Formulations of anti-il-33 antibodies

Abstract

The present disclosure relates to compositions comprising greater than about 100 mg / ml of an anti-IL-33 antibody, a surfactant, arginine, and a buffer. Also disclosed are methods of making these compositions and methods of treating a disease in a subject.

Description

[0001] This application claims priority to Greek patent application No. 20200100239, filed on May 11, 2020. The contents of that application are incorporated herein by reference in their entirety. Technical Field

[0002] This disclosure relates to anti-IL-33 antibodies, including high-concentration aqueous formulations of 33_640087-7B and their biosimilars. Background Technology

[0003] 33_640087-7B is a human immunoglobulin (Ig) G1 monoclonal antibody (mAb) that binds to human interleukin (IL)-33, preventing IL-33 from binding to its receptor ST2 and inhibiting its conversion to disulfide-bonded (DSB) IL-33. 33_640087-7B has therapeutic potential in many diseases and is currently being developed for the treatment of moderate to severe chronic obstructive pulmonary disease (COPD), asthma, atopic dermatitis (AD), and diabetic nephropathy (DKD).

[0004] The intention is to administer 33_640087-7B via subcutaneous injection in the future. This disclosure addresses that need. Summary of the Invention

[0005] The Phase 1 clinical trial of 33_640087-7B (Study D9180C00001) has been completed. Study D9180C00001 is a first-in-class, randomized, placebo-controlled, blinded (investigator and participant blinded; sponsor not blinded) human clinical trial with 88 participants (Part I: single-dose escalation (SAD) in 56 healthy volunteers with a history of mild specific reactions; Part II: multiple-dose escalation (MAD) in 24 participants with mild chronic obstructive pulmonary disease; Part III: single-dose in 8 healthy Japanese volunteers) to evaluate the safety, tolerability, pharmacokinetics, and immunogenicity of 33_640087-7B. In Parts I and III of the study, 33_640087-7B was found to be generally safe and well-tolerated, with no safety issues following intravenous (IV) administration of up to 300 mg of 33_640087-7B. In part 2 of the study, COPD patients received three doses of 33_640087-7B subcutaneously every 14 days.

[0006] For the Phase 1 clinical trial, 33_640087-7B is supplied as a sterile white to off-white lyophilized powder vial. Each vial contains a nominal 50 mg of active 33_640087-7B intended for IV or SC administration. After reconstitution with 1.2 mL of sterile water for injection, the solution contains 50 mg / mL of 33_640087-7B in 20 mM L-histidine / L-histidine hydrochloride, 80 mM L-arginine-hydrochloride, 120 mM sucrose, and 0.02% (w / v) polysorbate 80 (pH 6.0).

[0007] In some cases, the predicted effective dose of 33_640087-7B can be as high as 300 mg (or more). Therefore, low-concentration formulations can provide a barrier for subcutaneous administration, especially for use in chronic conditions. It is unrealistic to expect patients with chronic disorders to routinely receive 6 ml or more of the drug product subcutaneously to achieve a therapeutic dose.

[0008] Therefore, it is necessary to increase the concentration of 33_640087-7B in drug formulations, especially for subcutaneous administration.

[0009] However, increasing the protein concentration in drug formulations can lead to stability issues, such as protein aggregation resulting in the formation of high molecular weight variants (HMWS). HMWS, particularly those that retain most of the antibody's natural conformation, are of particular concern in some protein formulations. Soluble high-order variants can form due to reversible self-association (RSA) induced by high protein concentrations. Aggregation can also potentially affect the subcutaneous bioavailability and pharmacokinetics of therapeutic proteins. Furthermore, the formation of soluble high-order variants at high concentrations can increase solution viscosity, making drug products difficult to deliver, especially from devices with high back pressure, such as pre-filled syringes.

[0010] This article provides an improved anti-IL-33 antibody formulation with low viscosity and reduced reversible self-association characteristics, while containing a high concentration of antibody.

[0011] In one aspect, this disclosure provides a composition comprising greater than about 100 mg / ml of an anti-IL-33 antibody, at least about 170 mM arginine, and a buffer, wherein the anti-IL-33 antibody comprises: a heavy chain variable domain comprising VHCDR1 having the sequence of SEQ ID NO: 1, VHCDR2 having the sequence of SEQ ID NO: 2, and VHCDR3 having the sequence of SEQ ID NO: 3; and a heavy chain variable domain comprising VLCDR1 having the sequence of SEQ ID NO: 5, VLCDR2 having the sequence of SEQ ID NO: 6, and VLCDR3 having the sequence of SEQ ID NO: 7. In some cases, the composition further comprises a surfactant.

[0012] In another aspect, this disclosure provides a composition comprising greater than about 100 mg / ml of an anti-IL-33 antibody, at least about 150 mM lysine, and a buffer, wherein the anti-IL-33 antibody comprises: a heavy chain variable domain comprising VHCDR1 having the sequence of SEQ ID NO: 1, VHCDR2 having the sequence of SEQ ID NO: 2, and VHCDR3 having the sequence of SEQ ID NO: 3; and a heavy chain variable domain comprising VLCDR1 having the sequence of SEQ ID NO: 5, VLCDR2 having the sequence of SEQ ID NO: 6, and VLCDR3 having the sequence of SEQ ID NO: 7. In some cases, the composition further comprises a surfactant.

[0013] In some cases, the composition is a liquid. In some cases, the composition is characterized by a reduced viscosity relative to a composition containing a lower concentration of the anti-IL-33 antibody, 20 mM histidine, 80 mM arginine, 120 mM sucrose, and 0.02% (w / v) polysorbate 80 (pH 6.0). In some cases, the composition is characterized by reduced reversible self-association of the anti-IL-33 antibody relative to a composition containing 20 mM histidine, 80 mM arginine, 120 mM sucrose, and 0.02% (w / v) polysorbate 80 (pH 6.0) and a lower concentration of the anti-IL-33 antibody.

[0014] In another aspect, this disclosure provides a composition comprising about 130 mg / ml to about 170 mg / ml 33_640087-7B, about 0.03% (w / v) ± 0.015% polysorbate 80, about 220 mM arginine, and about 16 mM to about 24 mM histidine buffer, wherein the pH is pH 5.5 ± 0.5.

[0015] In another aspect, this disclosure provides a composition comprising about 130 mg / ml to about 170 mg / ml of anti-IL-33 antibody, about 0.03% (w / v) ± 0.015% polysorbate 80, about 220 mM arginine, and about 16 mM to about 24 mM histidine buffer, wherein the pH is pH 5.5 ± 0.5.

[0016] In another aspect, this disclosure provides an article of manufacture comprising the composition disclosed herein, for example, comprising 0.5 ml to about 5 ml (e.g., 1 ml to about 3 ml) of the composition.

[0017] On the other hand, this disclosure provides a vial containing the composition disclosed herein, for example, containing about 0.5 ml to about 5 ml (e.g., 1 ml to about 3 ml) of the composition.

[0018] On the other hand, this disclosure provides a method for treating IL-33-mediated disorders in a subject, the method comprising administering to the subject a therapeutically effective amount of the composition disclosed herein.

[0019] On the other hand, this disclosure provides a method for preparing a stable liquid composition with a viscosity of less than about 10 cP and containing more than about 100 mg / mL of anti-IL-33 antibody, at least about 170 mM arginine, optionally a surfactant, and a buffer. The method includes the steps of: (i) combining a first solution containing a first concentration of antibody and a buffer with arginine to obtain a solution containing about 110 mg / mL to about 200 mg / mL of anti-IL-33 antibody, at least about 170 mM arginine, and a buffer; and optionally (ii) adding a surfactant to the solution to achieve a final concentration of about 0.03% (w / v) ± 0.015% (w / v) surfactant.

[0020] On the other hand, this disclosure provides a method for preparing a stable liquid composition with a viscosity of less than about 10 cP and containing more than about 100 mg / mL of anti-IL-33 antibody, at least about 150 mM lysine, optionally a surfactant, and a buffer. The method includes the steps of: (i) combining a first solution containing a first concentration of antibody and a buffer with arginine to obtain a solution containing about 110 mg / mL to about 200 mg / mL of anti-IL-33 antibody, at least about 150 mM lysine, and a buffer; and optionally (ii) adding a surfactant to the solution to achieve a final concentration of about 0.02% (w / v) ± 0.015% (w / v) surfactant. Attached Figure Description

[0021] Embodiments of the present invention will be illustrated with reference to the following figures, wherein:

[0022] Figure 1 The stability of the percentage distribution of soluble higher species of 33_640087-7B (the composition disclosed herein) was demonstrated when stored for a period of 6 months between 2°C and 8°C.

[0023] Figure 2 The long-term stability of 33_640087-7B in the compositions disclosed herein was demonstrated, measured as a function of insoluble aggregate formation over time (months–minutes). Aggregation levels were measured during storage in glass vials and pre-filled syringes (PFS). The compositions were stored between 2°C and 8°C.

[0024] Figure 3 The stability of 33_640087-7B in the compositions disclosed herein was demonstrated, measured as a function of insoluble aggregate formation over time (months–minutes). Aggregation levels were measured during storage in glass vials and pre-filled syringes (PFS). The compositions were stored at 25°C.

[0025] Figure 4 The stability of 33_640087-7B in the compositions disclosed herein was demonstrated, measured as a function of insoluble aggregate formation over time (months–minutes). Aggregation levels were measured during storage in glass vials and pre-filled syringes (PFS). The compositions were stored at 40°C.

[0026] Figure 5 The effects of arginine and temperature on the viscosity of the formulation were shown.

[0027] Figure 6 The effects of 33-640087_7B concentration, arginine, and temperature on the viscosity of the formulation are shown. Viscosity (Cp) was measured at each arginine concentration for each 33-640087_7B concentration at 5°C, 18°C, 25°C, and 30°C. Detailed Implementation

[0028] definition

[0029] It should be understood that the specific implementations shown and described herein are examples and are not intended to limit the scope of this application in any other way.

[0030] The published patents, patent applications, websites, company names, and scientific literature mentioned in this article are hereby incorporated in their entirety by reference, to the same extent as each one specifically and individually indicated and incorporated by reference.

[0031] As used in this specification, the singular forms “a / an” and “the” specifically also cover the plural forms of the terms they refer to, unless otherwise clearly indicated in this content.

[0032] The terms “about” or “approximately” mean an acceptable error for a particular value as determined by one of ordinary skill in the art, depending in part on how the value is measured or determined. In some embodiments, the terms “about” or “approximately” mean within 1, 2, 3, or 4 standard deviations. In some embodiments, the terms “about” or “approximately” mean within 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, or 0.05% of a given value or range. Whenever the term “about” or “approximately” precedes the first value in a series of two or more values, it should be understood that the term “about” or “approximately” applies to each value in that series.

[0033] The methods disclosed herein and their individual steps can be performed manually and / or by means of electronic devices or automation provided by electronic devices. Although the processes have been described with reference to specific cases, those skilled in the art will readily understand that other ways of performing the actions associated with these methods can be used. For example, unless otherwise stated, the order of the individual steps may be changed without departing from the scope or spirit of the methods. Furthermore, some individual steps may be combined, omitted, or further subdivided into other steps.

[0034] Unless otherwise stated, consideration of these compositions and methods includes the following embodiments, which include any combination of one or more other optional elements, features, and steps (including those shown in the figures) further described below.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. The following references provide general definitions for several terms used in this disclosure, including but not limited to: Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY (2nd edition, 1994); THE CAMBRIDGE DICTIONARY OF SCIENCE AND TECHNOLOGY (Walker, ed., 1988); THE GLOSSARY OF GENETICS, 5th edition, R. Rieger et al. (eds.), Springer Verlag (1991); and Hale and Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY (1991).

[0036] The term "antibody" or "immunoglobulin" refers to a tetrameric glycoprotein composed of two heavy chains and two light chains (each containing a variable region and a constant region). The antigen-binding portion can be produced using recombinant DNA technology or by enzymatic or chemical cleavage of the intact antibody. The term "antibody" includes monoclonal antibodies, polyclonal antibodies, chimeric antibodies, human antibodies, and humanized antibodies.

[0037] Antibody variants include antibody fragments and antibody-like proteins with canonical tetrameric antibody structural alterations. Typically, antibody variants include a V region with alterations to the constant region, or alternatively, a V region may be added to the constant region in a non-canonical manner. Examples include multispecific antibodies (e.g., bispecific antibodies with an additional V region), antibody fragments capable of binding antigens (e.g., Fab′, F′(ab)2, Fv, single-chain antibodies, biantibodies), biparatopic sites containing the aforementioned peptides, and recombinant peptides (provided they exhibit the desired biological activity).

[0038] Antibody fragments include antigen-binding portions of antibodies (i.e., "antigen-binding fragments"), particularly including Fab, Fab′, F(ab′)2, Fv, domain antibodies (dAb), complementarity-determining region (CDR) fragments, CDR-transplanted antibodies, single-chain antibodies (scFv), single-chain antibody fragments, chimeric antibodies, biantibodies, triantibodies, tetraantibodies, microantibodies, linear antibodies; chelated recombinant antibodies, tribody or bibody antibodies, intrabody antibodies, nanobody, small modular immunopharmaceutical (SMIP), antigen-binding domain immunoglobulin fusion proteins, single-domain antibodies (including camelified antibodies), antibodies containing VHH, or variants or derivatives thereof, and polypeptides containing at least a portion of an immunoglobulin sufficient to bind a specific antigen to the polypeptide (e.g., one, two, three, four, five, or six CDR sequences), provided that the antibody retains the desired biological activity.

[0039] The term "treatment" refers to the temporary or permanent, partial or complete elimination, reduction, suppression or improvement of clinical symptoms, manifestations or progression of an event, disease or condition associated with the disorder described herein. As recognized in the relevant art, a medicine used as a therapeutic agent can be considered a useful therapeutic agent if it reduces the severity of a given disease state, without the need to eliminate every manifestation of the disease. Similarly, for a feasible preventative agent to be effective, preventative administration of treatment does not need to completely and effectively prevent the occurrence of the condition. It is sufficient to simply reduce the effects of the disease (e.g., by reducing the number or severity of its symptoms, or by increasing the effectiveness of another treatment, or by producing another beneficial effect), or to reduce the likelihood of the disease occurring or worsening in the subject. One embodiment of this disclosure relates to a method for determining therapeutic efficacy, the method comprising administering a therapeutic agent to a patient in an amount and for a duration sufficient to induce sustained improvement beyond a baseline of an indicator reflecting the severity of a particular disorder.

[0040] As used herein, 'IL-33' protein refers to interleukin 33, particularly mammalian interleukin 33 protein, such as the human protein deposited under UniProt number 095760. IL-33 exists in both reduced and oxidized forms. The terms "IL-33" and "IL-33 polypeptide" are used interchangeably. In some embodiments, IL-33 is full-length. In another embodiment, IL-33 is mature truncated IL-33 (amino acids 112-270). Recent studies have shown that full-length IL-33 is active (Cayrol and Girard, Proc Natl Acad Sci USA [Proceedings of the National Academy of Sciences of the United States of America] 106(22): 9021-6 (2009); Hayakawa et al., Biochem Biophys Res Commun. [Research Letters in Biochemistry and Biophysics] 387(1): 218-22 (2009); Talabot-Ayer et al., J Biol Chem. [Journal of Biochemistry] 284(29): 19420-6 (2009)). However, N-terminated or truncated IL-33 (including but not limited to aa 72-270, 79-270, 95-270, 99-270, 107-270, 109-270, 111-270, 112-270) may have enhanced activity (Lefrancais 2012, 2014).

[0041] As used herein, 'oxidized IL-33' or 'oxIL-33' refers to the form of IL-33 that binds to RAGE and triggers RAGE-mediated signaling. Oxidized IL-33 refers to proteins that are visible as unique bands, for example, by Western blot analysis under non-reducing conditions, particularly proteins with a mass 4 Da smaller than their corresponding reduced form. Specifically, it refers to proteins that have one or two disulfide bonds between cysteine ​​residues independently selected from cysteine ​​residues 208, 227, 232, and 259. In one embodiment, oxidized IL-33 shows no binding to ST2.

[0042] As used herein, 'reduced IL-33' or 'redIL-33' refers to the form of IL-33 that binds to ST2 and triggers ST2-mediated signaling. Specifically, cysteine ​​residues 208, 227, 232, and 259 of this reduced form are not disulfide-bonded. In one embodiment, reduced IL-33 does not bind to RAGE.

[0043] As used herein, the term “IL-33-mediated disorder” refers to any disorder or condition mediated or associated with the IL-33 axis. In some cases, IL-33-mediated disorders are associated with excessive levels or activity of IL-33, where atypical symptoms may be present due to the levels or activity of IL-33 locally and / or systemically in the body. Exemplary IL-33-mediated disorders include inflammatory conditions, immune disorders, fibrotic disorders, eosinophilic disorders, infections, pain, central nervous system disorders, solid tumors, and ophthalmic disorders. IL-33-mediated disorders are described, for example, in Liew et al., Nature Reviews Immunology 10:103-110, 2010, which is incorporated herein by reference in its entirety. “IL-33-mediated disorder” may also be referred to herein as “IL-33-driven disorder”.

[0044] In some cases, IL-33-mediated inflammatory diseases can be any of the following: asthma, sepsis, septic shock, atopic dermatitis, allergic rhinitis, rheumatoid arthritis, chronic obstructive pulmonary disease (COPD), asthma-COPD overlap syndrome (ACOS), chronic bronchitis, emphysema, chronic sinusitis with or without nasal polyps, vasculitis, GvHD, uveitis, chronic idiopathic urticaria, sinusitis, or pancreatitis.

[0045] In some cases, this IL-33-mediated impairment can be diabetic nephropathy. Diabetic nephropathy, as defined herein, refers to a diagnosis of type 2 diabetes and an estimated glomerular filtration rate (eGFR) of 30 ml / min–75 ml / min. Typically, DKD is further defined as a diagnosis of the UACR ratio of albumin to creatinine from 100 mg to 3000 mg. The term “therapeuticly effective dose” refers to the amount of therapeutic agent that effectively improves or reduces the symptoms or signs of disease or impairment associated with the disease or impairment.

[0046] Compositions with low reversible self-association

[0047] 33_640087-7B has been proven safe and is generally well tolerated in humans when administered parenterally at doses up to 300 mg. Therapeutic effective doses of 33_640087-7B may be equal to or greater than 300 mg, depending on the disease and the local biology of interleukin-33.

[0048] IL-33 is believed to mediate many conditions of disease that are chronic and long-term. This means that in order for patients to effectively manage their disease symptoms, they may need to take anti-IL-33-based therapies for an extended period. Therefore, suitable therapeutic compositions containing 33_640087-7B should allow patients to undergo long-term treatment as comfortably as possible.

[0049] Therefore, high-concentration formulations suitable for parenteral administration (e.g., subcutaneous or intravenous) are needed. However, formulations with high protein concentrations can be challenging from a developability perspective. For example, 33_640087-7B has been shown to reversibly self-associate at moderately high concentrations (e.g., approximately 50 mg / ml). Reversible self-association (RSA) is an important developability parameter for high-concentration formulations. RSA typically manifests as soluble, reversible higher-order derivatives (e.g., non-covalent dimers) and can present challenges in manufacturing and drug administration. For example, the presence of RSA leads to increased viscosity. High viscosity presents significant manufacturing challenges, such as filter clogging during filtration. If a significant amount of drug substance is lost during purification of higher-order derivatives from the monomer, this, in turn, can lead to reduced yield. Increased viscosity can also negatively impact drug administration by reducing the functionality of the device used to administer the antibody, particularly when the drug is administered parenterally (e.g., subcutaneously). In such cases, the ability of the end user (e.g., a patient or healthcare provider) to manually inject the product may be affected by the high viscosity.

[0050] This document provides stable liquid compositions (i.e., “liquid formulations”) suitable for long-term or short-term storage and suitable for parenteral administration, comprising a high concentration of anti-IL-33 antibody (meaning greater than 100 mg / ml), optionally a surfactant, a high concentration of arginine or lysine, and a buffer. As used herein, “high concentration of arginine” means an arginine concentration greater than about 170 mM (e.g., greater than about 190 mM). “High concentration of lysine” means a lysine concentration greater than about 150 mM. The compositions disclosed herein have been shown to surprisingly reduce the reversible self-association (RSA) of 33_640087-7B at high concentrations compared to the lower RSA observed in previously observed Phase I formulations (see Example 1).

[0051] In some cases, the anti-IL-33 antibody is present in the composition at a concentration greater than about 100 mg / ml and optionally less than about 200 mg / ml. In some cases, the anti-IL-33 antibody is present in the composition at concentrations of about 105 mg / ml, about 110 mg / ml, about 115 mg / ml, about 120 mg / ml, about 125 mg / ml, about 130 mg / ml, about 135 mg / ml, about 140 mg / ml, about 145 mg / ml, about 150 mg / ml, about 155 mg / ml, about 160 mg / ml, about 165 mg / ml, about 170 mg / ml, about 175 mg / ml, about 180 mg / ml, about 190 mg / ml, or about 195 mg / ml. In some cases, the anti-IL-33 antibody is present in the composition at concentrations of about 105 mg / ml to about 190 mg / ml, about 110 mg / ml to about 180 mg / ml, about 110 mg / ml to about 170 mg / ml, about 110 mg / ml to about 165 mg / ml, about 110 mg / ml to about 160 mg / ml, about 120 mg / ml to about 160 mg / ml, about 130 mg / ml to about 160 mg / ml, or about 140 mg / ml to about 160 mg / ml. In some cases, the anti-IL-33 antibody is present in the composition at concentrations of approximately 110 mg / ml ± 10%, approximately 115 mg / ml ± 10%, approximately 120 mg / ml ± 10%, approximately 125 mg / ml ± 10%, approximately 130 mg / ml ± 10%, approximately 135 mg / ml ± 10%, approximately 140 mg / ml ± 10%, approximately 145 mg / ml ± 10%, approximately 150 mg / ml ± 10%, approximately 155 mg / ml ± 10%, approximately 160 mg / ml ± 10%, approximately 165 mg / ml ± 10%, approximately 170 mg / ml ± 10%, approximately 175 mg / ml ± 10%, approximately 180 mg / ml ± 10%, approximately 185 mg / ml ± 10%, approximately 190 mg / ml ± 10%, or approximately 195 mg / ml ± 10%. In some cases, the anti-IL-33 antibody is present in the composition at a concentration of approximately 150 mg / ml.

[0052] In some cases, the compositions disclosed herein contain surfactants. The surfactants are amphiphilic (having a polar head and a hydrophobic tail). Surfactants preferentially accumulate at the interface, resulting in reduced interfacial tension. The use of surfactants also helps to mitigate the formation of large protein particles. In some cases, the surfactants present in the compositions disclosed herein are amphiphilic and / or nonionic surfactants. Exemplary surfactants include polyoxyethylene sorbitan fatty acid esters (e.g., polysorbate 20, polysorbate 80), alkyl aryl polyethers, such as oxyethylated alkylphenols (e.g., Triton).TM X-100) and Polosham (e.g.) For example F68), and combinations thereof (within a class of surfactants or in various classes of surfactants). Polysorbate 20 and polysorbate 80 (and optionally mixtures thereof) are particularly considered. In an exemplary embodiment, the surfactant is present in the composition at a concentration of less than or about 0.050% (w / v) ± 0.015% (w / v). For example, the composition may contain about 0.005% (w / v) to about 0.05% (w / v) of surfactant, such as about 0.005% (w / v), about 0.015% (w / v), about 0.02% (w / v), about 0.025% (w / v), about 0.03% (w / v), about 0.035% (w / v), about 0.04% (w / v), about 0.045% (w / v), or about 0.05% (w / v). In some cases, the concentration of the surfactant in the composition is 0.03% (w / v) ± 0.015% (w / v). In some cases, the concentration of the surfactant in the composition is 0.03% (w / v) ± 0.01% (w / v). In some cases, the concentration of the surfactant in the composition is from about 0.02% (w / v) to about 0.04% (w / v). In some cases, the surfactant comprises polysorbate 80.

[0053] The disclosed composition further comprises at least about 170 mM arginine. In some cases, the composition comprises at least about 190 mM arginine. In some cases, the disclosed composition comprises L-arginine. In some cases, the disclosed composition comprises L-arginine hydrochloride. In some cases, the composition comprises more than 190 mM arginine. In some cases, the composition comprises less than about 500 mM arginine. For example, the composition comprises about 200 mM, about 210 mM, about 220 mM, about 240 mM, about 260 mM, about 280 mM, about 300 mM, about 350 mM, about 400 mM, or about 450 mM arginine. In some cases, the composition comprises about 220 mM arginine. Compared to the reversible self-association observed in compositions containing 20 mM histidine, 80 mM arginine, 120 mM sucrose, 0.02% (w / v) polysorbate 80 (pH 6.0), and a lower concentration of 33_640087-7B (about 50 mg / ml), high concentrations of arginine (i.e., concentrations greater than about 190 mM) have been found to promote a surprising reduction in the reversible self-association of 33_640087-7B in stable liquid compositions. In some cases, when the compositions disclosed herein contain about 150 mg / ml of anti-IL-33 antibody, the compositions contain about 220 mM arginine.

[0054] In another aspect, the compositions disclosed herein may alternatively comprise at least about 150 mM lysine. In some cases, the compositions disclosed herein comprise L-lysine. In some cases, the compositions disclosed herein comprise L-lysine hydrochloride. In some cases, the composition comprises more than 150 mM lysine. In some cases, the composition comprises less than about 500 mM lysine. For example, the composition comprises about 160 mM, about 170 mM, about 180 mM, about 200 mM, about 220 mM, about 240 mM, about 260 mM, about 280 mM, about 300 mM, about 350 mM, about 400 mM, or about 450 mM lysine. In some cases, the composition comprises about 170 mM lysine. Compared to the viscosity observed in compositions containing 20 mM histidine, 80 mM arginine, 120 mM sucrose, 0.02% (w / v) polysorbate 80 (pH 6.0), and a lower concentration of 33_640087-7B (about 50 mg / ml), high concentrations of lysine (i.e., concentrations greater than about 150 mM) have been found to promote a surprising reduction in the viscosity of 33_640087-7B in stable liquid compositions. In some cases, when the compositions disclosed herein contain about 150 mg / ml of anti-IL-33 antibody, the compositions contain about 170 mM of lysine.

[0055] In some cases, the compositions disclosed herein are characterized by reduced reversible self-association of the anti-IL-33 antibody compared to compositions comprising 20 mM histidine, 80 mM arginine, 120 mM sucrose, 0.02% (w / v) polysorbate 80 (pH 6.0), and a lower concentration thereof. In some cases, the RSA is reduced by a factor of 2 compared to the RSA of the anti-IL-33 antibody in a liquid composition comprising a lower concentration of the anti-IL-33 antibody in 20 mM histidine, 80 mM arginine, 120 mM sucrose, and 0.02% (w / v) polysorbate 80 (pH 6.0). In some cases, the lower concentration of the anti-IL-33 antibody is 50 mg / ml. RSA is positively correlated with protein concentration. Therefore, increasing the concentration of the therapeutic protein is expected to lead to an increase in the RSA of the therapeutic protein. RSA can be expressed as a function of the percentage of soluble monomers in the liquid composition. Examples unexpectedly show that, relative to the % by weight monomers observed in compositions containing 20 mM histidine, 80 mM arginine, 120 mM sucrose, and 0.02% (w / v) polysorbate 80 (pH 6.0), the novel formulation can increase the % by weight monomers by 2-fold when the concentration of the therapeutic protein is increased by 3-fold. In some cases, the compositions disclosed herein contain at least about 30%, for example, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, or about 50% by weight monomers. In some cases, the compositions disclosed herein contain about 35% to about 50% by weight monomers. In some cases, the compositions disclosed herein contain about 40% to about 45% by weight of monomer. In some cases, after storage at a temperature of about 2°C to about 8°C for about 3 months, the compositions disclosed herein contain about 35% to about 50% by weight of monomer. In some cases, after storage at a temperature of about 2°C to about 8°C for about 3 months, the compositions disclosed herein contain about 40% by weight of monomer. In some cases, after storage at a temperature of about 2°C to about 8°C for about 6 months, the compositions disclosed herein contain about 35% to about 50% by weight of monomer. In some cases, after storage at a temperature of about 2°C to about 8°C for about 6 months, the compositions disclosed herein contain about 40% by weight of monomer. The RSA and % monomer can be calculated using static light scattering intensity in volts as a function of concentration (mg / mL). This can then be converted to apparent molecular weight (kDa) at each concentration using the Rayleigh equation. Unless otherwise stated, this method has been used to measure the RSA in the stable liquid compositions disclosed herein.

[0056] The compositions disclosed herein comprise a buffer solution. For example, the buffer solution may be an organic buffer solution. In some cases, the buffer solution is concentrated at about pH 5 to pH 6.5, or concentrated at pH 5 to pH 6, at 25°C. In some embodiments, the buffer solution has a pKa within a pH unit of pH 5.4 to pH 5.6 at 25°C. An exemplary buffer solution is histidine / histidine hydrochloride, which has a pKa of about pH 6.09 at 25°C. Another such buffer solution is acetate / acetate, which has a pKa of about 4.75 at 25°C. Other alternative buffer solutions considered include ion-based buffer solutions, including propionate (pKa 4.87 at 25°C), malate (pKa 5.13 at 25°C), pyridine (pKa 5.23 at 25°C), piperazine (pKa 5.33 at 25°C), and succinate (pKa 5.40 at 25°C). Histidine-based buffer solutions are particularly considered. In some cases, the buffer solution is histidine.

[0057] In some cases, the buffer solution in the composition is present at a concentration of about 1 mM to about 50 mM, about 1 mM to about 40 mM, or about 1 mM to about 30 mM. In some cases, the composition contains about 5 mM to about 50 mM, about 10 mM to about 40 mM, about 15 mM to about 30 mM, or about 15 mM to about 25 mM buffer solution. In some cases, the buffer solution in the composition is present at a concentration of about 11 mM, about 12 mM, about 13 mM, about 14 mM, about 15 mM, about 16 mM, about 17 mM, about 18 mM, about 19 mM, about 20 mM, about 21 mM, about 22 mM, about 23 mM, about 24 mM, about 25 mM, about 26 mM, about 27 mM, about 28 mM, about 29 mM, or about 30 mM. In some cases, the concentration of the buffer solution is about 16 mM to about 24 mM, about 17 mM to about 24 mM, about 18 mM to about 24 mM, or about 19 mM to about 21 mM. In some cases, the composition contains about 20 mM ± 10% buffer solution.

[0058] In various cases, the compositions disclosed herein may contain other components. In all respects, the compositions may contain any pharmaceutically acceptable ingredients, including, for example, acidifiers, additives, adsorbents, aerosol propellants, air displacement agents, alkalizers, anti-caking agents, anticoagulants, antimicrobial preservatives, antioxidants, preservatives, alkalis, binders, buffers, chelating agents, coating agents, colorants, desiccants, detergents, diluents, disinfectants, disintegrants, dispersants, solubilizers, dyes, emollients, emulsifiers, emulsion stabilizers, fillers, film-forming agents, flavor enhancers, aroma enhancers, flow enhancers, gelling agents, granulating agents, humectants, lubricants, binders, ointment bases, ointments, oily carriers, organic bases, lozenge bases, pigments, plasticizers, polishing agents, preservatives, chelating agents, skin penetrants, solubilizers, solvents, stabilizers, suppository bases, and surfactants. Agents / surfactants), suspending agents, sweeteners, therapeutic agents, thickeners, fortifying agents, toxic agents, viscous agents, water-absorbing agents, water-miscible solubilizers, water softeners, or wetting agents. See, for example, the Handbook of Pharmaceutical Excipients, 3rd edition, AHKibbe (Pharmaceutical Press, London, UK, 2000), which is incorporated herein by reference in its entirety; Remington's Pharmaceutical Sciences, 16th edition, EWMartin (Mack Publishing Company, Easton, PA, 1980), which is incorporated herein by reference in its entirety.

[0059] In some cases, the compositions disclosed herein are liquids. In some cases, the pH of the liquid is less than about 6.0, optionally about 5.5. In some cases, the pH is about 5.0 to about 6.0 or about 5.3 to about 5.8, for example, about 5.3, about 5.4, about 5.5, about 5.6, about 5.7, or about 5.8, about 5.4. In some cases, the pH is about 5.5.

[0060] In some cases, the composition is characterized by a reduced viscosity relative to formulations containing lower concentrations of the anti-IL-33 antibody, 20 mM histidine, 80 mM arginine, 120 mM sucrose, and 0.02% (w / v) polysorbate 80 (pH 6.0). In some cases, the composition is characterized by a viscosity of less than about 25 centipoise (cP) at 23°C when the concentration of the anti-IL-33 antibody is less than 165 mg / mL, optionally about 9 cP when the concentration of the anti-IL-33 antibody is about 150 mg / mL, or about 5 cP when the concentration of the anti-IL-33 antibody is about 130 mg / mL. In some aspects, the composition is characterized in that, when the concentration of the anti-IL-33 antibody is less than about 150 mg / mL (e.g., about 130 mg / mL, about 140 mg / mL, about 150 mg / mL), the viscosity is about 5 cP to about 20 cP, for example, about 5 cP to about 15 cP, about 5 cP to about 10 cP, about 10 cP to about 20 cP, about 15 cP to about 20 cP, or about 5 cP, about 6 cP, about 7 cP, about 8 cP, about 9 cP, about 10 cP, about 11 cP, about 12 cP, about 13 cP, about 14 cP, about 15 cP, about 16 cP, about 17 cP, about 18 cP, about 19 cP, about 20 cP. In an exemplary aspect, when the concentration of the antibody is about 130 mg / mL to about 170 mg / mL, the viscosity of the composition is about 10 cP ± 5 cP. In some cases, the composition is characterized by a viscosity of less than about 10 centipoise (cP) at 23°C when the concentration of the anti-IL-33 antibody is about 150 mg / mL. In other cases, the viscosity is from about 5 cP to about 20 cP, optionally less than about 10 cP (e.g., about 9 cP). Unless otherwise stated, all viscosities disclosed herein refer to viscosities measured using a rotational viscometer at 23°C and a shear rate of about 1000 l / s.

[0061] In an exemplary aspect, the composition is intended for subcutaneous administration to a subject, and therefore isotonic with the intended site of application. For example, in some cases, the osmotic pressure of the composition is in the range of about 340 mOsm / kg to about 520 mOsm / kg, or about 344 mOsm / kg to about 516 mOsm / kg, or about 400 mOsm / kg to about 500 mOsm / kg. In an exemplary aspect, the osmotic pressure of the liquid pharmaceutical composition is in the range of about 300 mOsm / kg to about 600 mOsm / kg, or about 340 mOsm / kg to about 520 mOsm / kg, or about 360 mOsm / kg to about 500 mOsm / kg. In some cases, the osmotic pressure is about 452 mOsm / kg.

[0062] The compositions disclosed herein are advantageously suited for long-term or short-term storage. In some cases, the compositions are suitable for long-term or short-term storage at freezing or refrigeration temperatures or higher. Therefore, the compositions disclosed herein can be stored at temperatures below 0°C (e.g., about -80°C to about -10°C, about -60°C to about -20°C, or about -30°C) or at temperatures between about 1°C and about 10°C (e.g., about 2°C to about 8°C). Optionally, storage at these temperatures (below 10°C) can be long-term storage, e.g., at least 6 months, at least 12 months, at least 18 months, at least 24 months, at least 30 months, or at least 36 months. The compositions disclosed herein can be stored at room temperature (e.g., about 20°C to about 30°C, about 23°C to about 27°C, about 25°C, or about 30°C). In some cases, the compositions disclosed herein can be stored at temperatures above room temperature (e.g., above 30°C (e.g., about 35°C to about 45°C, about 40°C)).

[0063] In some cases, the compositions disclosed herein are highly stable and can withstand prolonged storage at refrigerated or frozen temperatures. The compositions disclosed herein are highly stable as liquids or solids. Optionally, after storage at about 2°C to about 8°C (e.g., about 2°C, about 4°C, about 8°C, about -20°C) for about 1 month to about 3 months, less than about 5% (e.g., less than about 4%, less than about 3%, less than about 2%, less than about 1%) of the anti-IL-33 antibody aggregates. As used herein, "aggregate" refers to insoluble aggregates of the anti-IL-33 antibody. In some cases, as determined by the SEC, after storage at about 2°C to about 8°C (e.g., about 2°C, about 4°C, about 8°C, about 10°C) for 6 months or 12 months, less than about 5% (e.g., less than about 4%, less than about 3%, less than about 2%, less than about 1%) of the anti-IL-33 antibody aggregates. In some cases, as determined by the SEC, after storage at about 2°C to about 8°C (e.g., about 2°C, about 4°C, about 8°C) for 18 months, less than about 5% (e.g., less than about 4%, less than about 3%, less than about 2%, less than about 1%) of the anti-IL-33 antibody degrades. In some cases, as determined by the SEC, after storage in glass vials or syringes at about 2°C to about 8°C (e.g., about 2°C, about 4°C, about 8°C) for 18 months, more than 95% of the anti-IL-33 antibody remains intact. In some cases, as determined by the SEC, after storage at about 2°C to about 8°C (e.g., about 2°C, about 4°C, about 8°C) for about 18 months, less than about 5% (e.g., less than about 4%, less than about 3%, less than about 2%, less than about 1%) of the antibody aggregates in the compositions disclosed herein.

[0064] In some cases, the compositions disclosed herein are highly stable and can withstand prolonged storage at room temperature. Optionally, after storage at about 23°C to about 27°C (e.g., about 23°C, about 24°C, about 25°C, about 26°C, about 27°C) for about 1 month to about 3 months, less than about 5% (e.g., less than about 4%, less than about 3%, less than about 2%, less than about 1%) of the anti-IL-33 antibody aggregates. In some cases, as determined by the SEC, after storage at about 23°C to about 27°C for about 6 months, less than about 5% (e.g., less than about 4%, less than about 3%, less than about 2%, less than about 1%) of the anti-IL-33 antibody aggregates. In many cases, as determined by the SEC, after storage at about 23°C to about 27°C in glass vials or syringes for about 6 months, more than 95% of the anti-IL-33 antibody remains intact. In some cases, as determined by the SEC, less than about 5% (e.g., less than about 4%, less than about 3%, less than about 2%, less than about 1%) of the anti-IL-33 antibody in the compositions disclosed herein degrades after being stored at about 23°C to about 27°C for about 6 months.

[0065] Under various conditions, the compositions disclosed herein are highly stable and capable of withstanding short-term storage under pressure. In some cases, after storage at about 38°C to about 42°C (e.g., about 38°C, about 39°C, about 40°C, about 41°C, about 42°C) for about 1 month to about 3 months, less than about 5% (e.g., less than about 4%, less than about 3%, less than about 2%, less than about 1%) of the anti-IL-33 antibody aggregates. In some cases, as determined by the SEC, after storage in glass vials or syringes at about 38°C to about 42°C (e.g., about 38°C, about 39°C, about 40°C, about 41°C, about 42°C) for about 3 months, more than 95% of the anti-IL-33 antibody remains intact. In some cases, as determined by the SEC, after storage at about 38°C to about 42°C (e.g., about 38°C, about 39°C, about 40°C, about 41°C, about 42°C) for about 3 months, less than about 5% (e.g., less than about 4%, less than about 3%, less than about 2%, less than about 1%) of the anti-IL-33 antibody in the compositions disclosed herein aggregates.

[0066] In some cases, the composition is provided for storage or use, for example, in a disposable vial, a disposable syringe, or a glass, glass-lined, or glass-coated master container. In an exemplary case, the composition is provided in the form of a disposable system bag or polycarbonate bottle for cryogenic storage. Alternatively, the composition is contained in a glass vial or syringe for storage, for example, for prolonged storage at about 2°C to about 8°C or for storage at higher temperatures (e.g., about 25°C, about 30°C, about 40°C).

[0067] In some cases, the composition is provided for use in off-the-shelf and / or self-administered delivery systems. In other cases, the composition is provided in the form of pre-filled syringes or auto-injectors, pen syringes, dual-chamber pens, etc. Such products are known in the art and may be commercially available. See, for example, Shire, Steven, Monoclonal Antibodies: Meeting the Challenges in Manufacturing, Formulation, Delivery and Stability of Final Drug Product, Chapter 8: Development of delivery device technology to deal with the challenges of highly viscous mAb formulations at high concentration, Woodhead Publishing, Cambridge, UK, pp. 153-162 (2015).

[0068] The compositions disclosed herein are suitable for administration via any acceptable route, including parenteral administration, particularly subcutaneous administration. For example, subcutaneous administration may be applied to the upper arm, upper thigh, or abdomen. Other routes include intravenous, intradermal, intramuscular, intraperitoneal, intranodal, and intrasplenic administration. The subcutaneous route is preferred. In some cases, the intravenous route is preferred. For example, the stable liquid composition may be diluted in IV fluid prior to intravenous delivery.

[0069] The compositions disclosed herein contain an anti-IL-33 antibody. Interleukin-33 (IL-33), also known as IL-1F11, is a member of the IL-1 cytokine family, which stimulates the production of cells, cytokines, and immunoglobulins specific to type II immune responses. IL-33 is a 270-amino acid protein composed of two domains: a homologous domain and a cytokine (IL-1-like) domain. The homologous domain contains a nuclear localization signal (NLS). IL-33-mediated signaling is transduced via ST2, a receptor expressed on Th2 cells, mast cells, and many other cell types.

[0070] The extracellular form of IL-33 stimulates target cells by binding to ST2, subsequently activating the NFKB and MAP kinase pathways, leading to a series of functional responses, including the production of cytokines and chemokines. Soluble ST2 (sST2) is considered a decoy receptor that blocks IL-33 signaling.

[0071] In humans, IL-33 has been found to be constitutively expressed in smooth muscle and bronchial epithelium. Its expression can be induced in lung and dermal fibroblasts by IL-Iβ and TNF-α (Schmitz et al. (2005)). Increased levels of soluble ST2 protein and IL-33 mRNA / protein have been observed in serum and tissues from asthmatic patients (Oboki et al., Allergology International 59:143-160 (2010)).

[0072] In vivo, IL-33 induces the expression of IL-4, IL-5, and IL-13, leading to severe pathological changes in mucosal organs. Administration of IL-33 to mice exhibits potent inflammatory effects, including a large number of blood eosinophils, increased serum levels of IL-5 and IgE, and goblet cell proliferation on the mucosal surface (Schmitz et al. (2005)). Intraperitoneal or intranasal administration of IL-33 to mice induces eosinophilic inflammation of the lung and intestinal mucosa via IL-13 and STAT6-dependent pathways (Oboki et al. (2010)). Therefore, IL-33 may play a role in allergic diseases such as asthma and inflammatory airway diseases such as chronic obstructive pulmonary disease (COPD).

[0073] Therefore, compositions containing anti-IL-33 antibodies are considered for use in the treatment of IL-33-mediated diseases (such as asthma or COPD).

[0074] In some cases, the antibody present in the composition of the present invention comprises a heavy chain variable domain comprising VHCDR1 having the sequence of SEQ ID NO: 1, VHCDR2 having the sequence of SEQ ID NO: 2, and VHCDR3 having the sequence of SEQ ID NO: 3; and a light chain variable domain comprising VLCDR1 having the sequence of SEQ ID NO: 5, VLCDR2 having the sequence of SEQ ID NO: 6, and VLCDR3 having the sequence of SEQ ID NO: 7.

[0075] In some cases, the antibody present in the composition of the present invention comprises: (a) a heavy chain variable domain, which is a sequence of amino acids having at least 95%, 90%, 85%, or 80% identity with SEQ ID NO: 4, or a sequence of amino acids encoded by a polynucleotide sequence having at least 95%, 90%, 85%, or 80% identity with SEQ ID NO: 11; (b) a light chain variable domain, which is an amino acid sequence having at least 80% identity with SEQ ID NO: 8, or a sequence of amino acids encoded by a polynucleotide sequence having at least 95%, 90%, 85%, or 80% identity with SEQ ID NO: 12; or (c) the heavy chain variable domain of (a) and the light chain variable domain of (b).

[0076] In some cases, the antibody is a human antibody, a humanized antibody, a chimeric antibody, a monoclonal antibody, a recombinant antibody, an antigen-binding antibody fragment, a single-chain antibody, a monomeric antibody, a biantibody, a triantibody, a tetraantibody, a Fab fragment, an IgG1 antibody, an IgG2 antibody, an IgG3 antibody, and an IgG4 antibody. In some cases, the anti-IL-33 antibody is an IgG1 antibody.

[0077] In some cases, the anti-IL-33 antibody comprises a heavy chain variable domain containing the amino acid sequence of SEQ ID NO: 4. In some cases, the anti-IL-33 antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 8. In some cases, the anti-IL-33 antibody comprises a heavy chain variable domain containing the amino acid sequence of SEQ ID NO: 4 and a light chain containing the amino acid sequence of SEQ ID NO: 8.

[0078] In some cases, the anti-IL-33 antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 9. In some cases, the anti-IL-33 antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 10. In some cases, the anti-IL-33 antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 9 and a light chain containing the amino acid sequence of SEQ ID NO: 10.

[0079] In some cases, the composition contains an anti-IL-33 antibody that competitively binds to IL-33 against 33_640087-7B in an in vitro HTRF competitive binding assay. If an antibody specifically binds to the epitope to the extent that it partially blocks the binding of a reference antibody to the epitope, the antibody is said to competitively inhibit the binding of the reference antibody to the given epitope. Competitive inhibition can be determined by any method known in the art, such as solid-phase assays (e.g., competitive ELISA assays), dissociation-enhanced lanthanide fluorescence immunoassays (...). PerkinElmer (PerkinElmer) and radioligand binding assays. For example, a technician can determine whether their antibody competitively binds to IL-33 by using an in vitro competitive binding assay (such as the HTRF assay described in paragraphs 881-886 of WO 2016 / 156440, which is incorporated herein by reference). For example, a technician can label a primary anti-IL-33 antibody with a donor fluorophore and mix multiple concentrations of recombinant antibody with a fixed concentration of redIL-33 labeled with a receptor fluorophore. The fluorescence resonance energy transfer between the donor and receptor fluorophores within each sample can then be measured to determine the binding characterization. To elucidate competitive binding of anti-IL-33 antibodies, a technician can first mix various concentrations of test antibody with a fixed concentration of labeled antibody from Table 6. When the mixture is incubated with labeled IL-33, a decrease in the FRET signal compared to a positive control containing only labeled antibody will indicate competitive binding of IL-33. It can be said that the binding molecule or fragment thereof competitively inhibits the binding of the reference antibody to a given epitope by at least 90%, at least 80%, at least 70%, at least 60%, or at least 50%.

[0080] In some cases, the composition comprises anti-IL-33 antibody 33_640087-7B (as described in WO 2016 / 156440, which is incorporated herein by reference). WO 2016 / 156440 discloses that 33_640087-7B binds to redIL-33 with a particularly high affinity and attenuates both ST-2-dependent and RAGE-dependent IL-33 signaling.

[0081] Other exemplary anti-IL-33 antibodies include ANB020 (as described in WO 2015 / 106080), 9675P (as described in US 2014 / 0271658), A25-3H04 (as described in US 2017 / 0283494), Ab43 (as described in WO 2018 / 081075), IL33-158 (as described in US 2018 / 0037644), 10C12.38.H6.87Y.581 1gG4 (as described in WO 2016 / 077381), or their binding fragments. Other exemplary anti-IL-33 antibodies or their antigen-binding fragments include any other anti-IL-33 antibodies described in WO 2016 / 156440, WO 2015 / 106080, US 2014 / 0271658, US2017 / 0283494, WO 2018 / 081075, US 2018 / 0037644 or WO 2016 / 077381 (all of which are incorporated herein by reference).

[0082] Preparation method

[0083] This document further provides methods for preparing the compositions disclosed herein. Therefore, methods are further provided for preparing stable liquid compositions with a viscosity less than about 10 cP and comprising greater than about 100 mg / mL anti-IL-33 antibody, at least about 170 mM arginine, such as at least about 190 mM arginine, optionally a surfactant, and a buffer. In some cases, the method comprises: (i) combining the antibody, arginine, and buffer in solution to obtain a solution comprising about 100 mg / mL to about 200 mg / mL anti-IL-33 antibody, at least about 170 mM arginine, such as at least about 170 mM arginine, such as at least about 190 mM arginine, and buffer; and (ii) adding a surfactant to the solution to achieve a final concentration of about 0.03% (w / v) ± 0.015% (w / v) surfactant.

[0084] Further, a method is provided for preparing a stable liquid composition with a viscosity of less than about 10 cP and containing greater than about 100 mg / mL of anti-IL-33 antibody, at least about 150 mM lysine, optionally a surfactant, and a buffer. In some cases, the method includes: (i) combining the antibody, arginine, and buffer in solution to obtain a solution containing about 100 mg / mL to about 200 mg / mL of anti-IL-33 antibody, at least about 170 mM arginine, at least about 150 mM lysine, and a buffer; and (ii) adding a surfactant to the solution to achieve a final concentration of about 0.03% (w / v) ± 0.015% (w / v) surfactant.

[0085] In some cases, the stable liquid composition contains a surfactant at a concentration of 0.03% (w / v) ± 0.01% (w / v). In some cases, the stable liquid composition contains a surfactant at a concentration of from 0.02% (w / v) to about 0.04% (w / v).

[0086] In some cases, the stable liquid composition contains a surfactant at a concentration of 0.02% (w / v) ± 0.01% (w / v). In other cases, the stable liquid composition contains a surfactant at a concentration of 0.01% (w / v) to about 0.02% (w / v).

[0087] In some cases, the stable liquid composition contains approximately 150 mg / mL of the anti-IL-33 antibody.

[0088] In some cases, the stable liquid composition contains greater than 170 mM arginine. In some cases, the stable liquid composition contains greater than 190 mM arginine. In some cases, the composition contains less than about 500 mM arginine. For example, the composition contains about 200 mM, about 210 mM, about 220 mM, about 240 mM, about 260 mM, about 280 mM, about 300 mM, about 350 mM, about 400 mM, or about 450 mM arginine. In some cases, the composition contains about 220 mM arginine.

[0089] In some cases, the stable liquid composition contains at least about 150 mM of lysine. In some cases, the composition contains less than about 500 mM of lysine. For example, the composition contains about 160 mM, about 170 mM, about 180 mM, about 200 mM, about 220 mM, about 240 mM, about 260 mM, about 280 mM, about 300 mM, about 350 mM, about 400 mM, or about 450 mM of lysine. In some cases, the composition contains about 170 mM of lysine.

[0090] In some cases, the viscosity of a stable liquid composition with a high concentration of arginine is reduced relative to a liquid composition containing a lower concentration of anti-IL-33 antibody, 20 mM histidine, 80 mM arginine, 120 mM sucrose, and 0.02% (w / v) polysorbate 80 (pH 6.0).

[0091] In some cases, the viscosity of the stabilized liquid composition is less than about 10 cP. In some cases, the viscosity of the stabilized liquid composition is about 9 cP. In some cases, the viscosity is measured at 23°C.

[0092] In some cases, the reversible self-association (RSA) of the anti-IL-33 antibody in the stable liquid composition is reduced relative to the RSA of the anti-IL-33 antibody in a liquid composition containing 20 mM histidine, 80 mM arginine, 120 mM sucrose, and 0.02% (w / v) polysorbate 80 (pH 6.0), where the lower concentration is relative to the concentration of the anti-IL-33 antibody in the stable liquid composition.

[0093] In some cases, the RSA of the anti-IL-33 antibody was reduced by 2-fold compared to the RSA of the anti-IL-33 antibody in a liquid composition containing a lower concentration of 20 mM histidine, 80 mM arginine, 120 mM sucrose, and 0.02% (w / v) polysorbate 80 (pH 6.0).

[0094] In some cases, the stable liquid composition contains at least about 30%, for example, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, or about 50% by weight of monomer. In some cases, the stable liquid composition contains about 35% to about 50% by weight of monomer. In some cases, the stable liquid composition contains about 40% to about 45% by weight of monomer. In some cases, after storage at a temperature of about 2°C to about 8°C for about 3 months, the stable liquid composition contains about 35% to about 50% by weight of monomer. In some cases, after storage at a temperature of about 2°C to about 8°C for about 3 months, the stable liquid composition contains about 35% to about 50% by weight of monomer. In some cases, after storage at a temperature of about 2°C to about 8°C for about 3 months, the stable liquid composition contains about 40% by weight of monomer. In some cases, after storage at a temperature of about 2°C to about 8°C for about 6 months, the stable liquid composition contains about 35% to about 50% by weight of monomer. In some cases, after storage at a temperature of about 2°C to about 8°C for about 6 months, the stable liquid composition contains about 40% by weight of monomer.

[0095] In some cases, the surfactant is polysorbate 80 or polysorbate 20. In some cases, the surfactant is polysorbate 80.

[0096] In some cases, the buffer solution is made from histidine. In some cases, the final buffer concentration of the stable liquid composition is from about 16 mM to about 24 mM, optionally from about 17 mM to about 24 mM, optionally from about 18 mM to about 24 mM.

[0097] In some cases, the pH of a stable liquid composition is approximately pH 5.5.

[0098] In some cases, the anti-IL-33 antibody may be any of the antibodies described herein. In some cases, the anti-IL-33 antibody may be 33_640087-7B.

[0099] Products, syringes and vials

[0100] This disclosure provides an article comprising any of the compositions disclosed above, optionally comprising about 0.5 mL to about 5 mL (e.g., about 0.5 mL to about 4.5 mL, about 0.5 mL to about 4 mL, about 0.5 mL to about 3.5 mL, about 0.5 mL to about 3 mL, about 0.5 mL to about 2.5 mL, about 0.5 mL to about 2 mL, about 0.5 mL to about 1.5 mL, about 0.5 mL to about 1 mL, about 1 mL to about 5 mL, about 1.5 mL to about 5 mL, about 2 mL to about 5 mL, about 2.5 mL to about 5 mL, about 3 mL to about 5 mL, about 3.5 mL to about 5 mL, about 4 mL to about 5 mL, about 4.5 mL to about 5 mL). In some cases, the composition comprises more than about 100 mg / mL of anti-IL33 antibody (e.g., 33_640087-7B). In some cases, the composition comprises about 130 mg / mL to about 170 mg / mL of anti-IL-33 antibody (e.g., 33_640087-7B), about 0.03% (w / v) ± 0.015% (w / v) polysorbate 80, about 220 mM arginine, and about 16 mM to about 24 mM histidine, wherein the pH is less than about 6, optionally about pH 5.5. Optionally, the pH is from about pH 5.0 to about pH 6.0.

[0101] This disclosure also provides a prefilled syringe (PFS) comprising any of the compositions disclosed above, optionally comprising about 0.5 mL to about 5 mL (e.g., about 0.5 mL to about 4.5 mL, about 0.5 mL to about 4 mL, about 0.5 mL to about 3.5 mL, about 0.5 mL to about 3 mL, about 0.5 mL to about 2.5 mL, about 0.5 mL to about 2 mL, about 0.5 mL to about 1.5 mL, about 0.5 mL to about 1 mL, about 1 mL to about 5 mL, about 1.5 mL to about 5 mL, about 2 mL to about 5 mL, about 2.5 mL to about 5 mL, about 3 mL to about 5 mL, about 3.5 mL to about 5 mL, about 4 mL to about 5 mL, about 4.5 mL to about 5 mL). In some cases, the composition comprises more than about 100 mg / mL of anti-IL33 antibody (e.g., 33_640087-7B). In some cases, the composition comprises about 130 mg / mL to about 170 mg / mL of anti-IL-33 antibody (e.g., 33_640087-7B), about 0.03% (w / v) ± 0.015% (w / v) polysorbate 80, about 220 mM arginine, and about 16 mM to about 24 mM histidine, wherein the pH is less than about 6, optionally about pH 5.5.

[0102] A vial is also provided comprising any of the compositions disclosed above, optionally comprising about 0.5 mL to about 5 mL (e.g., about 0.5 mL to about 4.5 mL, about 0.5 mL to about 4 mL, about 0.5 mL to about 3.5 mL, about 0.5 mL to about 3 mL, about 0.5 mL to about 2.5 mL, about 0.5 mL to about 2 mL, about 0.5 mL to about 1.5 mL, about 0.5 mL to about 1 mL, about 1 mL to about 5 mL, about 1.5 mL to about 5 mL, about 2 mL to about 5 mL, about 2.5 mL to about 5 mL, about 3 mL to about 5 mL, about 3.5 mL to about 5 mL, about 4 mL to about 5 mL, about 4.5 mL to about 5 mL). In some cases, the composition comprises more than about 100 mg / mL of anti-IL33 antibody (e.g., 33_640087-7B). In some cases, the composition comprises about 130 mg / mL to about 170 mg / mL of anti-IL-33 antibody (e.g., 33_640087-7B), about 0.03% (w / v) ± 0.015% (w / v) polysorbate 80, about 220 mM arginine, and about 16 mM to about 24 mM histidine, wherein the pH is less than about 6, optionally about pH 5.5.

[0103] Reagent test kit

[0104] This disclosure also provides a kit comprising the compositions described herein, along with packaging inserts, packaging labels, instructions, or other labels that guide or disclose any methods disclosed herein. In some cases, this disclosure provides kits for generating single-dose administration units. Certain instances of this disclosure include kits comprising pre-filled single-lumen and multi-lumen syringes (e.g., liquid syringes).

[0105] Treatment

[0106] This disclosure also provides for the use of 33_640087-7B, or another anti-IL-33 antibody disclosed herein, or its antigen-binding portion, in the preparation of a medicament for treating a subject with an IL-33-mediated disease.

[0107] This document provides methods for treating subjects with IL-33-mediated diseases. In some cases, this disclosure provides compositions disclosed herein for use in treating subjects with IL-33-mediated diseases. As provided herein, this disclosure also provides the use of anti-IL-33 antibodies in the preparation of a medicament for treating subjects with IL-33-mediated diseases, wherein the medicament comprises any of the compositions disclosed herein.

[0108] In some cases, the methods, compositions or uses described herein are for the treatment of IL-33-mediated disorders selected from asthma, atopic dermatitis and chronic obstructive pulmonary disease.

[0109] In some cases, the methods, compositions, or uses described herein are for the treatment of diabetic nephropathy.

[0110] In some cases, the subject is a human being.

[0111] Example

[0112] 1. A composition comprising an anti-IL-33 antibody at a concentration greater than about 100 mg / ml, at least 170 mM arginine or at least about 150 mM lysine, and a buffer, wherein the anti-IL-33 antibody comprises:

[0113] i. A heavy chain variable structural domain comprising VHCDR1 having the sequence of SEQ ID NO: 1, VHCDR2 having the sequence of SEQ ID NO: 2, and VHCDR3 having the sequence of SEQ ID NO: 3; and

[0114] ii. A light chain variable structural domain comprising VLCDR1 having the sequence of SEQ ID NO: 5, VLCDR2 having the sequence of SEQ ID NO: 6, and VLCDR3 having the sequence of SEQ ID NO: 7.

[0115] 2. The composition as described in Example 1, wherein the anti-IL-33 antibody comprises:

[0116] i. Heavy chain variable structural domain, which is:

[0117] i. A sequence of amino acids having at least 95%, 90%, 85%, or 80% identity with SEQ ID NO: 4; or

[0118] ii. A sequence of amino acids encoded by a polynucleotide sequence having at least 80% identity with SEQ ID NO: 11;

[0119] ii. Light chain variable structural domain, which is:

[0120] i. A sequence of amino acids having at least 95%, 90%, 85%, or 80% identity with SEQ ID NO: 8; or

[0121] ii. A sequence of amino acids encoded by a polynucleotide sequence having at least 80% identity with SEQ ID NO: 12; or

[0122] iii. The heavy chain variable structural domain of (a) and the light chain variable structural domain of (b).

[0123] 3. The composition as described in Example 1 or 2, wherein the anti-IL-33 antibody is an IgG1 antibody.

[0124] 4. The composition as described in any of the foregoing embodiments, wherein the anti-IL-33 antibody comprises a heavy chain variable domain containing the amino acid sequence of SEQ ID NO: 4, a light chain containing the amino acid sequence of SEQ ID NO: 8, or a heavy chain variable domain containing the amino acid sequence of SEQ ID NO: 4 and a light chain containing the amino acid sequence of SEQ ID NO: 8.

[0125] 5. The composition as described in any of the foregoing embodiments, wherein the anti-IL-33 antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 9, a light chain containing the amino acid sequence of SEQ ID NO: 10, or a heavy chain containing the amino acid sequence of SEQ ID NO: 9 and a light chain containing the amino acid sequence of SEQ ID NO: 10.

[0126] 6. The composition as described in any of the foregoing embodiments, wherein the anti-IL-33 antibody competitively binds to IL-33 with 33_640087-7B in an in vitro HTRF competitive binding assay.

[0127] 7. The composition as described in any of the foregoing examples, wherein the anti-IL-33 antibody is present at a concentration of less than about 200 mg / ml.

[0128] 8. The composition as described in any of the foregoing examples, wherein the anti-IL-33 antibody is present at a concentration of less than about 180 mg / ml.

[0129] 9. The composition as described in any of the foregoing examples, wherein the anti-IL-33 antibody is present at a concentration of less than about 160 mg / ml.

[0130] 10. The composition as described in any of the foregoing embodiments, wherein the anti-IL-33 antibody is present at a concentration from about 100 mg / ml to about 200 mg / ml.

[0131] 11. The composition as described in any of the foregoing embodiments, wherein the anti-IL-33 antibody is present at a concentration from about 130 mg / ml to about 170 mg / ml.

[0132] 12. The composition as described in any of the foregoing embodiments, wherein the anti-IL-33 antibody is present at a concentration of 150 mg / ml ± 10%.

[0133] 13. The composition as described in any of the foregoing embodiments, further comprising a surfactant.

[0134] 14. The composition as described in Example 13, wherein the surfactant is amphiphilic and anionic.

[0135] 15. The composition as described in Example 14, wherein the surfactant is polysorbate.

[0136] 16. The composition as described in Example 15, wherein the surfactant is polysorbate 20 or polysorbate 80 or a mixture thereof.

[0137] 17. The composition of any one of Examples 13 to 16, wherein the concentration of the surfactant is from about 0.005% (w / v) to about 0.05% (w / v).

[0138] 18. The composition as described in Example 17, wherein the composition contains 0.03% (w / v) ± 0.010% (w / v) surfactant.

[0139] 19. The composition as described in Example 17, wherein the composition comprises about 0.015% (w / v), 0.03% (w / v), or 0.045% (w / v) of surfactant.

[0140] 20. The composition as described in any one of Examples 16 to 19, wherein the surfactant is polysorbate 80.

[0141] 21. The composition as described in any of the foregoing embodiments, wherein the composition comprises at least about 190 mM arginine.

[0142] 22. The composition as described in any of the foregoing embodiments, wherein the composition comprises about 190 mM to about 250 mM arginine.

[0143] 23. The composition as described in any of the foregoing embodiments, wherein the composition comprises about 220 mM arginine.

[0144] 24. The composition as described in any of the foregoing embodiments, wherein the arginine is L-arginine hydrochloride.

[0145] 25. The composition of any one of Examples 1 to 20, wherein the composition comprises about 150 mM to about 250 mM of lysine.

[0146] 26. The composition as described in Example 25, wherein the composition contains about 170 mM lysine.

[0147] 27. The composition as described in any one of Examples 1-20, 25 or 26, wherein the lysine is L-lysine.

[0148] 28. The composition as described in any of the foregoing embodiments, wherein the buffer solution is a succinate, histidine, or acetate.

[0149] 29. The composition as described in Example 28, wherein the buffer solution is histidine.

[0150] 30. The composition as described in Example 29, wherein the buffer solution is L-histidine / L-histidine hydrochloride.

[0151] 31. The composition as described in any of the foregoing embodiments, wherein the concentration of the buffer solution is from about 10 mM to about 30 mM.

[0152] 32. The composition as described in Example 31, wherein the concentration of the buffer solution is from about 16 mM to about 24 mM, optionally from about 17 mM to about 24 mM, optionally from about 18 mM to about 24 mM.

[0153] 33. The composition as described in any one of Examples 31 or 32, wherein the concentration of the buffer solution is from about 19 mM to about 21 mM.

[0154] 34. The composition as described in any of the foregoing embodiments, wherein the composition comprises 20 mM ± 10% buffer solution.

[0155] 35. The composition as described in any of the foregoing embodiments is a liquid.

[0156] 36. The composition as described in any of the foregoing embodiments, wherein the pH is less than about pH 6.0.

[0157] 37. The composition as described in any of the foregoing embodiments, wherein the pH is from about pH 5.0 to about pH 6.0.

[0158] 38. The composition as described in any of the foregoing embodiments, wherein the pH is about pH 5.2, about pH 5.5, or about pH 5.8.

[0159] 39. The composition as described in any of the foregoing embodiments, wherein the pH is about pH 5.5.

[0160] 40. The composition as described in any one of Examples 35 to 39, characterized in that its viscosity is reduced relative to a composition containing less than or equal to 80 mM arginine.

[0161] 41. The composition as described in any one of Examples 35 to 39, characterized in that its viscosity is reduced relative to a composition comprising a lower concentration of the anti-IL-33 antibody, 20 mM histidine, 80 mM arginine, 120 mM sucrose, and 0.02% (w / v) polysorbate 80 (pH 6.0).

[0162] 42. The composition as described in any one of Examples 35 to 41, characterized in that the viscosity at 23°C is less than about 10 cP, wherein the concentration of the anti-IL-33 antibody is about 150 mg / ml ± 10%.

[0163] 43. The composition as described in any one of Examples 35 to 41, wherein the viscosity is from about 5 cP to about 20 cP, optionally less than about 10 cP, such as about 9 cP.

[0164] 44. The composition of any one of Examples 35 to 43, characterized in that, relative to the reversible self-association of the anti-IL-33 antibody in a composition comprising 20 mM histidine, 80 mM arginine, 120 mM sucrose and 0.02% (w / v) polysorbate 80 (pH 6.0) and at a lower concentration (e.g., 50 mg / ml), the anti-IL-33 antibody has reduced reversible self-association.

[0165] 45. The composition of any one of Examples 35 to 44, wherein the composition comprises about 35% to about 50% by weight of monomer.

[0166] 46. ​​The composition as described in any of the foregoing embodiments, wherein, as measured by size exclusion chromatography (SEC), after storage at about 2°C to about 8°C for about 12 months to about 18 months, less than about 5%, optionally less than about 2%, of the antibody aggregates.

[0167] 47. A composition comprising about 130 mg / ml to about 170 mg / ml 33_640087-7B, about 0.03% (w / v) ± 0.015% polysorbate 80, about 220 mM arginine and about 16 mM to about 24 mM histidine buffer, wherein the pH is pH 5.5 ± 0.5.

[0168] 48. The composition as described in Example 47, comprising about 150 mg / ml 33_640087-7B.

[0169] 49. The composition of any one of Examples 47 or 48, wherein the composition comprises about 18 mM to about 22 mM histidine buffer, optionally about 20 mM histidine buffer.

[0170] 50. The composition as described in any one of Examples 47 to 49, wherein the arginine is L-arginine hydrochloride.

[0171] 51. A composition comprising about 130 mg / ml to about 170 mg / ml of anti-IL-33 antibody, about 0.03% (w / v) ± 0.015% polysorbate 80, about 220 mM arginine and about 16 mM to about 24 mM histidine buffer, wherein the pH is pH 5.5 ± 0.5.

[0172] 52. The composition as described in any one of Examples 47 to 51, wherein the composition is a liquid.

[0173] 53. An article comprising the composition as described in any of the foregoing embodiments, optionally comprising 0.5 ml to about 5 ml (e.g., about 1 ml to about 3 ml) of the composition.

[0174] 54. A vial containing the composition as described in any one of Examples 1 to 52, optionally containing about 0.5 ml to about 5 ml (e.g., about 1 ml to about 3 ml) of the composition.

[0175] 55. A method for treating an IL-33-mediated disorder in a subject, the method comprising administering to the subject a therapeutically effective amount of a composition as described in any one of Examples 1 to 52.

[0176] 56. The method as described in Example 55, wherein the IL-33-mediated disorder is asthma, atopic dermatitis, or chronic obstructive pulmonary disease.

[0177] 57. The method as described in Example 55, wherein the IL-33-mediated disorder is diabetic nephropathy.

[0178] 58. A method for preparing a stable liquid composition with a viscosity of less than about 10 cP and comprising greater than about 100 mg / ml anti-IL-33 antibody, at least about 170 mM arginine or about 150 mM lysine, a surfactant, and a buffer, the method comprising the steps of:

[0179] i. Combine the antibody, arginine, and buffer in solution to obtain a solution containing approximately 100 mg / mL to approximately 200 mg / mL anti-IL-33 antibody, at least approximately 170 mM arginine or approximately 150 mM lysine, and buffer; and

[0180] ii. Add a surfactant to the solution to achieve a final surfactant concentration of approximately 0.03% (w / v) ± 0.015% (w / v).

[0181] 59. The method as described in Example 58, wherein the stable liquid composition contains more than 190 mM arginine.

[0182] 60. The method of any one of Examples 58 or 59, wherein the stable liquid composition comprises about 220 mM arginine.

[0183] 61. The composition as described in any one of Examples 58 to 60, wherein the arginine is L-arginine hydrochloride.

[0184] 62. The method as described in any one of Examples 58 to 61, wherein the reversible self-association (RSA) of the anti-IL-33 antibody in the stable liquid composition is reduced relative to the RSA of the anti-IL-33 antibody in a liquid composition comprising 20 mM histidine, 80 mM arginine, 120 mM sucrose, and 0.02% (w / v) polysorbate 80 (pH 6.0).

[0185] 63. The method of any one of Examples 58 to 62, wherein the viscosity of the liquid formulation is reduced relative to a liquid formulation containing a lower concentration of the anti-IL-33 antibody, 20 mM histidine, 80 mM arginine, 120 mM sucrose, and 0.02% (w / v) polysorbate 80 (pH 6.0).

[0186] 64. The method of any one of Examples 58 to 63, wherein the surfactant is polysorbate 80.

[0187] 65. The method as described in any one of Examples 58 to 64, wherein the buffer solution is made from histidine.

[0188] 66. The method as described in Example 65, wherein the method produces a stable liquid formulation with a final buffer concentration of about 16 mM to about 24 mM, optionally about 17 mM to about 24 mM, optionally about 18 mM to about 24 mM.

[0189] 67. The method of any one of Examples 58 to 66, wherein the method produces a stable liquid formulation with a pH of about pH 5 to about pH 6, optionally about pH 5.5.

[0190] 68. The method of any one of Examples 58 to 67, wherein the anti-IL-33 antibody is as defined in any one of Examples 1 to 5.

[0191] 69. The method as described in any one of Examples 58 to 68, wherein cP is measured at 23°C.

[0192] Example

[0193] The generation of formulations with improved properties

[0194] 33_640087-7B is a human immunoglobulin (Ig) G1 monoclonal antibody (mAb) that binds to human interleukin (IL)-33, preventing IL-33 from binding to its receptor ST2 and inhibiting its conversion to disulfide-bonded (DSB) IL 33.

[0195] A Phase 1 clinical trial (Study D9180C00001) of 33_640087-7B has been completed. 33_640087-7B was found to be generally safe and well-tolerated, with no safety issues following intravenous (IV) administration of up to 300 mg of 33_640087-7B. 33_640087-7B is supplied as a lyophilized powder vial. Each vial contains a nominal 50 mg of 33_640087-7B. After reconstitution with 1.2 mL of sterile water for injection, the solution contains 50 mg / mL of 33_640087-7B (“Phase I formulation”) in 20 mM L-histidine / L-histidine hydrochloride, 80 mM L-arginine-hydrochloride, 120 mM sucrose, and 0.02% (w / v) polysorbate 80 (pH 6.0).

[0196] This example describes the surprising results of efforts to reformulate 33_640087-7B to achieve a higher unit dose composition per milliliter for subsequent clinical studies.

[0197] The reversible self-association characteristics of 33_640087-7B in the Phase I formulation were measured by obtaining the weight percent monomer and soluble reversible higher-order species using static light scattering. Static light scattering intensity in volts was measured as a function of concentration (mg / mL) and converted to apparent molecular weight (kDa) using the Rayleigh equation. The weight fractions of monomer and soluble reversible higher-order species were extracted from the measured apparent molecular weight using an efficient hard-particle model (Fernandez and Minton (2009) Biophys J [Journal of Biophysics] 96: 1992-8).

[0198] Table 1 shows the reversible self-association of the aqueous phase I compositions:

[0199]

[0200] Next, the concentration of 33_640087-7B was increased threefold to 150 mg / ml, and the viscosity was measured at 23°C. The viscosity was determined to be approximately 24 centipoise.

[0201] Next, we attempted to reformulate 33_640087-7B. Unexpectedly, changing the excipient dosage in the composition yielded a formulation with improved RSA properties compared to the formulation from Phase 1.

[0202] Table 2 shows the reversible self-association characteristics of the aqueous Phase I composition and the next-generation composition.

[0203]

[0204] The reduction in RSA resulted in a significant improvement in viscosity (approximately 9 cP) measured at 23°C compared to the viscosity (approximately 24 cP) of the Phase 1 composition containing an equivalent antibody concentration. Notably, this improvement was observed at three times the protein concentration.

[0205] The RSA characteristics were also found to be long-term stable. After storage at 2°C to 8°C for 6 months, the percentage distribution of soluble higher-order species did not change significantly. RSA stability was observed in next-generation compositions at multiple antibody concentrations. Figure 3 ).

[0206] Table 3 shows the weight % distribution of monomers, trimers, and hexamers (i.e., soluble higher-order species) over time.

[0207] Sample Description % by weight of monomer % trimer by weight % hexamer by weight T＝0 44 36 20 3 months at 2℃-8℃ 40 43 17 6 months at 2℃-8℃ 41 40 19

[0208] The long-term stability of next-generation compositions was tested at multiple time points and temperatures. Stability data were generated for compositions stored in glass vials or pre-filled syringes.

[0209] Table 4 shows the long-term stability characteristics as a function of insoluble aggregate formation, expressed as a percentage of the original antibody concentration (approximately 150 mg / ml).

[0210]

[0211] Figure 2 , 3 Figure 4 shows the data graphically.

[0212] Next, univariate analysis of viscosity (Cp) was performed at multiple 33-640087_7B and arginine concentrations (with the remaining formulation components fixed).

[0213] The results are shown in Figure 5 In the study, at multiple high arginine concentrations (150 mM, 190 mM, 220 mM, and 250 mM), the Cp at 25°C was significantly lower than the Cp calculated for the Phase 1 formulation at 23°C (24 Cp). The Cp at 5°C improved with increasing arginine concentration.

[0214] Cp was also tested at multiple protein concentrations (135 mg / ml, 150 mg / ml, and 165 mg / ml). Results are shown in... Figure 6Cp was measured at multiple temperatures (5°C, 18°C, 25°C, and 30°C). Analysis showed that even at high protein concentrations, Cp decreased with increasing arginine concentration, particularly at temperatures above 18°C. Typically, when using at least 190 mM arginine, the viscosity at approximately 25°C is equal to or lower than the desired 10 Cp value when the formulation contains 165 mg / ml 33-640087_7B.

[0215] The stability of formulation 33-640087_7B was also analyzed at several temperatures, pH values, arginine concentrations, and excipient concentrations. The formulation was stored at 40°C, 25°C, or 2°C–8°C for 1 month, 6 months, or 11 months, respectively. Samples were collected at multiple time points under each condition, and aggregate formation was determined using standard analytical techniques. The percentage of aggregate formation was calculated for each month. The slope gradients of the resulting curves are shown in Table 5. The results indicate that the aggregation rate is stable within the specified pH, surfactant, or arginine concentration range under the test conditions. A slight increase in the aggregation rate was observed at pH 5.0 under the accelerated stability conditions (40°C) after one month.

[0216] Table 5

[0217]

[0218] Several other formulations were tested. Of particular interest were formulations containing 20 mM histidine / histidine-HCl, 170 mM lysine-HCl, 0.02% PS80, pH 5.5, and approximately 160 mg / ml 33-640087_7B, which also showed a significant improvement in Cp (8.7 Cp) at 23 °C. Analysis of the Cp of formulations containing 150 mg / ml 33-640087_7B and 150 mM or 190 mM lysine (and 20 mM histidine / histidine-HCl, 0.02% PS80, pH 5.5) at 23 °C also showed a significant improvement in viscosity compared to the Cp of the Phase 1 formulations, i.e., Cp < 10.

[0219] in conclusion

[0220] A new generation of formulations has been developed that results in a surprising reduction in RSA at high antibody concentrations. This next-generation formulation allows for the administration of larger unit doses of anti-IL-33 antibody per volume, enabling the delivery of larger therapeutic doses. This can reduce patient discomfort by decreasing the volume of drug product delivered to the injection site, for example, improving patient compliance for subcutaneous delivery. It also makes it possible to explore a larger dynamic dosing range in the clinic, increasing the prospect of discovering the most therapeutically effective dose.

[0221] Furthermore, this formulation exhibits an acceptable long-term stability profile and reduced viscosity. Lower viscosity can positively impact drug administration by increasing the functionality of the device used to administer the antibody. Similarly, lower viscosity improves the ability of healthcare providers or patients to manually inject the drug into the patient's body.

[0222] sequence

[0223] SEQ ID NO 1:33 _ 640087-7B VH CDR1

[0224] Ser Tyr AlaMet Ser

[0225] SEQ ID NO 2: 33_640087-7B VH CDR2

[0226] Gly Ile Ser Ala Ile Asp Gln Ser Thr Tyr Tyr Tyr Ala Asp Ser Val Lys Gly

[0227] SEQ ID NO 3: 33_640087-7B VH CDR3

[0228] Gln Lys Phe Met Gln Leu Trp Gly Gly Gly Leu Arg Tyr Pro Phe Gly Tyr

[0229] SEQ ID NO 4: 33_640087-7B VH

[0230] Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

[0231] Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

[0232] Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

[0233] Ser Gly Ile Ser Ala Ile Asp Gln Ser Thr Tyr Tyr Tyr Ala Asp Ser Val

[0234] Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

[0235] Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

[0236] Ala Arg Gln Lys Phe Met Gln Leu Trp Gly Gly Gly Leu Arg Tyr Pro

[0237] Phe Gly Tyr Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser

[0238] SEQ ID NO: 5 33 _ 640087-7B VL CDR1

[0239] Ser Gly Glu Gly Met Gly Asp Lys Tyr Ala Ala

[0240] SEQ ID NO 6: 33_640087-7B VL CDR2

[0241] Arg Asp Thr Lys Arg Pro Ser

[0242] SEQ ID NO 7: 33_640087-7B VL CDR3

[0243] Gly Val Ile Gln Asp Asn Thr Gly Val

[0244] SEQ ID NO 8:33 _ 640087-7B VL

[0245] Ser Tyr Val Leu Thr Gln Pro Pro Ser Val Ser Val Ser Pro Gly Gln

[0246] Thr Ala Ser Ile Thr Cys Ser Gly Glu Gly Met Gly Asp Lys Tyr Ala

[0247] Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Val Leu Val Ile Tyr

[0248] Arg Asp Thr Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser

[0249] Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Thr Gln Ala Met

[0250] Asp Glu Ala Asp Tyr Tyr Cys Gly Val Ile Gln Asp Asn Thr Gly Val

[0251] Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

[0252] SEQ ID NO 9: 33_640087-7B HC

[0253] Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

[0254] Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

[0255] Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

[0256] Ser Gly Ile Ser Ala Ile Asp Gln Ser Thr Tvr Tyr Ala Asp Ser Val

[0257] Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

[0258] Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

[0259] Ala Arg Gln Lys Phe Met Gln Leu Trp Gly Gly Gly Leu Arg Tyr Pro

[0260] Phe Gly Tyr Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser Ala Ser

[0261] Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr

[0262] Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro

[0263] Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val

[0264] His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tvr Ser Leu Ser

[0265] Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile

[0266] Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val

[0267] Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala

[0268] Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro

[0269] Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val

[0270] Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val

[0271] Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln

[0272] Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln

[0273] Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala

[0274] Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lvs Gly Gln Pro

[0275] Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr

[0276] Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser

[0277] Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr

[0278] Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr

[0279] Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe

[0280] Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys

[0281] Ser Leu Ser Leu Ser Pro Gly Lys

[0282] SEQ ID NO 10：33 _ 640087-7B LC

[0283] Ser Tyr Val Leu Thr Gln Pro Pro Ser Val Ser Val Ser Pro Gly Gln

[0284] Thr Ala Ser Ile Thr Cys Ser Gly Glu Gly Met Gly Asp Lys Tyr Ala

[0285] Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Val Leu Val Ile Tyr

[0286] Arg Asp Thr Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser

[0287] Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Thr Gln Ala Met

[0288] Asp Glu Ala Asp Tyr Tyr Cys Gly Val Ile Gln Asp Asn Thr Gly Val

[0289] Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Gln Pro Lys Ala Ala

[0290] Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu Glu Leu Gln Ala Asn

[0291] Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe Tyr Pro Gly Ala Val

[0292] Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val Lys Ala Gly Val Glu

[0293] Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn Lys Tyr Ala Ala Ser Ser

[0294] Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser His Arg Ser Tyr Ser

[0295] Cys Gln Val Thr His Glu Gly Ser Thr Val Glu Lys Thr Val Ala Pro

[0296] Thr Glu Cys Ser

[0297] SEQ ID NO 11:33 _ 640087-7B VH DNA

[0298] gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggc cctgagactc

[0299] tcctgtgcag cctctggatt cacctttagc agctatgcca tgagctgggt ccgccaggct

[0300] ccagggaagg ggctggagtg ggtctcaggc atttctgcaa tagaccaaag cacatactac

[0301] gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat

[0302] ctgcaaatga acagcctgag agccgaggac acggccgtgt attactgtgc ccggcagaag

[0303] ttcatgcagc tatggggggg gggcttgcgttatcccttcg gctactgggg ccaggggaca

[0304] atggtcaccg tctcctca

[0305] SEQ ID NO 12:33 _ 640087-7B VL DNA

[0306] tcctatgtgc tgactcagcc accctcagtg tccgtgtccc caggacagac ggccagcatc

[0307] acctgctctg gagaaggaat gggggataaa tatgctgcct ggtatcagca gaagccaggc

[0308] cagtcacctg tgctggtcat ctatcgagat acaaagcggc cctcagggat ccctgagcga

[0309] ttctctggct ccaactctgg gaacacagcc acgttgacca tcagcgggac ccaggctatg

[0310] gatgaggctg actattactg tggggtgatc caggacaaca ctggggtatt cggcggaggg

[0311] accaagctca ccgtccta sequence list <110> MEDIMMUNE LTD. <120> Preparations of anti-IL-33 antibodies <130> IL33-300-WO-PCT <160> 12 <170> PatentIn version 3.5 <210> 1 <211> 5 <212> PRT <213> Artificial sequence <220> <223> VH CDR1 <400> 1 Ser Tyr Ala Met Ser 1 5 <210> 2 <211> 17 <212> PRT <213> Artificial sequence <220> <223> VH CDR2 <400> 2 Gly Ile Ser Ala Ile Asp Gln Ser Thr Tyr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 3 <211> 17 <212> PRT <213> artificial sequence <220> <223> VH CDR3 <400> 3 Gln Lys Phe Met Gln Leu Trp Gly Gly Gly Leu Arg Tyr Pro Phe Gly 1 5 10 15 Taurus <210> 4 <211> 126 <212> PRT <213> artificial sequence <220> <223> VH <400> 4 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Ala Ile Asp Gln Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gln Lys Phe Met Gln Leu Trp Gly Gly Gly Leu Arg Tyr Pro 100 105 110 Phe Gly Tyr Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser 115 120 125 <210> 5 <211> 11 <212> PRT <213> Artificial sequence <220> <223> VL CDR1 <400> 5 Ser Gly Glu Gly Met Gly Asp Lys Tyr Ala Ala 1 5 10 <210> 6 <211> 7 <212> PRT <213> Artificial sequence <220> <223> VL CDR2 <400> 6 Arg Asp Thr Lys Arg Pro Ser 1 5 <210> 7 <211> 9 <212> PRT <213> Artificial sequence <220> <223> VL CDR 3 <400> 7 Gly Val Ile Gln Asp Asn Thr Gly Val 1 5 <210> 8 <211> 106 <212> PRT <213> Artificial sequence <220> <223> VL <400> 8 Ser Tyr Val Leu Thr Gln Pro Pro Ser Val Ser Val Ser Pro Gly Gln 1 5 10 15 Thr Ala Ser Ile Thr Cys Ser Gly Glu Gly Met Gly Asp Lys Tyr Ala 20 25 30 Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Val Leu Val Ile Tyr 35 40 45 Arg Asp Thr Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 50 55 60 Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Thr Gln Ala Met 65 70 75 80 Asp Glu Ala Asp Tyr Tyr Cys Gly Val Ile Gln Asp Asn Thr Gly Val 85 90 95 Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 <210> 9 <211> 456 <212> PRT <213> Artificial Sequence <220> <223> HC <400> 9 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Ala Ile Asp Gln Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gln Lys Phe Met Gln Leu Trp Gly Gly Gly Leu Arg Tyr Pro 100 105 110 Phe Gly Tyr Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser Ala Ser 115 120 125 Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr 130 135 140 Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro 145 150 155 160 Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val 165 170 175 His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser 180 185 190 Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile 195 200 205 Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val 210 215 220 Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala 225 230 235 240 Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro 245 250 255 Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val 260 265 270 Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val 275 280 285 Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln 290 295 300 Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln 305 310 315 320 Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala 325 330 335 Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro 340 345 350 Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr 355 360 365 Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 370 375 380 Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr 385 390 395 400 Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 405 410 415 Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe 420 425 430 Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys 435 440 445 Ser Leu Ser Leu Ser Pro Gly Lys 450 455 <210> 10 <211> 212 <212> PRT <213> Artificial Sequence <220> <223> LC <400> 10 Ser Tyr Val Leu Thr Gln Pro Pro Ser Val Ser Val Ser Pro Gly Gln 1 5 10 15 Thr Ala Ser Ile Thr Cys Ser Gly Glu Gly Met Gly Asp Lys Tyr Ala 20 25 30 Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Val Leu Val Ile Tyr 35 40 45 Arg Asp Thr Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 50 55 60 Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Thr Gln Ala Met 65 70 75 80 Asp Glu Ala Asp Tyr Tyr Cys Gly Val Ile Gln Asp Asn Thr Gly Val 85 90 95 Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Gln Pro Lys Ala Ala 100 105 110 Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu Glu Leu Gln Ala Asn 115 120 125 Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe Tyr Pro Gly Ala Val 130 135 140 Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val Lys Ala Gly Val Glu 145 150 155 160 Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn Lys Tyr Ala Ala Ser Ser 165 170 175 Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser His Arg Ser Tyr Ser 180 185 190 Cys Gln Val Thr His Glu Gly Ser Thr Val Glu Lys Thr Val Ala Pro 195 200 205 Thr Glu Cys Ser 210 <210> 11 <211> 378 <212> DNA <213> Artificial sequence <220> <223> Polynucleotides encoding VH <400> 11 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttagc agctatgcca tgagctgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcaggc atttctgcaa tagaccaaag cacatactac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgag agccgaggac acggccgtgt attackgtgc ccggcagaag 300 ttcatgcagc tatgggggggg gggcttgcgt tatcccttcg gctactgggg ccaggggaca 360 atggtcaccg tctcctca 378 <210> 12 <211> 318 <212> DNA <213> Artificial sequence <220> <223> Polynucleotides encoding VL <400> 12 tcctatgtgc tgactcagcc accctcagtg tccgtgtccc caggacagac ggccagcatc 60 acctgctctg gagaaggaat gggggataaa tatgctgcct ggtatcagca gaagccaggc 120 cagtcacctg tgctggtcat ctatcgagat acaaagcggc cctcagggat ccctgagcga 180 ttctctggct ccaactctgg gaacacagcc acgttgacca tcagcgggac ccaggctatg 240 gatgaggctg actattactg tggggtgatc caggacaaca ctggggtatt cggcggaggg 300 accaagctca ccgtccta 318

Claims

1. A composition comprising 130 mg / ml to 170 mg / ml of an anti-IL-33 antibody, 190 mM to 250 mM of arginine, a surfactant, and a buffer, wherein the surfactant is polysorbate 80 at a concentration of 0.02% (w / v) to 0.05% (w / v), wherein the buffer is L-histidine / L-histidine hydrochloride at a concentration of 10 mM to 30 mM, wherein the pH is pH 5.0 to pH 6.0, wherein the anti-IL-33 antibody has a heavy chain as shown in the amino acid sequence of SEQ ID NO: 9 and a light chain as shown in the amino acid sequence of SEQ ID NO:

10.

2. The composition of claim 1, wherein the anti-IL-33 antibody is present at a concentration of 150 mg / ml ± 10%.

3. The composition of claim 1 or claim 2, wherein the composition comprises 0.03% (w / v) ± 0.010% ( w / v Surfactants.

4. The composition of claim 1 or claim 2, wherein the composition comprises 220 mM arginine.

5. The composition of claim 1 or claim 2, wherein the arginine is L-arginine hydrochloride.

6. The composition of claim 1 or claim 2, wherein the concentration of the buffer solution is from 16 mM to 24 mM.

7. The composition of claim 1 or claim 2, wherein the concentration of the buffer solution is from 17 mM to 24 mM.

8. The composition of claim 1 or claim 2, wherein the concentration of the buffer solution is from 18 mM to 24 mM.

9. The composition of claim 1 or claim 2, wherein the concentration of the buffer solution is 19 mM to 21 mM.

10. The composition of claim 1 or claim 2, wherein it is a liquid.

11. The composition of claim 1 or claim 2, wherein the pH is pH 5.

5.

12. The composition of claim 10, wherein the viscosity is 5 cP to 10 cP.

13. The composition of claim 1 or claim 2, wherein the composition comprises 35% to 50% by weight of monomer.

14. The composition of claim 1 or claim 2, wherein after storage at 2°C to 8°C for 12 to 18 months, less than 5% of the antibody aggregates, as measured by size exclusion chromatography (SEC).

15. The composition of claim 1 or claim 2, comprising 150 mg / ml of the anti-IL-33 antibody, 20 mM M His-HCl, 220 mM Arg-HCl, and 0.03% (w / v) polysorbate 80, wherein the pH is pH 5.

5.

16. A composition comprising: 130 mg / ml to 170 mg / ml 33_640087-7B, 0.03% (w / v) ± 0.015% polysorbate 80, 220 mM arginine, and 16 mM to 24 mM buffer, wherein the buffer is L-histidine / L-histidine hydrochloride, and the pH is pH 5.5 ± 0.

5. Among them, 33_640087-7B is an anti-IL-33 antibody having the heavy chain shown in the amino acid sequence of SEQ ID NO: 9 and the light chain shown in the amino acid sequence of SEQ ID NO:

10.

17. The composition of claim 16, wherein the composition comprises 150 mg / ml 33_640087-7B.

18. The composition of claim 16 or 17, wherein the composition comprises 18 mM to 22 mM buffer.

19. The composition of claim 16 or claim 17, wherein it is a liquid.

20. The composition of claim 16, comprising 150 mg / ml 33_640087-7B, 20 mM His / His-HCl, 220 mM Arg-HCl, and 0.03% (w / v) polysorbate 80, wherein the pH is pH 5.

5.

21. An article comprising the composition as described in any one of claims 1 to 20, comprising 1 ml to 3 ml of the composition.

22. A vial containing the composition as described in any one of claims 1 to 20, comprising 1 ml to 3 ml of the composition.

Images