotides), and at least about 60 °C for long probes (including, but not limited to, greater than 50 nucleotides). Stringent conditions can also be achieved by adding destabilizing agents such as formamide. For selective or specific hybridization, a positive signal can be at least twice the background hybridization, or 10-fold background hybridization as the case may be. Exemplary stringent hybridization conditions can be as follows: 50% formamide, 5×SSC, and 1% SDS, incubated at 42 °C; or 5×SSC, 1% SDS, incubated at 65 °C, washed in 0.2×SSC and washed in 0.1% SDS at 65 °C. The washing can be carried out for 5, 15, 30, 60, 120 minutes or longer.

[0054] In this specification, "one or more amino acids" refers to the extent of amino acids that can be deleted, substituted, inserted, and / or added by site-directed mutagenesis methods. Without limitation, it is preferably 20 or less, 15 or less, 10 or less, or 7 or less, and more preferably 5 or less. Regarding site-directed mutagenesis methods, for example, in addition to the desired mutation, i.e., specific inconsistencies, synthetic oligonucleotide primers complementary to the single-stranded phage DNA to be mutated can be used as follows. That is, a strand complementary to the phage is synthesized using the above synthetic oligonucleotide as a primer, and the resulting double-stranded DNA is used to transform a host cell. The culture of the transformed bacteria is spread on agar, and plaques are formed from single cells containing the phage. Then, the plaques hybridizing with the probe are collected, cultured, and the DNA is recovered. Moreover, methods for deleting, substituting, inserting, and / or adding one or more amino acids to the amino acid sequence of a bioactive peptide such as an enzyme while maintaining its activity, in addition to the above site-directed mutagenesis, include methods of treating genes with mutagenic sources and methods of selectively cleaving genes, then deleting, substituting, inserting, or adding selected nucleotides, and then ligating them.

[0055] The term "Expression vectors" refers to vectors that can express a target gene by adding expression elements (such as promoters, RBSs, terminators, etc.) on the basis of the basic framework of a cloning vector. An expression vector consists of four parts: a target gene, a promoter, a terminator, and a marker gene. The present invention includes, but is not limited to, prokaryotic cell expression vectors, eukaryotic cell expression vectors, or other cell expression vectors.

[0056] The term "Framework region", i.e., the framework area, has a very large variation in the amino acid sequence of approximately 110 amino acids near the N-terminus of the H and L chains of immunoglobulins, and the amino acid sequences of other parts are relatively constant. Based on this, the light and heavy chains can be divided into variable regions (V) and constant regions (C). The variable region contains hypervariable regions (HVRs) or complementarity-determining regions (CDRs) and FR framework regions.

[0057] The terms "mutation" and "mutant" have their common meanings herein and refer to genetic, naturally occurring, or introduced changes in nucleic acid or polypeptide sequences, and their meanings are the same as those commonly known to those skilled in the art.

[0058] The term "host cell" or "recombinant host cell" means a cell containing the polynucleotide of the present invention, regardless of the method used for insertion to produce the recombinant host cell, such as direct uptake, transduction, f-mating, or other methods known in the art. The exogenous polynucleotide can be maintained as a non-integrated vector such as a plasmid or can be integrated into the host genome. Description of the Drawings

[0059] Figure 1 Electrophoresis diagram of the first-round PCR amplification of the common antibody heavy chain and the V gene of the heavy-chain antibody HH ; Marker is 2000bp, 1500b, 1000bp, 750bp, 500bp, 250bp and 100bp; 1 and 2 are the products obtained by PCR using different primer combinations; 1 has an amplified fragment of the common antibody heavy chain gene greater than 750bp and an amplified fragment of the heavy-chain antibody gene less than 750bp; 2 is only an amplified fragment of the V gene of the heavy-chain antibody of about 500bp HH gene amplification fragment.

[0060] Figure 2 Diagram of the FAPphage PCR amplification product; Marker (2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp and 100bp), the PCR amplification product is about 400bp.

[0061] Figure 3 Diagram of the SDS-PAGE electrophoresis of the collected solution of the extracted protein "SN1" (wells 1, 2, and 4 are F80-3C4, F80-4G3, and Marker respectively).

[0062] Figure 4 Diagram of the SDS-PAGE electrophoresis of the collected solution of the extracted protein "SN2" (F80-3C4, F80-4G3, and Marker).

[0063] Figure 5 SDS-PAGE identification of the flow-through solution, washing solution, elution solution 1, and elution solution 2 of the SDS-PAGE purified by magnetic beads method (F80-3C4, F80-4G3).

[0064] Figure 6 Test results of the binding ability of the Anti-FAP single-domain antibody to the FAP antigen.

[0065] Figure 7 Electrophoresis results of the prokaryotic expression of the FAP-Fc fusion protein.

[0066] Figure 8 SDS-PAGE reducing gel electrophoresis results of the FAP-Fc fusion protein.

[0067] Figure 9 SEC-HPLC detection results of F80-3C4-Fc.

[0068] Figure 10 SEC-HPLC detection results of F80-4G3-Fc.

[0069] Figure 11 Results of affinity determination of FAP-Fc fusion protein biochip

[0070] Figure 12 143B tumor-bearing mice were intravenously administered once 89 Zr-F803C4-Fc, 89 MIP images of small animal PET / CT scans after Zr-F804G3-Fc

[0071] Figure 13 Distribution maps of radioactivity uptake values in ROI of animal tissues at each scanning time point

[0072] Figure 14 A375 tumor-bearing mice were intravenously administered once 89 Zr-F803C4-Fc, 89 MIP images of small animal PET / CT scans after Zr-F804G3-Fc

[0073] Figure 15 Distribution maps of radioactivity uptake values in ROI of animal tissues at each scanning time point

[0074] Figure 16 A549 tumor-bearing mice were intravenously administered once 89 Zr-F803C4-Fc, 89 MIP images of small animal PET / CT scans after Zr-F804G3-Fc

[0075] Figure 17 Distribution maps of radioactivity uptake values in ROI of animal tissues at each scanning time point

[0076] Figure 18 Graph of tumor size change over time

[0077] Figure 19 Graph of mouse body weight change over time Detailed implementation method

[0078] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description progresses. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and forms of the present invention without departing from the spirit and scope of the present invention, and all such modifications and substitutions fall within the protection scope of the present invention

[0079] Example 1 Construction of a single-domain antibody library specific to FAP antigen

[0080] 1. Immunize alpacas with FAP antigen

[0081] Select adult healthy alpacas and inject FAP antigen subcutaneously at multiple points on the back of the neck. The total amount is 2 mg (FAP Protein, Human, Recombinant (ECD, His Tag), Sino Biological Inc., Catalog No. 10464-H07H). Add an equal volume of Freund's adjuvant to the antigen and immunize 6 times. The immunization interval is 14 - 21 days. Collect serum before and after immunization, and use the ELISA method to determine the immunization titer of the antigen. When the titer reaches more than 10,000 times, collect 70 ml of whole blood, isolate PBMC cells, add Trizol and mix well, then store at -80 °C for later use.

[0082] 1. RNA extraction

[0083] Take 1 ml of the separated PBMC cells, add 0.2 ml of chloroform, and mix well by shaking. Add 200 μL of chloroform, shake vigorously for 15 s, and let stand at room temperature for 3 min; centrifuge at 12,000 rpm at 4 °C for 15 min; carefully take out the centrifuge tube, aspirate the supernatant and transfer it to a new 1.5 mL Eppendorf tube, add an equal volume of isopropanol, invert up and down to mix well, and let stand at room temperature for 10 min; centrifuge at 12,000 rpm at 4 °C for 10 min; carefully discard the supernatant with a pipette tip, add 75% ethanol along the wall of the tube, and gently blow up the precipitate (or gently flick the bottom of the tube with your hand); centrifuge at 7,500 rpm at 4 °C for 5 min; carefully pour out the supernatant, spin for another 1 min, and aspirate the supernatant; open the lid and let stand at room temperature for 10 - 15 min until the ethanol has completely evaporated; add 30 μL of RNase-free water to dissolve the RNA, and immediately reverse transcribe the RNA into cDNA.

[0084] 2. Obtain the variable region - V of the Anti-FAP heavy chain antibody by RT-PCR HH Gene fragment (single-domain antibody gene)

[0085] According to the cDNA synthesis kit (PrimeScript TMUsing the instruction manual of the II 1st Strand cDNA Synthesis Kit (Catalog No. 6210A, manufactured by TAKARA), the extracted RNA was reverse-transcribed into cDNA. The following reaction mixture was prepared in a centrifuge tube: 1 μl of Random 6 mers (50 μM), 1 μl of dNTP Mixture (10 mM each), template RNA: less than 5 μg, and RNase-Free ddH2O to a total volume of 10 μl. The mixture was incubated at 65°C for 5 min and then rapidly cooled on ice. The following reverse transcription reaction solution with a total volume of 20 μl was prepared in the above centrifuge tube. 10 μl of the denatured reaction solution mentioned above, 4 μl of 5×PrimeScript II Buffer, 0.5 μl of RNase Inhibitor (40 U / μl), 1 μl of PrimeScript II RTase (200 U / μl), and RNase-Free dH2O was added to make the total volume 20 μl. The reverse transcription reaction was carried out under the following conditions: 30°C for 10 min, 42°C for 30 - 60 min, 95°C for 5 min, and then cooled on ice.

[0086] Using the cDNA as a template, PCR amplification of the heavy chain V HH gene fragments was performed with two sets of primers respectively. In the first PCR amplification, those greater than 750 bp were common heavy chain gene fragments, and those between 750 - 500 bp were single-domain antibody gene fragments. The heavy chain antibody V HH gene fragments (single-domain antibody genes) were gel-extracted and recovered. Using this as a template, the V HH specific primers were used for PCR amplification to obtain the V HH target gene (~500 bp)

[0087] Table 1 PCR Primer Sequences

[0088]

[0089] First round of PCR (1): 10 pmol of YT1, 10 pmol of YT1BN, 10 pmol of YT2, and 10 pmol of YT1BN.

[0090] The upstream and downstream primers for the second round of PCR were YTV8 and YTV9, each at 10 pmol.

[0091] First round of PCR amplification:

[0092] 5 μl of 10×PCR buffer, 5 μl of dNTPs, 1.5 μl of forward primer, 1.5 μl of reverse primer, 3.5 μl of template, 0.5 μl of Blend Taq enzyme, 33 μl of ddH2O. PCR conditions: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min; perform 25 cycles, 10 min at 4°C.

[0093] Figure 1 For the first-round PCR of the common heavy chain of antibodies and the V gene of the heavy chain antibody HH Gene amplification electrophoresis map.

[0094] Second-round PCR amplification:

[0095] 5 μl of 10×PCR buffer, 5 μl of dNTPs, 1.5 μl of forward primer, 1.5 μl of reverse primer, 3.5 μl of template (the first-round recovered product), 0.5 μl of Blend Taq enzyme, 33 μl of ddH2O. PCR conditions: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min; perform 15 cycles, 10 min at 4°C.

[0096] 3. Ligation and transformation

[0097] Digest the PCR product and the pHEN6 vector with the restriction endonuclease SfiI, digest overnight at 37°C, and purify and recover the fragments using a universal recovery kit (Tiangen, product number: DP214). Mix the recovered fragments and the vector at a ratio of 3:1, add T4 DNA ligase (NEB, M0202L), mix well and centrifuge briefly, place in a 16°C constant-temperature metal bath, ligate overnight, and purify and recover the ligation product using a universal recovery kit. For the ligation product of the V HH fragment and the pHEN6 vector, electrotransform it into TG1 competent cells, spread on plates, and verify the antibody insertion rate by colony PCR. Spread the electrotransformed bacterial solution on LB / Amp plates, incubate at 37°C for 14 hours, count the colonies and calculate the library capacity the next day. Use 2YT medium at 2 mL / plate, scrape the colonies. After mixing all the colonies evenly, add glycerol and store as 20% glycerol bacteria. 1 ml / vial, store at -80°C.

[0098] 4. Anti-FAPV HH Preparation of phage library (single-domain antibody library)

[0099] Take 1 ml of the seed bacterial library and add it to 200 ml of 2YT medium (containing a final concentration of 50 μg / ml Amp + 1% glucose), culture at 37°C until OD 600After it reaches 0.8 - 1, add M13KO7 helper phage at a ratio of 1:20 for infection. After culturing for 1 hour, replace it with fresh 2YT medium (containing 100 μg / ml Amp + 50 μg / ml Kana at the final concentration), and culture it overnight on a shaker at 37°C. Collect the bacterial solution into a sterile centrifuge tube, centrifuge to collect the supernatant, then add 1 / 5 volume of 20% PEG - 2.5M NaCl, mix well, incubate on ice for 1 hour, centrifuge at 12,000 rpm for 30 min, discard the supernatant, dissolve the precipitate in 3 ml of sterile 15% glycerol - PBS solution, and store the phage library at -80°C.

[0100] Example 2 Screening of Anti - FAP Single - Domain Antibody

[0101] 1. Screening for FAP - specific single - domain antibody

[0102] Coat the FAP protein onto the immunotube with the coating solution for the first - round screening at 25 μg / ml. (The coating concentration for the second - round screening is 10 μg / ml.) Discard the coating solution, block the whole tube with the blocking solution, add the phage solution after 1 h at room temperature, wash the tube 20 times with PBST, and then wash 5 times with PBS. Elute with 500 μl of elution solution and add the neutralizing solution for neutralization. Take 2 μl of the eluted phage for titer determination, and culture the remaining phage solution for expansion.

[0103] Determining the titer is convenient for the next - round screening. The screening results are shown in Table 2.

[0104] Table 2 Screening of Anti - FAP Specific Single - Domain Antibody

[0105]

[0106] Using the coated FAP protein as the target, perform 3 - round screening from the total phage antibody library by solid - phase screening method, detect the titer of the phage eluted in each round. As can be seen from Table 2, as the number of screening rounds increases, the coating concentration decreases step by step, but the titer of the eluted phage increases, indicating that FAP - specific phages are enriched.

[0107] 2. Construction of Anti - FAP Single - Domain Antibody Expression Plasmid

[0108] Use the following sequences as primers:

[0109] 5 - nano - BbsI—GAAGAAGAAGACAACAGGCCSVKGTGMAGCTGGWGGAKTCT (SEQ ID NO.20);

[0110] 3-nano-BamHI——GAAGATCTCCGGATCCTGAGGAGACGGTGACCTGGGT(SEQ ID NO.21);

[0111] Using the elution product of phage screening as a template, a specific Anti-FAP single-domain antibody gene was obtained by PCR amplification ( Figure 2 Shown in the figure of FAPphage PCR amplification product). The PCR product and the pSJF2 vector were treated with the restriction enzymes BbsI and BamHI respectively, and the ligated fragments were electrotransformed into TG1 competent cells by T4 DNA ligase to obtain a plasmid capable of highly expressing single-domain antibodies in Escherichia coli.

[0112] 3. Screening of Anti-FAP single-domain antibody positive clones

[0113] 94 single colonies were randomly picked from the recombinant monoclonal colony agar plate and inoculated into a 96-well deep-well culture plate containing 2YT liquid medium with Amp. After culturing for 4 hours, IPTG was added to the deep-well culture plate to a final concentration of 1 mM for induction. After culturing overnight, the bacterial supernatant expressing the protein was harvested, and the FAP antigen was coated for ELISA determination. The concentration of the coated FAP antigen protein was 1 μg / ml, 100 μl / well, and incubated overnight at 4°C. The supernatant after overnight induction was added, and Anti-myc (HRP) was used as the secondary antibody, and incubated at 37°C for 1 h. After washing, TMB was added for color development, 2M H2SO4 was added to terminate the reaction, and the OD value of the sample at a wavelength of 450 nm was measured with an enzyme-linked immunosorbent assay reader. The Anti-FAP positive wells were selected, and DNA sequencing was performed to identify the gene sequences of the anti-FAP single-domain antibody clones, and a series of single-domain antibody gene sequences were obtained. Through the analysis and typing of the amino acids encoded by the sequences, single-domain antibodies of multiple gene subtypes were obtained, and finally, highly specific and highly active anti-FAP single-domain antibodies F80-3C4 and F80-4G3 were screened; among them, the amino acid sequence of the single-domain antibody F80-3C4 includes 3 complementary determining regions (CDRs), and the amino acid sequences of the 3 complementary determining regions are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 respectively; the amino acid sequence of the single-domain antibody F80-3C4 is shown in SEQ ID NO.4, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.5; the amino acid sequence of the single-domain antibody F80-4G3 includes 3 complementary determining regions (CDRs), and the amino acid sequences of the 3 complementary determining regions are shown in SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8 respectively; the amino acid sequence of the single-domain antibody F80-3C4 is shown in SEQ ID NO.9, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.10.

[0114] 4. Expression and purification of anti-FAP single domain antibody

[0115] Inoculate the bacterial strain containing the target gene by streaking on a culture plate containing ampicillin and culture overnight at 32 °C. Select a single clone and inoculate it into 4 mL of 2YT medium containing ampicillin and culture overnight. Inoculate the overnight culture into 100 mL of 2YT medium containing ampicillin at a ratio of 1:100, culture for 2 - 3 hours, and measure the OD 600 value. When the OD value is 0.4 - 0.6, add IPTG for induction and continue to culture overnight. Centrifuge the overnight culture, discard the supernatant, and collect the bacterial cells. Resuspend the bacterial cells in Sucrose Buffer and centrifuge to collect the supernatant, denoted as "SN1". Resuspend the bacterial cells in Shock Buffer, incubate on ice, and then centrifuge to collect the supernatant, denoted as "SN2".

[0116] Take an appropriate amount of magnetic beads (Beaver, product number: 70501-100) into a centrifuge tube, perform magnetic separation, and discard the supernatant. Remove the centrifuge tube from the magnetic rack, add Binding Buffer, perform magnetic separation, and discard the supernatant. Add the prepared magnetic beads to the "SN1" or (and) "SN2" liquid containing the target protein. Place the centrifuge tube on a mixer and rotate and mix at room temperature. Place the centrifuge tube on the magnetic rack for magnetic separation, transfer the supernatant to a new centrifuge tube for subsequent detection. Remove the centrifuge tube from the magnetic rack, add Washing Buffer, invert the centrifuge tube several times to resuspend the magnetic beads; perform magnetic separation, transfer the supernatant to a new centrifuge tube for subsequent detection. Remove the centrifuge tube from the magnetic rack, add Elution Buffer, invert the centrifuge tube several times to resuspend the magnetic beads; perform magnetic separation, transfer the supernatant to a new centrifuge tube for subsequent detection.

[0117] Figure 3 SDS-PAGE electrophoresis diagram of the collected solution "SN1" for protein extraction; Figure 4 SDS-PAGE electrophoresis diagram of the collected solution "SN2" for protein extraction; Figure 5 SDS-PAGE identification results of the flow-through solution, washing solution, eluate 1, and eluate 2 purified by the magnetic bead method.

[0118] Example 3 Confirmation of the binding ability of the purified anti-FAP single domain antibody to FAP antigen

[0119] Dilute the FAP-his antigen with 0.05M NaHCO3 (pH 9.6) coating solution to 1 μg / ml, 100 μl / well, and coat at 4 °C overnight. Block the 96-well plate with 4% PBSM at 37 °C for 1 hour. Add purified Anti-FAP single domain antibody at different dilution concentrations and incubate at 37 °C for 1 hour. Wash the plate three times with 0.05% PBST. Add the secondary antibody Anti-cmyc-antibody-HRP diluted 1:3000, 100 μl / well, and incubate at 37 °C for 1 hour. Wash the plate three times with 0.05% PBST. Add 100 μl of TMB and let it develop color in the dark at room temperature for 10 minutes. Add 50 μl of 2M H2SO4 to terminate the reaction. Measure the OD value of the sample at a wavelength of 450 nm with an enzyme-linked immunosorbent assay (ELISA) reader.

[0120] Figure 6 It is the test result of the binding ability between the Anti-FAP single domain antibody and the FAP antigen.

[0121] Example 4 Construction and expression of FAP-Fc fusion protein

[0122] I. Construction and expression of FAP-Fc fusion protein

[0123] 1. Construction steps:

[0124] Gene synthesis of F80-3C4-Fc (Human IgG4-Fc(S228P)) (amino acid sequence shown in SEQ ID NO.11, nucleotide sequence of the encoding gene shown in SEQ ID NO.12), F80-4G3-Fc (Human IgG4-Fc(S228P)) (amino acid sequence shown in SEQ ID NO.13, nucleotide sequence of the encoding gene shown in SEQ ID NO.14), add a NotI restriction site at the 5' end and an XbaI restriction site at the 3' end, digest F80-3C4-Fc, F80-4G3-Fc and pCDA3.4 vector with NotI / XbaI respectively, ligate and transform Escherichia coli, randomly select 4 colonies for colony PCR identification, use CMV-F (CGCAAATGGGCGGTAGGCGTG(SEQ ID NO.22)) / SEQ-R (AGCGTAAAAGGAGCAACATAGT(SEQ IDNO.23)) primers for colony PCR, and the PCR conditions are 95 °C, 3 min; 95 °C, 30 S, 55 °C, 30 S, 72 °C, 40 S, 30 cycles; 72 °C, 10 min; 4 °C, save.

[0125] The electrophoresis results are shown in Figure 7 . Select these clones for gene sequencing, and the sequencing is correct.

[0126] 2. Expression of FAP-Fc fusion protein

[0127] Transient expression in HEK293 cells: When the cell density reaches 2.5 - 3.0 x 10^6 cells / ml, perform transient transfection and expression on 100 ml of cultured cells. Dilute 50 μg of F80-3C4-Fc and F80-4G3-Fc expression plasmids with the culture medium, add 200 μl of transfection reagent, mix well, add to the cultured cells, mix well, incubate at 37°C for 15 minutes, then transfer to a shaker for culturing for one week. Collect the supernatant and centrifuge at 8000 rpm for 5 minutes.

[0128] 3. Purification of FAP-Fc fusion protein

[0129] Purification method: Purification using Protein A affinity chromatography column

[0130] (1) Equilibrate the chromatography column: 1xPBS, flow rate 1 ml / min, 20 ml;

[0131] (2) Load the sample: Flow rate 1 ml / min;

[0132] (3) Wash away impurities: 1xPBS, flow rate 1 ml / min, 20 ml;

[0133] (4) Elute: Citrate buffer (pH 3.4), 1 ml / min, collect in fractions, approximately 500 μl per tube. A total of 10 tubes are collected, and the absorbance at 280 nm is measured using a NanoDrop instrument;

[0134] (5) Dialyze: Transfer the high-concentration protein to a dialysis bag and dialyze in a beaker containing 1xPBS.

[0135] Table 3 Protein concentration and expression level after purification

[0136] Sample Name Concentration (mg / ml) Expression Level (mg / L) F80-3C4-Fc 4.19 109.6 F80-4G3-Fc 4.15 153.5

[0137] 4. Quality inspection

[0138] Quality inspection results are shown in SDS-PAGE electrophoresis and SEC-HPLC:

[0139] (1) The results of SDS-PAGE reducing gel electrophoresis are as Figure 8 shown. The molecular weight of F80-3C4-Fc is close to the theoretical value of 38278.11 Daltons, and the molecular weight of F80-4G3-Fc is close to the theoretical value of 38232.19 Daltons. The electrophoresis purity is over 95%.

[0140] (2) Purity detection (SEC-HPLC): Purity detection results are shown in Figure 9 and Figure 10 . From Figure 9The results showed that the purity of F80-3C4-Fc at 280 nm was 95.614% as detected by SEC-HPLC. From Figure 10 The results showed that the purity of F80-4G3-Fc at 280 nm was 76.04% as detected by SEC-HPLC.

[0141] II. Affinity determination of biochip

[0142] 1. Chip preparation

[0143] The mouse anti-human IgG (Fc) antibody was diluted to 25 μg / mL with the immobilization reagent (10 mM sodium acetate, pH 5.0). First, the surface of the CM5 chip was activated with 400 mM EDC and 100 mM NHS at a flow rate of 10 μL / min for 420 s. Second, the 25 μg / mL mouse anti-human IgG (Fc) antibody was injected into the experimental channel (FC2) at a flow rate of 10 μL / min for about 420 s, and the immobilized amount was about 9000 to 14000 RU. Finally, the chip was blocked with 1 M ethanolamine at a flow rate of 10 μL / min for 420 s. The reference channel (FC1) was operated in the same way as the test channel (FC2). (Refer to the instruction manual of the human IgG (Fc) capture kit of GE, 《22-0648-88AD》).

[0144] 2. Capture ligand

[0145] FAP-Fc was diluted to 9 μg / mL with the running reagent and injected into the experimental channel (FC2) at a flow rate of 10 μL / min in sequence to capture about 800 RU. F804G3-Fc and F803C4-Fc were diluted to 1 μg / mL with the running reagent and injected into the experimental channel (FC2) at a flow rate of 10 μL / min in sequence to capture about 90 RU. The reference channel (FC1) did not need to capture the ligand.

[0146] F80-4G3 and F80-3C4 were serially diluted 2-fold from a starting concentration of 25 nM to 0.195 nM with the running reagent, and FAP-His was serially diluted 2-fold from a starting concentration of 50 nM to 0.391 nM with the running reagent. The diluted samples were sequentially injected into the experimental channel and the reference channel at a flow rate of 30 μL / min, the binding time was 120 s, and the dissociation time was 280 s. The binding and dissociation steps were both carried out in the running reagent. After each concentration analysis, the chip needed to be regenerated with 3 M magnesium chloride at a flow rate of 20 μL / min for 30 s to remove the ligand and the undissociated analyte.

[0147] The detection results are shown in Table 4 and Figure 11 .

[0148] Table 4 Affinity determination results

[0149]

[0150] According to the detection results, the affinities of Biacore 8K for detecting FAP-Fc with F80-4G3 and F80-3C4 are 0.393 nM and 0.654 nM respectively, and the affinities of FAP-His for F804G3-Fc and F803C4-Fc are 0.307 nM and 0.547 nM respectively.

[0151] Example 5 Antibody Modification, Labeling, Performance Detection and In Vivo Tumor Inhibition Assay

[0152] 1. Antibody Modification and Labeling

[0153] 1.1 89 Preparation of Zr-F803C4-Fc

[0154] Antibody modification: Take antibody F803C4-Fc (4.17 mg / mL, 76 KDa), adjust the pH to 9 with 1 M Na2CO3; according to the molar ratio of F803C4-Fc:DFO = 1:10, add DFO solution (10 mg / mL, in DMSO); react at 37 °C for 70 min to obtain the crude modified product; purify the crude product with a PD-10 column, add 2.5 mL of acetate buffer (0.2 M, pH = 7.2), collect the effluent to obtain DFO-F803C4-Fc.

[0155] Radioactive labeling: Adjust the pH of the zirconium oxalate solution to 7.0 with acetate buffer (0.2 M, pH = 7.2) and Na2CO3 (1 M); add the purified DFO-F803C4-Fc above, react at room temperature for 60 min (specific activity about 2 mCi / mg); purify the crude reaction product with a PD-10 column, add 3 mL of normal saline, collect the effluent to obtain 89Zr-F803C4-Fc. The Radio-iTLC detection result shows that the radiochemical purity is 100%.

[0156] 89 Preparation method reference of Zr-F804G3-Fc 89 Zr-F803C4-Fc.

[0157] 1.2 177 Preparation of Lu-F803C4-Fc

[0158] Antibody modification: Take antibody F803C4-Fc (10.87 mg / mL, 76 KDa), adjust the pH to 9 with 1 M Na2CO3; add DOTA solution (20 mg / mL) according to the molar ratio of F803C4-Fc:DOTA = 1:10; react at 37 °C for 70 min to obtain the crude modified product; purify the crude product with a PD-10 column, add 2.5 mL of acetate buffer (0.2 M, pH = 7.2), collect the eluate to obtain DOTA-F803C4-Fc.

[0159] Radioactive labeling: Take an appropriate amount of 177 LuCl3 and add it to DOTA-F803C4-Fc, with a specific activity of about 2 mCi / mg; react at 37 °C for 60 min; purify the crude reaction product with a PD-10 column, add 3 mL of normal saline, collect the eluate to obtain 177 Lu-F803C4-Fc. The Radio-iTLC detection results show that the radiochemical purity is 100%.

[0160] 2. In vitro stability experiment of the labeled antibody

[0161] 89 After storing Zr-F803C4-Fc at 2 - 8 °C in 0.15 M acetic acid / sodium acetate buffer (pH = 7.2) for 21 h and 25 h, the Radio-iTLC detection results show that the radiochemical purity is 100% in both cases.

[0162] 89 After storing Zr-F804G3-Fc at 2 - 8 °C in 0.15 M acetic acid / sodium acetate buffer (pH = 7.2) for 21 h and 25 h, the Radio-iTLC detection results show that the radiochemical purity is 100% in both cases.

[0163] 3. PET / CT scan of the labeled antibody

[0164] Experimental protocol: Administer the imaging agent 89 Zr-F803C4-Fc, 89 Zr-F804G3-Fc to mice of 3 models respectively for 1 h of PET dynamic scan, and perform small animal whole body PET scans at 4 h, 24 h, 48 h, 72 h, 96 h, 168 h, and 216 h after administration. Keep the animals stationary, and complete CT scans before / after the small animal PET scans. Before the scan, anesthetize the animals with isoflurane through an anesthesia machine, place the animals that have completed anesthesia induction on the small animal PET / CT bed, and the animals will continuously inhale isoflurane during the scan to maintain the anesthetic effect. Static scan each bed for 10 - 30 min, scan energy window: 350 - 650 Kev, and record the scan time.

[0165] After the small animal PET / CT scan is completed, image reconstruction is performed. The PMOD software is used to process the images and data. Organs such as the heart, whole brain, and muscle are outlined as regions of interest to obtain the radioactivity concentration (i.e., the radioactivity value per unit volume) of the region of interest (ROI), and then the activity at each time point is decay-corrected.

[0166] 3.1 143B model

[0167] After a single intravenous administration of 89 Zr-F803C4-Fc, 89 Zr-F804G3-Fc to 143B tumor-bearing mice, the MIP images of the small animal PET / CT scan are shown in Figure 12 , and the %ID / g values of the regions of interest at each scan time point are shown in Figure 13 .

[0168] It can be seen from Figure 12 and Figure 13 that after a single intravenous administration of 89 Zr-F803C4-Fc, the radioactive substances are mainly distributed in the liver and heart, followed by the spleen, kidney, and lung, then the stomach, bone joints, and tumor, and the intestine, bladder, brain, tibia, and muscle have relatively low distribution. The radioactivity uptake value of the tumor first increases and then decreases with time and reaches the peak at 48 h, which is 7.82.

[0169] After a single intravenous administration of 89 Zr-F804G3-Fc, the radioactive substances are mainly distributed in the liver and heart, followed by the spleen, kidney, and lung, then the stomach, bone joints, and tumor, and the intestine, bladder, brain, tibia, and muscle have relatively low distribution. The radioactivity uptake value of the tumor first increases and then decreases with time and reaches the peak at 24 h, which is 6.25.

[0170] 3.2 A375 model

[0171] After a single intravenous administration of 89 Zr-F803C4-Fc, 89 Zr-F804G3-Fc to A375 tumor-bearing mice, the MIP images of the small animal PET / CT scan are shown in Figure 14 , and the %ID / g values of the regions of interest at each scan time point are shown in Figure 15 .

[0172] It can be seen from Figure 14 and 15 that after a single intravenous administration of 89 Zr-F803C4-Fc, the radioactive substances are mainly distributed in the liver and heart, followed by the lung, spleen, and kidney, then the stomach, bone joints, and tumor, and the intestine, brain, tibia, and muscle have relatively low distribution. The radioactivity uptake value of the tumor first increases and then decreases with time and reaches the peak at 96 h, which is 5.13.

[0173] After single intravenous administration 89 of Zr-F804G3-Fc, the radioactive substances were mainly distributed in the liver and heart, followed by the lungs, spleen and kidneys, then the stomach, bones and joints, and tumors, and the intestines, brain, tibia and muscles had relatively low distribution. The radioactivity uptake value of the tumor first increased and then decreased over time and reached the peak at 72 h, which was 2.93.

[0174] 3.3 A549 model (FAP negative)

[0175] After single intravenous administration of 89 Zr-F803C4-Fc, 89 Zr-F804G3-Fc to A549 tumor-bearing mice, the MIP images of small animal PET / CT scans are shown in Figure 16 , and the %ID / g values of the regions of interest at each scanning time point are shown in Figure 17 .

[0176] It can be seen from Figure 16 and Figure 17 that after single intravenous administration of 89 Zr-F803C4-Fc, the radioactive substances were mainly distributed in the liver and heart, followed by the spleen, kidneys and lungs, then the stomach, bones and joints, and tumors, and the intestines, brain, tibia and muscles had relatively low distribution. The radioactivity uptake value of the tumor first increased and then decreased over time and reached the peak at 48 h, which was 4.25.

[0177] After single intravenous administration of 89 Zr-F804G3-Fc, the radioactive substances were mainly distributed in the liver and heart, followed by the lungs, spleen and kidneys, then the stomach and bones and joints, and the tumors, intestines, brain, tibia and muscles had relatively low distribution. The radioactivity uptake value of the tumor first increased and then decreased over time and reached the peak at 24 h, which was 2.83.

[0178] 4. Efficacy and safety tests of the labeled antibody

[0179] 4.1 Experimental protocol

[0180] After single intravenous injection of about 400 μCi of 177 Lu-F803C4-Fc to HT1080 tumor-bearing mice, the tumor size and body weight were detected. 177 The solvent of Lu-test substance was normal saline, and the dilution solution for animal administration was normal saline. The control groups were normal saline (with the same administration volume as the experimental group) and 177 LuCl3 (400 μCi). The body weight was weighed and the tumor size was measured before administration. After administration, the body weight and tumor size of the enrolled experimental animals were detected every day.

[0181] The number of mice in each group was respectively: 1778 mice in the Lu-F803C4-Fc experimental group, 4 mice in the normal saline control group, 177 8 mice in the LuCl3 control group, with half males and half females. During the animal feeding period, they had free access to food and water. The environmental conditions were set as room temperature of 20°C to 26°C, relative humidity of 40% to 70%, and 12-hour light and dark alternation.

[0182] 4.2 Experimental results

[0183] The tumor size changed over time as Figure 18 shown, and the body weight of the mice changed over time as Figure 19 shown.

[0184] According to the experimental results, it can be seen that there were no significant differences in the tumor volumes among the groups before treatment. After treatment, 177 the average tumor volume in the Lu-F803C4-Fc group was less than 1500 mm until the 29th day 3 (1093.16 ± 382.49 mm 3 ), while the average tumor volume in the normal saline group gradually increased and finally reached 2829.02 ± 1165.54 mm 3 . 177 The tumor growth curve trend in the LuCl3 group was the same as that in the normal saline group. Compared with the normal saline group and 177 the LuCl3 group, 177 the Lu-F803C4-Fc group could significantly inhibit tumor growth. 177 No adverse reactions such as rapid weight loss, diarrhea, hair loss, etc. were observed in the Lu-F803C4-Fc group, indicating that 177 Lu-F803C4-Fc had good safety. SEQUENCE LISTING <110> Nanjing Jiangyuan Andico Positron Research & Development Co., Ltd., Beijing New Ambow Biotechnology Co., Ltd. <120> Anti-FAP single domain antibody, Fc fusion protein, immunoconjugate and their applications <130> BJ-3038-210411A <160> 23 <170> PatentIn version 3.5 <210> 1 <211> 7 <212> PRT <213> Vicugna pacos <400> 1 Val Asn Ser Tyr Thr Met Gly 1 5 <210> 2 <211> 14 <212> PRT <213> Vicugna pacos <400> 2 Ala Phe Ile Thr Thr Asp Gly Met Thr Asn Tyr Ala Ser Ser 1 5 10 <210> 3 <211> 9 <212> PRT <213> Vicugna pacos <400> 3 Asn Arg Ser Pro Pro Gly Val Ser Asn 1 5 <210> 4 <211> 116 <212> PRT <213> Vicugna pacos <400> 4 Gln Val Gln Phe Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asn Ile Val Asn Ser Tyr 20 25 30 Thr Met Gly Trp Tyr Arg Gln Ala Leu Gly Lys Gln Arg Glu Tyr Val 35 40 45 Ala Phe Ile Thr Thr Asp Gly Met Thr Asn Tyr Ala Ser Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Asp Leu 65 70 75 80 His Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Arg Ser Pro Pro Gly Val Ser Asn Tyr Trp Gly Gln Gly Thr Gln Val 100 105 110 Thr Val Ser Ser 115 <210> 5 <211> 348 <212> DNA <213> Vicugna pacos <400> 5 caggtgcagt tcgtggagtc tgggggaggc ttggtacagc ctggggggtc tctgagactc 60 tcctgtgcag cctctggaaa catcgtgaat agctatacca tgggctggta ccgccaggct 120 ctcgggaagc agcgcgagta cgtcgcattt attactactg acggtatgac aaattatgca 180 agctccgtga agggccggtt caccatctcc agagacaacg ccaagaacac ggtggatctg 240 cacatgaaca gcctgaaacc tgaggacacg gccgtctatt actgtaatag aagcccaccg 300 ggcgtttcga attactgggg ccaggggacc caggtcaccg tctcctca 348 <210> 6 <211> 7 <212> PRT <213> Vicugna pacos <400> 6 Val Ser Val Gly Phe Met Gly 1 5 <210> 7 <211> 15 <212> PRT <213> Vicugna pacos <400> 7 Ala Gly Ile Ser Thr Tyr Ser Asp Asp Ile Asn Val Val Asp Ser 1 5 10 15 <210> 8 <211> 10 <212> PRT <213> Vicugna pacos <400> 8 Ser Glu Val Pro Pro Arg Ile Gly Gln Asn 1 5 10 <210> 9 <211> 117 <212> PRT <213> Vicugna pacos <400> 9 Gln Val Gln Phe Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Val Ser Val Gly 20 25 30 Phe Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Lys Arg Glu Leu Val 35 40 45 Ala Gly Ile Ser Thr Tyr Ser Asp Asp Ile Asn Val Val Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Phe 65 70 75 80 Leu Gln Met Ser Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ser Glu Val Pro Pro Arg Ile Gly Gln Asn Trp Gly Gln Gly Thr Gln 100 105 110 Val Thr Val Ser Ser 115 <210> 10 <211> 351 <212> DNA <213> Vicugna pacos <400> 10 caggtgcagt tcgtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60 tcctgtgcag cctctggaag catcgtcagt gtcggtttca tgggctggta ccgccaggct 120 ccagggaaga agcgcgaatt ggtcgcaggt attagcactt atagtgatga cataaacgtt 180 gtagactccg tgaagggccg attcaccatc tccagagaca acgccaagaa cacggtattt 240 ctgcaaatga gcagcctgaa acctgaggac acggccgtct attactgtag tgaagtcccg 300 ccaagaatcg ggcagaactg gggccagggg acccaggtca ccgtctcctc a 351 <210> 11 <211> 345 <212> PRT <213> Artifical sequence <400> 11 Gln Val Gln Phe Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asn Ile Val Asn Ser Tyr 20 25 30 Thr Met Gly Trp Tyr Arg Gln Ala Leu Gly Lys Gln Arg Glu Tyr Val 35 40 45 Ala Phe Ile Thr Thr Asp Gly Met Thr Asn Tyr Ala Ser Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Asp Leu 65 70 75 80 His Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Arg Ser Pro Pro Gly Val Ser Asn Tyr Trp Gly Gln Gly Thr Gln Val 100 105 110 Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro 115 120 125 Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 130 135 140 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 145 150 155 160 Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr 165 170 175 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 180 185 190 Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 195 200 205 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 210 215 220 Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 225 230 235 240 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met 245 250 255 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 260 265 270 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 275 280 285 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 290 295 300 Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val 305 310 315 320 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 325 330 335 Lys Ser Leu Ser Leu Ser Leu Gly Lys 340 345 <210> 12 <211> 1035 <212> DNA <213> Artifical sequence <400> 12 caggtgcagt tcgtggagtc tgggggaggc ttggtacagc ctggggggtc tctgagactc 60 tcctgtgcag cctctggaaa catcgtgaat agctatacca tgggctggta ccgccaggct 120 ctcgggaagc agcgcgagta cgtcgcattt attactactg acggtatgac aaattatgca 180 agctccgtga agggccggtt caccatctcc agagacaacg ccaagaacac ggtggatctg 240 cacatgaaca gcctgaaacc tgaggacacg gccgtctatt actgtaatag aagcccaccg 300 ggcgtttcga attactgggg ccaggggacc caggtcaccg tctcctcaga gtccaaatat 360 ggtcccccat gcccaccatg cccagcacct gagttcctgg ggggaccatc agtcttcctg 420 ttccccccaa aacccaagga cactctcatg atctcccgga cccctgaggt cacgtgcgtg 480 gtggtggacg tgagccagga agaccccgag gtccagttca actggtacgt ggatggcgtg 540 gaggtgcata atgccaagac aaagccgcgg gaggagcagt tcaacagcac gtaccgtgtg 600 gtcagcgtcc tcaccgtcct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 660 gtctccaaca aaggcctccc gtcctccatc gagaaaacca tctccaaagc caaagggcag 720 ccccgagagc cacaggtgta caccctgccc ccatcccagg aggagatgac caagaaccag 780 gtcagcctga cctgcctggt caaaggcttc taccccagcg acatcgccgt ggagtgggag 840 agcaatgggc agccggagaa caactacaag accacgcctc ccgtgctgga ctccgacggc 900 tccttcttcc tctacagcag gctaaccgtg gacaagagca ggtggcagga ggggaatgtc 960 ttctcatgct ccgtgatgca tgaggctctg cacaaccact acacacagaa gagcctctcc 1020 ctgtctctgg gtaaa 1035 <210> 13 <211> 346 <212> PRT <213> Artifical sequence <400> 13 Gln Val Gln Phe Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Val Ser Val Gly 20 25 30 Phe Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Lys Arg Glu Leu Val 35 40 45 Ala Gly Ile Ser Thr Tyr Ser Asp Asp Ile Asn Val Val Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Phe 65 70 75 80 Leu Gln Met Ser Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ser Glu Val Pro Pro Arg Ile Gly Gln Asn Trp Gly Gln Gly Thr Gln 100 105 110 Val Thr Val Ser Ser Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys 115 120 125 Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro 130 135 140 Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys 145 150 155 160 Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp 165 170 175 Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu 180 185 190 Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu 195 200 205 His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn 210 215 220 Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly 225 230 235 240 Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu 245 250 255 Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr 260 265 270 Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn 275 280 285 Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe 290 295 300 Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn 305 310 315 320 Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr 325 330 335 Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys 340 345 <210> 14 <211> 1038 <212> DNA <213> Artifical sequence <400> 14 caggtgcagt tcgtggagtc tgggggaggc ttggtgcagc ctggggggtc tctgagactc 60 tcctgtgcag cctctggaag catcgtcagt gtcggtttca tgggctggta ccgccaggct 120 ccagggaaga agcgcgaatt ggtcgcaggt attagcactt atagtgatga cataaacgtt 180 gtagactccg tgaagggccg attcaccatc tccagagaca acgccaagaa cacggtattt 240 ctgcaaatga gcagcctgaa acctgaggac acggccgtct attactgtag tgaagtcccg 300 ccaagaatcg ggcagaactg gggccagggg acccaggtca ccgtctcctc agagtccaaa 360 tatggtcccc catgcccacc atgcccagca cctgagttcc tggggggacc atcagtcttc 420 ctgttccccc caaaacccaa ggacactctc atgatctccc ggacccctga ggtcacgtgc 480 gtggtggtgg acgtgagcca ggaagacccc gaggtccagt tcaactggta cgtggatggc 540 gtggaggtgc ataatgccaa gacaaagccg cgggaggagc agttcaacag cacgtaccgt 600 gtggtcagcg tcctcaccgt cctgcaccag gactggctga acggcaagga gtacaagtgc 660 aaggtctcca acaaaggcct cccgtcctcc atcgagaaaa ccatctccaa agccaaaggg 720 cagccccgag agccacaggt gtacaccctg cccccatccc aggaggagat gaccaagaac 780 caggtcagcc tgacctgcct ggtcaaaggc ttctacccca gcgacatcgc cgtggagtgg 840 gagagcaatg ggcagccgga gaacaactac aagaccacgc ctcccgtgct ggactccgac 900 ggctccttct tcctctacag caggctaacc gtggacaaga gcaggtggca ggaggggaat 960 gtcttctcat gctccgtgat gcatgaggct ctgcacaacc actacacaca gaagagcctc 1020 tccctgtctc tgggtaaa 1038 <210> 15 <211> 21 <212> DNA <213> Artifical sequence <400> 15 cgccatcaag gtaccagttg a 21 <210> 16 <211> 29 <212> DNA <213> Artifical sequence <400> 16 ggggtacctg tcatccacgg accagctga 29 <210> 17 <211> 43 <212> DNA <213> Artifical sequence <400> 17 cagccggcca tggccsmkgt rcagctggtg gaktctgggg gag 43 <210> 18 <211> 41 <212> DNA <213> Artifical sequence <400> 18 catgtgcatg gcctagactc gcggcccagc cggccatggc c 41 <210> 19 <211> 47 <212> DNA <213> Artifical sequence <400> 19 catgtgtaga ttcctggccg gcctggcctg aggagacggt gacctgg 47 <210> 20 <211> 41 <212> DNA <213> Artifical sequence <400> 20 gaagaagaag acaacaggcc svkgtgmagc tggwggaktc t 41 <210> 21 <211> 37 <212> DNA <213> Artifical sequence <400> 21 gaagatctcc ggatcctgag gagacggtga cctgggt 37 <210> 22 <211> 21 <212> DNA <213> Artifical sequence <400> 22 cgcaaatggg cggtaggcgt g 21 <210> 23 <211> 22 <212> DNA <213> Artifical sequence <400> 23 agcgtaaaag gagcaacata gt 22

Claims

1. Anti-FAP single domain antibody, characterized in that, The single-domain antibody is single-domain antibody F80-3C4; the amino acid sequence of the single-domain antibody F80-3C4 comprises three complementary determining regions, and the amino acid sequences of the three complementary determining regions are shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 respectively.

2. The anti-FAP single-domain antibody according to claim 1, characterized in that, The amino acid sequence of the single-domain antibody F80-3C4 is the amino acid sequence shown as SEQ ID NO.

4.

3. The encoding gene of the single-domain antibody according to claim 1 or 2.

4. The coding gene according to claim 3, wherein The nucleotide sequence of the encoding gene is the polynucleotide sequence shown as SEQ ID NO.

5.

5. An Fc fusion protein obtained by fusing an anti-FAP single domain antibody according to claim 1 or 2 with an Fc protein, characterized in that, The amino acid sequence of the Fc fusion protein is the amino acid sequence shown as SEQ ID NO.

11.

6. The encoding gene of the Fc fusion protein according to claim 5.

7. The coding gene according to claim 6, wherein The nucleotide sequence of the encoding gene is the polynucleotide sequence shown as SEQ ID NO.

12.

8. An expression vector containing the encoding gene according to claim 3, 4, 6 or 7.

9. An immunoconjugate, characterized in that, An immunoconjugate obtained by conjugating the anti-FAP single-domain antibody according to claim 1 or 2 with a functional molecule, or an immunoconjugate obtained by conjugating the Fc fusion protein according to claim 5 with a functional molecule; wherein, the functional molecule is a radioisotope.

10. The immunoconjugate according to claim 9, wherein The radioactive isotope is 89 Zr or 177 Lu.

11. A pharmaceutical composition, characterized in that, Comprising any one or more of the anti-FAP single-domain antibody according to claim 1 or 2, the Fc fusion protein according to claim 5, or the immunoconjugate according to claim 9 or 10, and a pharmaceutically acceptable carrier.

12. Use of the anti-FAP single-domain antibody according to claim 1 or 2, the Fc fusion protein according to claim 5, the immunoconjugate according to claim 9 or 10, or the pharmaceutical composition according to claim 11 in the preparation of a reagent or drug for diagnosing or treating cancer; the cancer is human osteosarcoma, human malignant melanoma or lung cancer.

Citation Information

Patent Citations

  • TNF-immunoconjugates with fibroblast activation protein antibodies and methods and uses thereof

    WO2011040973A2

  • Compositions including IGG FC mutations and uses thereof

    WO2021041715A2