siRNA of angiopoietin-like 3 (ANGPTL3) and its use

Abstract

Provided are siRNA for angiopoietin-like 3 (ANGPTL3) and its use. By designing a suitable specific small interfering RNA sequence and siRNA conjugate, ANGPTL3 is targeted, and the transcript of the ANGPTL3 gene in cells is degraded, thereby reducing the expression of ANGPTL3 protein. The siRNA can be used to prevent and / or treat dyslipidemia.

Description

Technical Field

[0001] The present disclosure relates to the field of gene engineering technology, and in particular, to siRNA of angiopoietin-like 3 (ANGPTL3) and uses thereof. Background Art

[0002] Hyperlipidemia, also known as dyslipidemia, is a systemic disease in which fat metabolism or operation is abnormal, causing plasma lipids to be higher than normal. The clinical manifestations of dyslipidemia mainly include two aspects: (1) xanthomas caused by lipid deposition in the dermis; (2) atherosclerosis caused by lipid deposition in the vascular endothelium, resulting in coronary heart disease and peripheral vascular disease. According to surveys, about 10% to 20% of adults have elevated total cholesterol (TC) or triglycerides (TG), and even nearly 10% of children have elevated blood lipids. Existing drugs for the treatment of dyslipidemia mainly include statins, cholesterol absorption inhibitors, resins, probucol, fibrates, and niacin and its derivatives.

[0003] At present, there are more or less contraindications and side effects after the use of therapeutic drugs. For example, statins are the first choice for lowering serum total cholesterol. They are used to treat patients with simple elevated serum total cholesterol levels. They are also used for patients with elevated serum total cholesterol levels and mildly elevated serum triglyceride levels. Such drugs mainly include lovastatin (Mecor), simvastatin (Zocor), pravastatin (Pravo), fluvastatin (Lescol), atorvastatin (Lipitor) and cerivastatin (Basting). Long-term use may cause abdominal distension, diarrhea, constipation, headache, insomnia, rash, thrombotic thrombocytopenic purpura (diffuse ecchymoses on the face, chest, and extremities, accompanied by decreased platelet counts). In addition, there are also depression, paresthesia, which often occurs on the face, scalp, tongue and limbs, manifested as numbness, burning sensation, skin allergies or pain. It can also cause peeling and elevated serum transaminases. The most serious adverse reaction is rhabdomyolysis, which manifests as muscle weakness, myalgia, anuria, and elevated serum creatine kinase levels, with an incidence of about 1‰. If the drug is not discovered and discontinued in time, it will cause severe myopathy and even renal failure.

[0004] Therefore, there is an urgent need to develop a drug for treating dyslipidemia that can be taken for a long time and has few side effects.

[0005] Angiopoietin-like protein 3 (ANGPTL3, NM_014495.4) is a secreted protein mainly expressed in liver cells. Studies have shown that angiopoietin-like protein 3 (ANGPTL3) is a key regulator of LDL-C, HDL-C and triglyceride metabolism, with multiple potential action nodes. Loss-of-function mutations in ANGPTL3 can lead to lower LDL-C, VLDL-C, HDL-C and triglycerides (TG), thereby reducing the risk of cardiovascular disease based on GWAS, and there is no adverse phenotype of known genetic defects. Therefore, inhibiting the activity of ANGPTL3 can effectively prevent or treat dyslipidemia.

[0006] In the prior art, ANGPTL3 antibodies are often used to inhibit its activity.

[0007] A Chinese patent application numbered CN201280038908.0 discloses a fully humanized antibody or an antigen-binding fragment of a human antibody, which specifically binds to human angiopoietin-like protein 3 (hANGPTL3) and inhibits or interferes with at least one activity thereof. The human anti-hANGPTL3 antibody can be used to treat diseases or disorders associated with ANGPTL3, such as hyperlipidemia, hyperlipoproteinemia, and dyslipidemia, including hypertriglyceridemia, hypercholesterolemia, chylomicronemia, and the like.

[0008] The Chinese patent application number CN201780026147.X discloses a method for treating patients with familial hypercholesterolemia, including HeFH and HoFH. By administering a therapeutically effective amount of an antibody or an antigen-binding fragment thereof that specifically binds to ANGPTL3, in combination with other drugs, at least one lipid parameter of the patient is reduced. It can be used to treat hypercholesterolemia, as well as hyperlipidemia, hyperlipoproteinemia and dyslipidemia, including hypertriglyceridemia and chylomicronemia.

[0009] Compared with antibodies, siRNA drugs have the advantages of abundant candidate targets, short R&D cycle, and high clinical development success rate. Therefore, they have more advantages in the treatment of chronic diseases. It is urgent to develop siRNA drugs that can be used for dyslipidemia. Summary of the invention

[0010] The present disclosure aims to solve one of the technical problems in the related art at least to some extent. To this end, one purpose of the present disclosure is to provide an siRNA for inhibiting the expression of ANGPTL3. The inventors of the present disclosure designed a suitable specific small interfering RNA sequence and siRNA conjugate to target ANGPTL3, and degraded the transcript of the ANGPTL3 gene in cells, thereby reducing the expression of ANGPTL3 protein. Therefore, the siRNA provided by the present disclosure can be used to prevent and / or treat dyslipidemia.

[0011] To this end, the present disclosure provides an siRNA on one hand. According to an embodiment of the present disclosure, the siRNA includes a sense strand and an antisense strand, the antisense strand includes a complementary region that is complementary to the sense strand, wherein the sense strand is selected from a nucleotide sequence that differs from the nucleotide sequence of each strand in SEQ ID NO:1-SEQ ID NO:154 by no more than 5 nucleotides, and the antisense strand is selected from a nucleotide sequence that differs from the nucleotide sequence of each strand in SEQ ID NO:155-SEQ ID NO:308 by no more than 5 nucleotides.

[0012] The inventors of the present disclosure designed a suitable small interfering RNA (siRNA) sequence to specifically reduce the synthesis of ANGPTL3 in hepatocytes while avoiding off-target effects. siRNA forms a silencing complex (RNA-induced silencing complex, RISC), and complements the sequence of the mRNA of the target gene (ANGPTL3 gene), thereby degrading the mRNA of the target gene and inhibiting the expression of the target gene, thereby reducing the levels of LDL-C, VLDL-C, HDL-C and triglycerides (TG).

[0013] According to the siRNA of the present disclosure, the siRNA may also have at least one of the following additional technical features:

[0014] The present disclosure also provides an siRNA, wherein the siRNA is selected from any pair of siRNAs in any of the following groups:

[0015] (1) It can specifically target nucleotides 60-80 of the angiopoietin-like protein 3 gene sequence; preferably, the sense strand of the siRNA is selected from SEQ ID NO: 10, and the antisense strand is selected from SEQ ID NO: 165;

[0016] (2) being able to specifically target nucleotides 107-133 of the angiopoietin-like protein 3 gene sequence; preferably, the sense strand of the siRNA is selected from SEQ ID NO: 17, and the antisense strand is selected from SEQ ID NO: 171, or the sense strand of the siRNA is selected from SEQ ID NO: 18, and the antisense strand is selected from SEQ ID NO: 172;

[0017] (3) being able to specifically target nucleotides 163-187 of the angiopoietin-like protein 3 gene sequence; preferably, the sense strand of the siRNA is selected from SEQ ID NO: 19, and the antisense strand is selected from SEQ ID NO: 173;

[0018] (4) can specifically target nucleotides 304-388 of the angiopoietin-like protein 3 gene sequence, preferably, can specifically target nucleotides 304-359 of the angiopoietin-like protein 3 gene sequence; more preferably, the sense strand of the siRNA is selected from SEQ ID NO: 27, and the antisense strand is selected from SEQ ID NO: 181,

[0019] Alternatively, the sense strand of the siRNA is selected from SEQ ID NO: 29, and the antisense strand is selected from SEQ ID NO: 183,

[0020] Alternatively, the sense strand of the siRNA is selected from SEQ ID NO:31, and the antisense strand is selected from SEQ ID NO:185,

[0021] Alternatively, the sense strand of the siRNA is selected from SEQ ID NO: 32, and the antisense strand is selected from SEQ ID NO: 186,

[0022] Alternatively, the sense strand of the siRNA is selected from SEQ ID NO: 35, and the antisense strand is selected from SEQ ID NO: 189,

[0023] Alternatively, the sense strand of the siRNA is selected from SEQ ID NO:36, and the antisense strand is selected from SEQ ID NO:190;

[0024] (5) It can specifically target nucleotides 430-459 of the angiopoietin-like protein 3 gene sequence; preferably, the sense strand of the siRNA is selected from SEQ ID NO: 43, and the antisense strand is selected from SEQ ID NO: 197,

[0025] Alternatively, the sense strand of the siRNA is selected from SEQ ID NO: 44, and the antisense strand is selected from SEQ ID NO: 198;

[0026] (6) capable of specifically targeting nucleotides 1360-1430 of the angiopoietin-like protein 3 gene sequence, preferably, capable of specifically targeting nucleotides 1397-1430 of the angiopoietin-like protein 3 gene sequence; more preferably, the sense strand of the siRNA is selected from SEQ ID NO: 145, and the antisense strand is selected from SEQ ID NO: 299,

[0027] Alternatively, the sense strand of the siRNA is selected from SEQ ID NO: 150, and the antisense strand is selected from SEQ ID NO: 304,

[0028] Alternatively, the sense strand of the siRNA is selected from SEQ ID NO: 151, and the antisense strand is selected from SEQ ID NO: 305,

[0029] Alternatively, the sense strand of the siRNA is selected from SEQ ID NO: 152, and the antisense strand is selected from SEQ ID NO: 306,

[0030] Alternatively, the sense strand of the siRNA is selected from SEQ ID NO: 154, and the antisense strand is selected from SEQ ID NO: 308.

[0031] According to an embodiment of the present disclosure, the siRNA includes at least one modified nucleotide;

[0032] Optionally, the modified nucleotide is selected from at least one of the following:

[0033] 5'-phosphorothioate-based nucleotides, 5-methylated cytosine nucleotides, 2'-O-methyl modified nucleotides, 2'-O-2-methoxyethyl modified nucleotides, 2'-fluoro modified nucleotides, 3'-nitrogen substituted modified nucleotides, 2'-deoxy-2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, abasic nucleotides, 2'-amino modified nucleotides, morpholino nucleotides, polypeptide nucleotides, phosphoramidates, and nucleotides including non-natural bases.

[0034] According to an embodiment of the present disclosure, the length of the complementary region is at least 17 bp;

[0035] Optionally, the length of the complementary region is 18-21 bp;

[0036] Optionally, the length of the region of complementarity is 19 bp.

[0037] According to an embodiment of the present disclosure, the length of the sense strand and the antisense strand in the siRNA is no more than 25 bp;

[0038] Optionally, the length of the sense strand and the antisense strand in the siRNA is 18-25 bp;

[0039] Optionally, the length of the sense strand and the antisense strand in the siRNA is 21 bp.

[0040] According to the embodiments of the present disclosure, the bases in the sense strand and the antisense strand of the siRNA may be one-to-one complementary pairings, or may be misplaced by several bases, but have a complementary region of at least 17 bp.

[0041] Another aspect of the present disclosure provides a siRNA conjugate, the siRNA conjugate comprising the aforementioned siRNA and a targeting ligand, wherein the siRNA is covalently linked to the targeting ligand;

[0042] Preferably, the targeting ligand is linked to the sense strand in the siRNA;

[0043] More preferably, the targeting ligand is linked to the 5' end of the sense strand in the siRNA via a phosphorothioate bond.

[0044] According to an embodiment of the present disclosure, the targeting ligand includes at least one N-acetyl-galactosamine.

[0045] According to an embodiment of the present disclosure, the targeting ligand is a GalNAC target head compound.

[0046] According to an embodiment of the present disclosure, the GalNAC target head compound is 1043, 1046, 1048, and its structure is shown in the following formula 1-3:

[0047]

[0048]

[0049] According to an embodiment of the present disclosure, the targeting ligand is linked to the sense strand in the siRNA.

[0050] Another aspect of the present disclosure provides a pharmaceutical composition. According to an embodiment of the present disclosure, the pharmaceutical composition comprises the aforementioned siRNA and / or the aforementioned siRNA conjugate, and optionally, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

[0051] Thus, the pharmaceutical composition according to the embodiments of the present disclosure can be used to inhibit the cell synthesis of ANGPTL3, thereby reducing the levels of LDL-C, VLDL-C, HDL-C and triglycerides (TG) to treat, prevent and / or treat hyperlipidemia and hypertriglyceridemia.

[0052] In another aspect, the present disclosure provides a kit. According to an embodiment of the present disclosure, the kit comprises the siRNA and / or siRNA conjugate.

[0053] Thus, the kit according to the embodiments of the present disclosure can be used to inhibit the expression of the ANGPTL3 gene in cells, thereby reducing the levels of LDL-C, VLDL-C, HDL-C and triglycerides (TG) to treat, prevent and / or treat hyperlipidemia and hypertriglyceridemia.

[0054] In yet another aspect, the present disclosure provides a method for inhibiting the expression of an ANGPTL3 gene in a subject, the method comprising: administering the aforementioned siRNA and / or the aforementioned siRNA conjugate to the subject to inhibit the expression of the ANGPTL3 gene.

[0055] In another aspect, the present disclosure provides a method for inhibiting the expression of ANGPTL3 gene in cells. According to an embodiment of the present disclosure, the method comprises: transfecting the cells with the siRNA and / or the siRNA conjugate to inhibit the expression of ANGPTL3 gene in the cells.

[0056] According to the method for inhibiting the expression of ANGPTL3 gene in cells according to the embodiment of the present disclosure, siRNA is used to form a silencing complex, which is complementary to the sequence of the mRNA of the target gene ANGPTL3 gene, so that the mRNA of the target gene is degraded to inhibit the expression of the target gene, thereby reducing the levels of LDL-C, VLDL-C, HDL-C and triglycerides (TG).

[0057] According to an embodiment of the present disclosure, the cell is derived from a mammal;

[0058] Optionally, the cell is of human origin;

[0059] Optionally, the cell is a liver cell.

[0060] The siRNA provided by the present invention forms a silencing complex in human liver cells, which is complementary to the sequence of the mRNA of the ANGPTL3 gene, thereby degrading the mRNA of the ANGPTL3 gene and inhibiting its expression, thereby reducing the levels of LDL-C, VLDL-C, HDL-C and triglycerides (TG).

[0061] In another aspect, the present disclosure provides the use of the siRNA and / or the siRNA conjugate in preparing a drug or a kit. According to an embodiment of the present disclosure, the drug or the kit is used to inhibit the expression of the ANGPTL3 gene.

[0062] The siRNA provided by the present disclosure is used to prepare a drug or a kit, wherein the drug or the kit reduces the expression level of the ANGPTL3 gene in cells through the siRNA therein, thereby preventing and / or treating dyslipidemia.

[0063] According to an embodiment of the present disclosure, the medicine or kit is used to prevent and / or treat dyslipidemia;

[0064] Optionally, the dyslipidemia disease includes hyperlipidemia and hypertriglyceridemia;

[0065] Optionally, the medicament or kit is used to inhibit ANGPTL3 gene expression in a cell.

[0066] In another aspect, the present disclosure provides a method for preventing and / or treating dyslipidemia. According to an embodiment of the present disclosure, the method comprises: administering the siRNA and / or the siRNA conjugate to a subject.

[0067] According to an embodiment of the present disclosure, the dyslipidemia disease includes hyperlipidemia and hypertriglyceridemia.

[0068] Additional aspects and advantages of the present disclosure will be given in part in the following description and in part will be obvious from the following description or will be learned through practice of the present disclosure.

[0069] Beneficial effects of the present invention:

[0070] The siRNA conjugate provided by the present invention can reduce the expression of ANGPTL3 in both cell models and mouse models, and can reduce the expression by more than 50% compared with the control group, and can reduce the expression by up to nearly 90%, and has good clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] The above and / or additional aspects and advantages of the present disclosure will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0072] Figure 1 The results of the expression of ANGPTL3 gene (abbreviated as ANL3 in the figure) in cells detected by real-time quantitative PCR after some siRNAs in Table 2 were transfected into Hep 3B cells at a concentration of 0.1 nM;

[0073] Figure 2 The results of the expression of ANGPTL3 gene (abbreviated as ANL3 in the figure) in cells detected by real-time quantitative PCR after some siRNAs in Table 2 were transfected into Hep 3B cells at a concentration of 10 nM are shown;

[0074] Figure 3 shows the GalNAc-siRNA conjugate synthesized in Example 3;

[0075] Figure 4 The activity test results of each conjugate in Example 4 are shown (EC 50 value). DETAILED DESCRIPTION

[0076] The embodiments of the present disclosure are described in detail below. The embodiments described below are exemplary and are only used to explain the present disclosure, and should not be understood as limiting the present disclosure.

[0077] "Pharmaceutically acceptable carriers" are recognized in the art and include pharmaceutically acceptable materials, compositions or vehicles suitable for administering the compounds of the present disclosure to mammals. The carriers include liquid or solid fillers, diluents, excipients, solvents or encapsulating materials that participate in carrying the subject matter or transferring it from one organ or part of the body to another organ or part of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the patient. Some examples of materials that can be used as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose, and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate, powdered tragacanth, malt, gelatin, talc, excipients such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols, such as propylene glycol; polyols, such as glycerol, sorbitol, mannitol, and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffers, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; Ringer's solution; ethanol; phosphate buffered saline; and other nontoxic, compatible substances used in pharmaceutical formulations.

[0078] Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.

[0079] Pharmaceutical compositions of the present disclosure include those suitable for oral, nasal, topical, buccal, sublingual, rectal and / or parenteral administration. The preparation can be conveniently present in unit dosage form and can be prepared by any method known in the pharmaceutical field. The amount of active ingredient that can be combined with a carrier material to prepare a single dose form is generally the amount of the compound that produces the therapeutic effect. Generally speaking, in units of one percent, the amount is about 1% to about 99% active ingredient, preferably about 5% to about 70%, most preferably about 10 to about 30%.

[0080] The term "treatment" is used to refer to obtaining a desired pharmacological and / or physiological effect. The effect may be preventive in terms of completely or partially preventing a disease or its symptoms, and / or may be therapeutic in terms of partially or completely curing a disease and / or adverse effects caused by the disease. "Treatment" as used herein covers diseases in mammals, particularly humans, and includes: (a) preventing the occurrence of a disease or condition in an individual who is susceptible to the disease but has not yet been diagnosed with the disease; (b) inhibiting the disease, such as arresting the progression of the disease; or (c) alleviating the disease, such as alleviating symptoms associated with the disease. "Treatment" as used herein covers any medication that administers a drug or compound to an individual to treat, cure, alleviate, improve, mitigate or inhibit an individual's disease, including but not limited to administering a drug containing a compound described herein to an individual in need.

[0081] The present disclosure provides an siRNA for inhibiting ANGPTL3 expression. According to an embodiment of the present disclosure, the siRNA includes a sense strand and an antisense strand, the antisense strand includes a complementary region that is complementary to the sense strand, wherein the sense strand is selected from a nucleotide sequence that differs from the nucleotide sequence of each strand in SEQ ID NO: 1 to SEQ ID NO: 154 by no more than 5 nucleotides, and the antisense strand is selected from a nucleotide sequence that differs from the nucleotide sequence of each strand in SEQ ID NO: 155 to SEQ ID NO: 308 by no more than 5 nucleotides.

[0082] According to an embodiment of the present disclosure, the sense strand includes, in addition to SEQ ID NO: 1-SEQ ID NO: 154 shown in Table 2, a continuous nucleotide sequence that differs from the sense strand shown in Table 2 by 1, 2, 3, 4, or 5 nucleotides.

[0083] According to an embodiment of the present disclosure, the antisense strand includes, in addition to SEQ ID NO: 155-SEQ ID NO: 308 shown in Table 2, a continuous nucleotide sequence that differs from the antisense strand shown in Table 2 by 1, 2, 3, 4, or 5 nucleotides.

[0084] According to an embodiment of the present disclosure, the siRNA includes at least one modified nucleotide;

[0085] The modified nucleotide is selected from at least one of the following:

[0086] 5'-phosphorothioate-based nucleotides, 5-methylated cytosine nucleotides, 2'-O-methyl modified nucleotides, 2'-O-2-methoxyethyl modified nucleotides, 2'-fluoro modified nucleotides, 3'-nitrogen substituted modified nucleotides, 2'-deoxy-2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, abasic nucleotides, 2'-amino modified nucleotides, morpholino nucleotides, polypeptide nucleotides, phosphoramidates, and nucleotides including non-natural bases.

[0087] According to an embodiment of the present disclosure, the length of the complementary region is 18-21 bp, for example, 19 bp.

[0088] According to an embodiment of the present disclosure, the length of the sense strand and the antisense strand in the siRNA is 18-25 bp, for example, 21 bp.

[0089] According to a specific embodiment of the present disclosure, the length of the sense strand and the antisense strand in the siRNA is 21 bp, and the bases in the sense strand and the antisense strand are complementary one to one, or the sense strand and the antisense strand in the siRNA have 19 consecutive complementary bases, that is, the length of the complementary region is 19 bp.

[0090] According to an embodiment of the present disclosure, liver cells are transfected with the siRNA to inhibit the expression of the ANGPTL3 gene in the cells.

[0091] Targeting the angiopoietin-like 3 (ANGPTL3) gene target, the inventors of the present disclosure designed a suitable small interfering nucleic acid (siRNA) sequence, synthesized siRNA, and introduced siRNA into cells using a transfection reagent to form a silencing complex (RNA-induce siliencing complex, RISC), which specifically recognizes and targets the mRNA sequence of the target gene and cuts the mRNA between positions 10-11 from the 5' end, thereby leading to post-transcriptional gene silencing and regulating the expression of angiopoietin-like 3 secretory protein.

[0092] According to an embodiment of the present disclosure, the siRNA is linked to the targeting ligand via a covalent bond.

[0093] According to an embodiment of the present disclosure, the targeting ligand includes at least one N-acetyl-galactosamine.

[0094] According to an embodiment of the present disclosure, the targeting ligand is linked to the sense strand in the siRNA.

[0095] The embodiments of the present disclosure are described in detail below. The embodiments described below are exemplary and are only used to explain the present disclosure, and should not be construed as limiting the present disclosure. If no specific techniques or conditions are specified in the embodiments, the techniques or conditions described in the literature in this area or the product instructions are used. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be obtained commercially.

[0096] Part of the synthetic route of this embodiment can refer to CN202110397429.9 and CN202110008013.3; the embodiments of this application incorporate the above two patent applications in the form of source citations.

[0097] Example 1 In vitro cell model (Hep 3B cells) testing the activity of small interfering nucleic acids (siRNA)

[0098] 1) Preparation of suspension transfection reagent: siRNA stock solution concentration is 50μM, dilute with DEPC water to get 10μM siRNA system, dilute with 50μL Opti-MEM to get 0.2μM siRNA system, pipette 3-5 times to mix (final concentration 10nM). 50μL Opti-MEM dilutes 0.5μL 0.2μM siRNA to get 0.002μM siRNA system, pipette 3-5 times to mix (final concentration 0.1nM); 50μL Opti-MEM dilutes 2μL RNAiMAX, pipette 3-5 times to mix. Mix the transfection reagent and small interfering nucleic acid diluent separately, pipette 3-5 times to mix, and let stand at room temperature for 10 minutes.

[0099] 2) Treat cells: Observe the confluence of Hep 3B cells under the microscope>70%, plate the cells, and plate 2x10 5 The cells / well were plated in a 12-well plate, 900 μL of DMEM medium containing 10% FBS was added to each well, the transfection complex was added to the 12-well plate, and the plate was cultured in a 37°C, 5% CO2 incubator.

[0100] 3) After 24 hours, the total RNA of the cells was extracted, and the expression of the ANGPTL3 mRNA sequence in the cells was detected by quantitative real-time PCR. The PCR primers used to amplify the internal reference genes PPIB and ANGPTL3 are shown in Table 1:

[0101] Table 1: PCR primer sequences used to amplify the internal reference genes PPIB and ANGPTL3

[0102]

[0103] 4) The inhibition rate of siRNA on ANGPTL3 expression level was calculated according to the following equation: inhibition rate = [1-(expression level of ANGPTL3 mRNA in the experimental group / expression level of PPIB mRNA in the experimental group) / (expression level of ANGPTL3 mRNA in the negative control group / expression level of PPIB mRNA in the negative control group)] × 100%. Among them, each experimental group is cells treated with siRNA respectively; the negative control group (denoted as Blank) is cells not treated with any siRNA.

[0104] The above method was used to obtain the inhibition rate results of ANGPTL3 gene (NM_014495.4) expression after 154 pairs of siRNAs in Table 2 were transfected into Hep 3B cells at concentrations of 0.1 nM and 10 nM, respectively.

[0105] Table 2: 154 pairs of siRNA sequences targeting ANGPTL3

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114] Attached Figure 1 and 2 The results of the expression of ANGPTL3 gene in Hep3B cells detected by real-time quantitative PCR after some siRNAs in Table 2 were transfected into Hep3B cells at a concentration of 0.1 nM or 10 nM are shown respectively. It shows that the siRNA shown in the figure can significantly reduce the expression of ANGPTL3 gene no matter it is transfected into Hep 3B cells at a concentration of 0.1 nM or 10 nM.

[0115] Example 2 Synthesis of GalNAc-linked target head

[0116] 1. Synthesis of GalNAc Target Head 1043

[0117] According to the following method, TO-23 and a diastereomer of TP-23 (precursor of 1043 target head linked to siRNA) were synthesized.

[0118] 1. Synthesis of intermediate GN-17-01

[0119]

[0120] (1) Under N2 atmosphere, GC-1 (12 g, 25.89 mmol) was dissolved in DCM (200 mL), cooled to 0-5°C in an ice-water bath, HBTU (11.78 g, 31 mmol) and DIEA (10 g, 77.67 mmol) were added, and stirred for 10 min;

[0121] (2) N-tert-butyloxycarbonyl-1,4-butanediamine (4.87 g, 25.89 mmol) was then added, the temperature was raised to 25° C. and stirred for 16 hours. TLC showed that the starting material had basically disappeared;

[0122] (3) Add saturated ammonium chloride solution (100 mL) to quench, separate the layers, and extract with DCM (100 mL × 2);

[0123] (4) The organic phases were combined and washed with saturated brine (100 mL), dried over anhydrous Na2SO4, filtered and concentrated. Purification by column chromatography (DCM / MeOH=20 / 1) gave white solid compound GN-17-01 (15 g, yield 91%).

[0124] 2. Synthesis of intermediate GN-17

[0125]

[0126] (1) GN-17-01 (15 g, 23.67 mmol) was dissolved in DCM (150 mL), TFA (50 mL) was added, and the mixture was stirred at 25 °C for 1 hour. TLC showed that the starting material was almost gone, and the mixture was concentrated;

[0127] (2) Excess TFA was removed by azeotropic distillation with acetonitrile (100 mL × 3) to obtain a foamy solid GN-17 (TFA salt, 12.6 g).

[0128] 3. Synthesis of intermediate TO-23-01

[0129]

[0130] (1) Under N2 atmosphere, NC-4 (2.6 g, 4.7 mmol) was dissolved in DCM (200 mL), cooled to 0-5°C in an ice-water bath, and HATU (5.6 g, 14.83 mmol) and DIEA (4.85 g, 37.6 mmol) were added and stirred for 20 min;

[0131] (2) GN-17 (8.45 g, 15.5 mmol) was then added, and the temperature was raised to 25°C and stirred for 4 hours. TLC detection showed that the starting material had almost disappeared;

[0132] (3) Add saturated ammonium chloride solution (50 mL) to quench, separate the layers, and extract with DCM (100 mL × 2);

[0133] (4) The organic phases were combined and washed with saturated brine (100 mL), and dried over anhydrous Na2SO4;

[0134] (5) Filtration and concentration gave a crude product, which was purified by column chromatography (DCM / MeOH=10 / 1) to give a white solid TO-23-01 (6.3 g, yield 63.1%).

[0135] 4. Synthesis of compound TO-23

[0136]

[0137] (1) 10% Pd / C (600 mg) and Pd(OH)2 / C (600 mg) were added to a MeOH (100 mL) solution of TO-23-01 (6.3 g, 3.0 mmol), and H2 was replaced three times. The reaction was stirred at 25°C for 3 hours. TLC (DCM / MeOH=8 / 1) detected that the raw material had basically disappeared;

[0138] (2) Filtration and concentration gave a crude product, which was purified by column chromatography (DCM / MeOH / TEA=10 / 1 / 0.1) to give a white solid TO-23 (4.5 g, yield 75%).

[0139] 1 H NMR (400MHz, DMSO-d6) δ7.88-7.81(m,9H),7.14(s,1H),5.21(d,J=3.4Hz,3H),4.95(dd,J=1 1.2,3.4Hz,3H),4.53(d,J=8.5Hz,3H),4.07-3.97(m,9H),3.88(dt,J=11.0,9.0Hz,3H),3.77 -3.71(m,3H),3.63-3.50(m,24H),3.49-3.41(m,8H),3.38-3.35(m,2H),3.08-2.98(m,12H), 2.35–2.25(m,14H),2.10(s,9H),2.00(s,9H),1.89(s,9H),1.78(s,9H),1.40-1.33(s,12H).

[0140] MS (ESI): m / z [1 / 2M+H] + Theoretical value is 1000.5, measured value is 1000.3.

[0141] 5. Synthesis of compound TP-23 (precursor of siRNA linked to 1043 target head)

[0142]

[0143] (1) Under N2 atmosphere, TO-23 (2.3 g, 1.15 mmol) was dissolved in dry DCM (40 mL), DIEA (0.86 mL, 5.2 mmol) was added, and a solution of 2-cyanoethyl-N,N-diisopropylchlorophosphoramidite (0.46 mL, 2.1 mmol) in dry DCM (2 mL) was slowly added dropwise using a syringe. The mixture was reacted at 25°C for 1 hour. According to TLC detection, the starting material was almost gone;

[0144] (2) Add saturated NaHCO3 (20 mL) to quench, separate the liquids, wash the organic phase with saturated NaHCO3 (20 mL) solution, saturated brine (20 mL), dry over anhydrous MgSO4, filter and concentrate to obtain a crude product. Purify by column chromatography (silica gel column pre-alkalinized with 1.5% TEA / DCM, DCM / MeOH / TEA=15 / 1 / 0.1) to obtain a white solid TP-23 (1.8 g, yield 71.1%).

[0145] 1 H NMR (400MHz, DMSO-d6) δ7.91-7.79(m,9H),7.15(s,1H),5.21(d,J=3.4Hz,3H),4.95(dd,J=11.2 ,3.4Hz,3H),4.53(d,J=8.5Hz,3H),4.06-3.97(m,9H),3.88(dt,J=11.1,8.9Hz,3H),3.78-3.66( m,6H),3.63-3.41(m,36H),3.07-2.98(m,12H),2.76(t,J=5.9Hz,2H),2.35-2.24(m,14H),2.10( s,9H),2.00(s,9H),1.89(s,9H),1.78(s,9H),1.40-1.33(m,12H),1.13(dd,J=6.7,4.1Hz,12H);

[0146] 31 P NMR (162MHz, DMSO-d6) δ147.81;

[0147] MS (ESI): m / z [1 / 2M + Na] + Theoretical value is 1122.5, measured value is 1122.4.

[0148] 2. Synthesis of GalNAc Target Head 1046

[0149] According to the following method, TO25 and a diastereomer of TP-25 (precursor of 1046 target head linked to siRNA) were synthesized.

[0150] 1. Synthesis of intermediate NC-6-01

[0151]

[0152] (1) Under N2 atmosphere, dry THF (300 mL) was added to a 1000 mL three-necked flask, and the temperature was cooled to 0-5°C in an ice bath with stirring. 60% NaH (14 g, 354.8 mmol) was added in batches, and then a THF solution (200 mL) of 2-chloroethoxyethanol (40 g, 322.5 mmol) was slowly added dropwise. The temperature was kept for reaction for 30 minutes, and then benzyl bromide (60.3 g, 354.8 mmol) was added dropwise to the reaction flask. The temperature was raised to 25°C and stirred for 16 hours. The raw material was basically consumed as monitored by TLC.

[0153] (2) Slowly drop saturated ammonium chloride solution (150 mL) to quench, separate the liquids, extract the aqueous phase with EtOAc (100 mL × 2), combine the organic phases and wash with saturated brine (300 mL), dry over anhydrous Na2SO4, filter and concentrate to obtain a crude product. The crude product was purified by silica gel column chromatography (petroleum ether / EtOAc = 5 / 1) to obtain a light yellow oily compound NC-6-01 (53 g, yield 78%).

[0154] MS (ESI): m / z [M+H] + Theoretical value 215.1, measured value 215.1.

[0155] 2. Synthesis of intermediate NC-6-02

[0156]

[0157] (1) Ethylenediamine (196 g, 3.26 mol) was placed in a 2000 mL three-necked flask, and acetonitrile (1000 mL), potassium carbonate (90 g, 0.65 mol) and sodium iodide (60.6 g, 0.33 mol) were added and stirred. Then, a solution of NC-6-01 (70 g, 0.33 mol) in acetonitrile (100 mL) was slowly added dropwise to the reaction flask, and the temperature was raised to 60° C. and stirred for 16 hours. TLC detection showed that the raw materials were basically consumed.

[0158] (2) Stop the reaction, concentrate, add purified water (300 mL), adjust the pH to 4-5 with concentrated hydrochloric acid, extract three times with EtOAc (200 mL×3), add solid sodium hydroxide to the aqueous phase to adjust the pH to 13-14, extract three times with DCM (200 mL×3), combine the organic phases, wash with saturated brine (300 mL), dry with anhydrous Na2SO4, filter and concentrate to obtain a light yellow oil NC-6-02 (69.5 g, 87%).

[0159] MS (ESI): m / z [M+H] + Theoretical value is 239.2, measured value is 239.1.

[0160] 3. Synthesis of intermediate NC-6-03

[0161]

[0162] (1) NC-6-02 (69.5 g, 0.29 mol) and tert-butyl bromoacetate (187 g, 0.96 mol) were added to tetrahydrofuran (700 mL) and purified water (350 mL), stirred, cooled to below 5°C in an ice-water bath, and potassium carbonate (322 g, 2.34 mol) was added. The mixture was stirred at 25°C for 14 hours, and the conversion of the raw material was complete after TLC detection.

[0163] (2) Purified water (300 mL) was added to the reaction solution, and the mixture was allowed to stand for stratification. The organic phase was separated and the aqueous phase was extracted twice with EtOAc (200 mL × 2). The organic phases were combined, washed with saturated brine (500 mL), dried over anhydrous Na2SO4, filtered and concentrated to obtain a light yellow oily substance NC-6-03 (201 g).

[0164] MS (ESI): m / z [M+H] + Theoretical value is 581.4, measured value is 581.3.

[0165] 4. Synthesis of intermediate NC-6

[0166]

[0167] (1) NC-6-03 (23 g, 39.6 mmol) was dissolved in 1,4-dioxane (200 mL), concentrated hydrochloric acid (40 mL) was added, and the temperature was raised to 60° C. for reaction for 2 hours. TLC detection showed that the raw material was basically consumed.

[0168] (2) Concentrate, add 1,4-dioxane (200 mL) again and concentrate to obtain a white solid crude product, add the crude product into ethyl acetate (200 mL) and slurry for 2 hours, filter, collect the filter cake, and dry it in vacuum at 50°C to obtain a white solid compound NC-6 (22.6 g, 96.9%).

[0169] (3)MS (ESI): m / z [M+H] + Theoretical value 413.2, measured value 413.1.

[0170] 5. Synthesis of intermediate TO-25-01

[0171]

[0172] (1) Under N2 atmosphere, NC-6 (1.5 g, 3.6 mmol), HBTU (4.5 g, 12.0 mmol) and DIEA (4.75 g, 36 mmol) were added to DCM (50 mL) and stirred for 30 min. Subsequently, a solution of GN-17 (6.4 g, 12.0 mmol) and DIEA (4.75 g, 36 mmol) in DCM (50 mL) was added dropwise and stirred at 25 °C for 16 h. LCMS detection showed that the starting material was basically consumed.

[0173] (2) DCM (100 mL) was added to dilute, 1N hydrochloric acid solution (80 mL×2) was added to the reaction solution for washing, the organic phases were combined, washed with saturated sodium bicarbonate (100 mL), washed with saturated brine (100 mL), dried over anhydrous Na2SO4, filtered and concentrated to obtain a crude product. The crude product was purified by silica gel column chromatography (DCM / MeOH=7 / 1) to obtain a white solid compound TO-25-01 (4.3 g, yield 60%).

[0174] (3)MS (ESI): m / z [M / 2+H] + Theoretical value is 980.0, measured value is 979.9.

[0175] 6. Synthesis of intermediate TO-25

[0176]

[0177] (1) TO-25-01 (4.3 g, 2.2 mmol) was dissolved in methanol (80 mL), 10% palladium carbon (1.0 g) was added, H2 was replaced three times, and the mixture was stirred at 25°C for 2 hours. LCMS detection showed that the starting material had basically disappeared.

[0178] (2) Filter, concentrate, add DCM (20 mL) to dissolve, slowly add dropwise to MTBE (300 mL), stir to crystallize for 30 minutes, and filter to obtain a white solid compound TO-25 (3.7 g, yield 90%).

[0179] 1H NMR (400MHz, DMSO-d6) δ8.48 (d, J=5.6Hz, 1H), 8.06 (t, J=5.7Hz, 2H), 7.85 (dd, J= 11.7,6.8Hz,6H),5.21(d,J=3.3Hz,3H),4.95(dd,J=11.2,3.3Hz,3H),4.53(d,J=8 .5Hz,3H),4.08-3.83(m,14H),3.75(p,J=4.8Hz,5H),3.68-3.26(m,28H),3.21-2 .95(m,14H),2.30(q,J=7.9,6.7Hz,6H),1.94-1.78(m,,36H),1.41-1.38(m,12H);

[0180] MS (ESI): m / z [1 / 2M+H] + Theoretical value is 934.9, measured value is 934.8.

[0181] 7. Synthesis of TP-25 (1046 target head connected to siRNA precursor)

[0182]

[0183] (1) Under N2 atmosphere, TO-25 (700 mg, 0.37 mmol) was dissolved in dry DCM (10 mL), DIEA (0.31 mL, 1.9 mmol) was added, and a solution of 2-cyanoethyl-N,N-diisopropylchlorophosphoramidite (0.19 mL, 0.74 mmol) in dry DCM (1 mL) was slowly added dropwise using a syringe. The mixture was reacted at 25°C for 30 min. After TLC detection, the starting material was almost gone.

[0184] (2) Add saturated NaHCO3 (10 mL) to quench, dilute with DCM (10 mL), separate the liquids, wash the organic phase with saturated NaHCO3 (10 mL) solution, saturated brine (10 mL), dry over anhydrous NaSO4, filter and concentrate to obtain a crude product. Purify by column chromatography (silica gel column pre-alkalinized with 1.5% TEA / DCM, DCM / MeOH / TEA=15 / 1 / 0.1) to obtain a white solid TP-25 (405 mg, yield 53%).

[0185] 1H NMR(400MHz,DMSO-d6)δ8.12(t,J=6.0Hz,2H),7.98-7.75(m,7H),5.21(d,J=3.4Hz,3H ),4.96(dd,J=11.2,3.4Hz,2H),4.54(d,J=8.4Hz,2H),4.02(q,J=5.3,4.5Hz,9H),3.95 -3.83(m,3H),3.82-3.50(m,23H),3.40-3.26(m,4H),3.12-2.94(m,27H),2.76-2.59(m ,7H),2.29(t,J=6.7Hz,5H),2.11-1.78(m,38H),1.38(s,12H),1.16(d,J=7.5Hz,12H);

[0186] 31 P NMR (162MHz, DMSO-d6) δ147.97;

[0187] MS (ESI): m / z [1 / 2M + Na] + Theoretical value is 1057.0, measured value is 1057.4.

[0188] 3. Synthesis of GalNAc Target Head 1048

[0189] According to the following method, TO26 and a diastereomer of TP-26 (precursor of 1048 target head linked to siRNA) were synthesized.

[0190] 1. Synthesis of intermediate GN-18-01

[0191]

[0192] (1) Under N2 atmosphere, GC-2 (20.1 g, 39.7 mmol) was dissolved in DCM (200 mL), and CDI (7.09 g, 73.7 mmol) was added in batches. The mixture was stirred at 25°C for 3 hours. Subsequently, N-Boc-ethylenediamine (7.0 g, 43.7 mmol) and triethylamine (12.05 g, 119.1 mmol) were added to the reaction solution. The reaction was continued for 16 hours. LCMS detection showed that the starting material disappeared.

[0193] (2) Add saturated sodium bicarbonate solution (200 mL) to quench, separate the liquids, extract the aqueous phase with DCM (100 mL × 3), combine the organic phases and wash with saturated ammonium chloride solution (200 mL) and saturated sodium chloride solution (200 mL), dry over anhydrous Na2SO4, filter and concentrate to obtain a crude product. The crude product was washed with methyl tert-butyl ether (100 mL), and the oily product was concentrated to obtain a white solid compound GN-18-01 (24.43 g, yield 95.1%).

[0194] MS (ESI): m / z [M+H] + Theoretical value: 650.3, measured value: 650.5.

[0195] 2. Synthesis of intermediate GN-18

[0196]

[0197] (1) GN-18-01 (45.52 g, 70 mmol) was added to HCl / EtOAc solution (2N, 500 mL) in batches and stirred at 25°C for 2 hours. LCMS detection showed that the starting material disappeared.

[0198] (2) The solvent was poured off and the solid was concentrated to obtain a crude product. The crude product was purified by slurrying with methyl tert-butyl ether (200 mL), filtered, and the filter cake was dried under vacuum at 40° C. to obtain a white solid GN-18 (49.6 g).

[0199] MS (ESI): m / z [M+H] + Theoretical value is 550.3, measured value is 550.5.

[0200] 3. Synthesis of intermediate TO-26-01

[0201]

[0202] (1) Under N2 atmosphere, NC-6 (1.5 g, 3.6 mmol), PyBOP (6.2 g, 12.0 mmol) and DIEA (4.75 g, 36 mmol) were added to DCM (50 mL) and stirred for 30 min. Subsequently, a solution of GN-18 (6.6 g, 12.0 mmol) and DIEA (4.75 g, 36 mmol) in DCM (50 mL) was added dropwise and stirred at 25 °C for 16 h. LCMS detection showed that the starting material was basically consumed.

[0203] (2) DCM (100 mL) was added to dilute, 1N hydrochloric acid solution (80 mL×2) was added to the reaction solution for washing, the organic phases were combined, washed with saturated sodium bicarbonate (100 mL), saturated brine (100 mL), dried over anhydrous Na2SO4, filtered and concentrated to obtain a crude product. The crude product was purified by silica gel column chromatography (DCM / MeOH=7 / 1) to obtain a white solid compound TO-26-01 (4.7 g, yield 65%).

[0204] MS (ESI): m / z [M / 2+H] + Theoretical value is 1004.0, measured value is 1004.2.

[0205] 4. Synthesis of intermediate TO-26

[0206]

[0207] (1) TO-26-01 (4.0 g, 2.0 mmol) was dissolved in methanol (80 mL), 10% palladium carbon (1.0 g) was added, H2 was replaced three times, and the mixture was stirred at 25°C for 2 hours. LCMS detection showed that the starting material had basically disappeared.

[0208] (2) Filter, concentrate, add DCM (20 mL) to dissolve, slowly add dropwise to MTBE (200 mL), stir to crystallize for 30 minutes, and filter to obtain a white solid compound TO-26 (3.5 g, yield 91%).

[0209] 1 H NMR(400MHz,DMSO-d6)δ8.54(s,1H),8.14(s,2H),7.95-7.92(m,3H),7.84(d ,J=7.8Hz,3H),5.21(d,J=3.4Hz,3H),4.97(dd,J=11.2,3.4Hz,3H),4.54(d,J =8.5Hz,3H),4.13-3.66(m,21H),3.60-3.44(m,37H),3.14(d,J=13.8Hz,15H ),2.31(t,J=6.4Hz,6H),2.10(s,9H),2.00(s,9H),1.89(s,9H),1.77(s,9H).

[0210] MS (ESI): m / z [1 / 2M+H] + Theoretical value is 958.9, measured value is 959.1.

[0211] 5. Synthesis of TP-26 (1048 target head linked to siRNA precursor)

[0212]

[0213] (1) Under N2 atmosphere, TO-26 (900 mg, 0.47 mmol) was dissolved in dry DCM (12 mL), DIEA (0.39 mL, 0.44 mmol) was added, and a solution of 2-cyanoethyl-N,N-diisopropylchlorophosphoramidite (277 mg, 1.17 mmol) in dry DCM (1 mL) was slowly added dropwise using a syringe. The mixture was reacted at 25°C for 30 min. After TLC detection, the starting material was almost gone.

[0214] (2) Add saturated NaHCO3 (10 mL) to quench, dilute with DCM (10 mL), separate the liquids, wash the organic phase with saturated NaHCO3 (10 mL) solution, saturated brine (10 mL), dry over anhydrous NaSO4, filter and concentrate to obtain a crude product. Purify by column chromatography (silica gel column pre-alkalinized with 1.5% TEA / DCM, DCM / MeOH / TEA=15 / 1 / 0.1) to obtain a white solid TP-26 (600 mg, yield 60%).

[0215] 1 H NMR (400 MHz, DMSO-d6) 1 H NMR (400MHz, DMSO-d6) δ8.15 (s, 2H), 7.94-7.81 (m, 7H), 5.22 (d, J = 3.4Hz, 3H), 4.97 (dd, J = 11. 2,3.4Hz,3H),4.55(d,J=8.5Hz,3H),4.03(s,8H),3.88(dt,J=11.2,8.9Hz,3H),3.81-3.67(m, 7H),3.64-3.46(m,30H),3.11(d,J=13.1Hz,19H),2.76(t,J=5.9Hz,3H),2.65-2.54(m,7H),2. 31(t,J=6.6Hz,7H),2.11(s,9H),2.00(s,9H),1.89(s,9H),1.77(s,9H),1.13(d,J=6.8,12H).

[0216] 31 P NMR (162MHz, DMSO-d6) δ147.89;

[0217] MS (ESI): m / z 1 / 2[Mi-Pr2N] theoretical value 1007.9, found value 1008.2.

[0218] Example 3 In vitro construction of GalNAc target head coupled (modified) siRNA conjugates

[0219] The oligonucleotide sequence portions of the antisense strand and sense strand of the following RNAi agent duplexes, as well as the connection between the targeting ligand and RNA, were synthesized on a solid phase for oligonucleotide synthesis according to the phosphoramidite coupling technology reported in J. Org. Chem. 2012, 77, 4566-4577; Curr. Protoc. Nucleic Acid Chem., 81, e107. The targeting ligands 1046, 1048, and 1043 were all connected to the 5' end of the siRNA sense strand via a phosphorothioate bond.

[0220]

[0221]

[0222] GalNAc-siRNA conjugates were synthesized as Figure 3 The conjugate structure in the second column includes three parts. For example, the structure of G1043-S2A2-A265 is: the target head 1043 is connected to the 5' end of the siRNA sense strand numbered A265 through a phosphorothioate bond, and S2A2 is the modification type of the siRNA A265. The specific modification groups and modification methods are as follows:

[0223] In the nucleic acid sequence, Ao represents adenine nucleoside, Uo represents uridine nucleoside, Go represents guanine nucleoside, and Co represents cytosine nucleoside. There is no symbol between directly adjacent nucleotides, indicating that they are connected by normal phosphate bonds.

[0224] DNA: AG CT (A represents 2'-deoxyadenine, T represents 2'-deoxythymidine, G represents 2'-deoxyguanosine, and C represents 2'-deoxycytidine);

[0225] 2'-F: aF gF cF uF (aF represents 2'-fluoroadenine nucleoside, uF represents 2'-fluorouridine nucleoside, gF represents 2'-fluoroguanosine nucleoside, and cF represents 2'-fluorocytosine nucleoside);

[0226] 2'-OMe: aM gM cM uM (aM represents 2'-O-methyladenine nucleoside, uM represents 2'-O-methyluridine nucleoside, gM represents 2'-O-methylguanosine nucleoside, and cM represents 2'-O-methylcytosine nucleoside);

[0227] *: indicates connection with phosphorothioate bond;

[0228] The y and z in the sequence represent the position of the target head.

[0229] Example 4: In vitro cell model (Hep 3B cells) testing the activity of the conjugate

[0230] Human hepatoma Hep3B cells (Shanghai Cell Bank, Chinese Academy of Sciences) were cultured in DMEM (Gibco, US) supplemented with 10% fetal bovine serum (FBS) (Gibco, US) at 37°C and 5% CO2 (il60, Thermo Fisher). On the day of the transfection experiment, cells were digested with 0.25% Trysin (Gibco, US), counted and seeded in a 24-well plate at a density of 450 μL / well and 50,000 / well. Subsequently, the test samples were added by lipofectmine2000 (Thermo Fisher) transfection. Transfection was performed according to the standard procedure in the RNAiMAX reagent manual, and the final concentration of siRNA was 10nM / 1nM / 0.5nM / 0.25nM / 0.1nM / 0.05nM / 0.01nM. The transfection group used siNC as a negative control, and its sequence was:

[0231] Sense strand: 5'-UUCUCCGAACGUGUCACGUTT-3'

[0232] Antisense strand: 5'-ACGUGACACGUUCGGAGAATT-3'.

[0233] After 24 hours, the total RNA of the cells was extracted, and the expression of the ANGPTL3 mRNA sequence in the cells was detected by quantitative real-time PCR. The PCR primers used to amplify the internal reference genes PPIB and ANGPTL3 are shown in Table 1:

[0234] The activity test results of each conjugate (EC 50 Value)See Figure 4 .

[0235] EC 50 The values ​​were calculated using nonlinear regression of GraphPad Prism and represent the amount of the conjugate required to inhibit the expression of the target mRNA (ANGPTL3) by half.

[0236] The results show that the selected conjugates showed good results in reducing the relative expression level of ANGPTL3 in the in vitro activity test experiment.

[0237] Example 5: Construction and drug administration test of AAV-hANGPTL3 mouse model

[0238] Basic information of experimental animals:

[0239] The experimental animals were purchased from Jinan Pengyue Experimental Animal Breeding Co., Ltd. and were SPF grade animals. The mice were weighed and observed before administration, and animals with uniform weight and normal condition were selected for subsequent experiments.

[0240]

[0241] Feeding conditions: Non-SPF grade feeding conditions. Animals were allowed to eat and drink freely under normal feeding conditions. After the animals were purchased, the experiment began after 3-7 days of adaptive training.

[0242] Modeling and administration: Each mouse was injected with 100 μL of a 2.5*10^11 titer virus solution through the tail vein. Seven days later, the experimental animals were randomly divided into groups, and each test substance was subcutaneously administered at a dose of 5 mg / kg. 72 hours after administration, the animals were sacrificed by cervical dislocation, and liver tissue was obtained for RNA extraction and quantification.

[0243] The results for each conjugate are shown in Table 3.

[0244] Table 3. Mouse model administration test results of each conjugate

[0245]

[0246]

[0247] The results show that the selected conjugate also showed good results in reducing the relative expression level of ANGPTL3 in the in vivo activity test experiment.

[0248] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present disclosure. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0249] Although the embodiments of the present disclosure have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present disclosure. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present disclosure.

Claims

1. A siRNA, characterized in that The siRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a complementary region complementary to the sense strand, wherein the sense strand is selected from SEQ ID NO.17: AAGACAAUUCAUCAUUUGAUU, and the antisense strand is selected from SEQ ID NO.171: AAUCAAAUGAUGAAUUGUCUU.

2. The siRNA according to claim 1, characterized in that The siRNA comprises at least one modified nucleotide; The modified nucleotide is selected from at least one of the following: 5'-phosphorothioate-based nucleotides, 5-methylated cytosine nucleotides, 2'-O-methyl modified nucleotides, 2'-O-2-methoxyethyl modified nucleotides, 2'-fluoro modified nucleotides, 3'-nitrogen substituted modified nucleotides, 2'-deoxy-2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, abasic nucleotides, 2'-amino modified nucleotides, morpholino nucleotides, polypeptide nucleotides, phosphoramidates, and nucleotides including non-natural bases.

3. The siRNA according to claim 1, characterized in that The complementary region is at least 17 bp in length.

4. The siRNA according to claim 3, characterized in that The length of the complementary region is 18-21 bp.

5. The siRNA according to claim 4, characterized in that The length of the complementary region is 19 bp.

6. A siRNA conjugate, characterized in that The siRNA conjugate comprises the siRNA according to any one of claims 1 to 5 and a targeting ligand, wherein the siRNA is covalently linked to the targeting ligand.

7. The siRNA conjugate according to claim 6, characterized in that The targeting ligand is linked to the sense strand of the siRNA.

8. The siRNA conjugate according to claim 7, characterized in that The targeting ligand is linked to the 5' end of the sense strand in the siRNA via a phosphorothioate bond.

9. The siRNA conjugate according to any one of claims 6 to 8, characterized in that The targeting ligand comprises at least one N-acetyl-galactosamine.

10. The siRNA conjugate according to claim 9, characterized in that The targeting ligand is a GalNAC target head compound.

11. The siRNA conjugate according to claim 10, characterized in that The GalNAC target head compound is selected from any one of the following structures 1043, 1046 and 1048: 1043 1046 1048。 12. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the siRNA according to any one of claims 1 to 5 and / or the siRNA conjugate according to any one of claims 6 to 11, and further comprises a pharmaceutically acceptable excipient.

13. Use of the siRNA according to any one of claims 1 to 5 in the preparation of a drug for preventing and / or treating dyslipidemia, the use comprising: The siRNA of any one of claims 1-5 is administered to a subject.

14. Use of the siRNA conjugate according to any one of claims 6 to 11 in the preparation of a medicament for preventing and / or treating dyslipidemia, the use comprising: The siRNA conjugate of any one of claims 6-11 is administered to a subject.

15. Use of the pharmaceutical composition according to claim 12 in the preparation of a drug for preventing and / or treating dyslipidemia, the use comprising: Administering the pharmaceutical composition of claim 12 to a subject.

16. The use according to any one of claims 13 to 15, characterized in that: The dyslipidemia diseases include hyperlipidemia and hypertriglyceridemia.

17. Use of the siRNA according to any one of claims 1 to 5 in preparing a kit, characterized in that: The kit is used for preventing and / or treating dyslipidemia.

18. Use of the siRNA conjugate according to any one of claims 6 to 11 in preparing a kit, characterized in that: The kit is used for preventing and / or treating dyslipidemia.

19. The use according to claim 17 or 18, characterized in that: The dyslipidemia diseases include hyperlipidemia and hypertriglyceridemia.

Images