High-expression nicotine NtPMT1 promoter, its expression vector and application

Abstract

The present invention discloses a high-expression nicotine NtPMT1 promoter, an expression vector and an application thereof, aiming to solve the technical problem that the efficiency of nicotine biosynthesis in tobacco is difficult to improve. PMT1 The promoter contains the G-box element sequence "ATGCACGTTGTAAT", which realizes the molecular regulation of tobacco nicotine biosynthesis. The relevant plant expression vectors and recombinant plasmids were modified and designed and applied to tobacco transformation, which can significantly improve the biosynthesis of tobacco nicotine.

Description

Technical Field

[0001] The present invention relates to the technical field of biological genetic engineering, and particularly relates to a highly expressed nicotine NtPMT1 promoter, its expression vector and application. Background Art

[0002] Nicotin, also known as nicotine, is an organic compound with the chemical formula C 10 H 14 N 2 , and its chemical name is 1-methyl-2-(2-pyridyl)pyrrolidine. It is an alkaloid naturally present in solanaceous plants. Nicotin can have a certain physiological stimulating effect on humans and is one of the main factors that make tobacco commercially valuable.

[0003] With the in-depth understanding of the biological activity of nicotin, nicotin has been extended to many application fields such as food, health care, medicine, and daily chemical industry. For example, a large amount of nicotin raw materials are needed in the production of tobacco substitutes (nicotin patches, chewing gums, nasal sprays, inhalants, and nAChR inhibitor drugs such as bupropion, varenicline tartrate, mecamylamine, nortriptyline, clonidine, and anti-anxiety drugs, etc.); nicotin is also widely used in the production of nicotin series pesticides in environmentally friendly and efficient pesticides, which belong to plant insecticides; in the field of the pharmaceutical industry, nicotin is a special raw material for the research and production of drugs for treating cardiovascular diseases, skin diseases, snake venom, etc.; nicotin can also be used to prepare nicotin citrate for use in components such as improvers for high-grade cigarettes. Currently, with the rapid development of the tobacco industry, fine chemicals, pharmaceuticals, organic synthesis, pesticides, etc., the market demand for nicotin raw materials is increasing day by day, especially the demand for high-purity nicotin is even greater. However, the current acquisition method relying on the biosynthesis of nicotin in tobacco is difficult to meet the demand.

[0004] Research has found that the proteins involved in the biosynthesis of nicotin in tobacco plants include ornithine decarboxylase (ODC), quinolinic acid synthase (QS), aspartate oxidase (AO), quinolinic acid phosphoribosyltransferase (QPT), putrescine N-methyltransferase (PMT), diamine oxidase (DAO), etc. The genes encoding these proteins exist in N. sylvestris ; among them, PMT (putrescine N-methyltransferase) is the rate-limiting enzyme in the biosynthesis of nicotin, and it is encoded by three genes (PMT1, PMT2, PMT3). Therefore, how to start from the rate-limiting factors of nicotin biosynthesis in tobacco to increase the biosynthesis amount of tobacco nicotin is an important topic worthy of exploration.

[0005] The information disclosed in this background art section is only used to deepen the understanding of the background art of the present disclosure, and should not be regarded as an admission or any form of suggestion that this information constitutes the prior art known to those skilled in the art. Summary of the Invention

[0006] The G-Box element with the highly conserved core sequence CACGTT is generally considered to be a regulatory element for plants to respond to external environmental stimuli and a light-responsive element for light-controlled genes. However, through research, the inventors found that doubling the sequence "ATGCACGTTGTAAT" containing the G-box (CACGTT) element on the promoter of tobacco PMT1 can positively regulate the biosynthesis of nicotine in tobacco.

[0007] According to one aspect of the present disclosure, there is provided a nicotine-high-expressing NtPMT1 promoter, the nucleotide sequence of which is:

[0008] (1) as shown in SEQ ID NO.1; or

[0009] (2) on the basis of the nucleotide sequence shown in SEQ ID NO.1, doubling the sequence ATGCACGTTGTAAT containing the G-box element.

[0010] In some embodiments of the present disclosure, the doubling multiple is 2-10.

[0011] In some embodiments of the present disclosure, the nucleotide sequence of the nicotine-high-expressing NtPMT1 promoter is as shown in SEQ ID NO.2 or SEQ ID NO.3.

[0012] According to another aspect of the present disclosure, there is provided a plant expression vector containing the above-mentioned nicotine-high-expressing NtPMT1 promoter.

[0013] According to another aspect of the present disclosure, there is provided a recombinant plasmid containing the above-mentioned nicotine-high-expressing NtPMT1 promoter.

[0014] In some embodiments of the present disclosure, the application of the above-mentioned nicotine-high-expressing NtPMT1 promoter, the plant expression vector or the recombinant plasmid in the regulation of nicotine biosynthesis in tobacco is disclosed.

[0015] According to another aspect of the present disclosure, there is provided a method for cultivating nicotine-high-expressing tobacco plants, including the following steps:

[0016] (1) Synthesize the above-mentioned nicotine-high-expressing NtPMT1 promoter and insert it into the multiple cloning site of the pCAMBIA-NPT- GUS vector to obtain a plant expression vector;

[0017] (2) Using tobacco cDNA as a template, design primers to amplify the NtPMT1 gene CDS sequence;

[0018] (3) Use Spe I and BstE II to double-digest the plant expression vector obtained in step (1), and ligate the NtPMT1 gene amplified in step (2) to the NtPMT1 - GUS sites of the Spe I and BstE II of the vector, replacing the original GUS gene to obtain a recombinant plasmid;

[0019] (4) Transform the recombinant plasmid obtained in the previous step into tobacco seedling leaves by the Agrobacterium-mediated transformation method, and screen on MS medium containing kanamycin to obtain T0 generation transgenic tobacco.

[0020] According to another aspect of the present disclosure, there is provided a method for regulating tobacco nicotine biosynthesis, which doubles the sequence "ATGCACGTTGTAAT" containing the G-box element on the PMT1 promoter of tobacco.

[0021] One or more technical solutions provided in the embodiments of the present application have at least the following technical effects or advantages:

[0022] 1. For the first time, the upstream promoter sequence of the PMT1 gene was isolated and improved. The provided promoter sequence can drive the GUS gene to express in tobacco and can be used as an expression element for plant genetic transformation to express foreign genes and for tobacco bioreactors.

[0023] 2. The provided promoter can specifically express in tobacco. This promoter can highly initiate the expression of the downstream PMT1 gene, thereby enhancing the biosynthesis of nicotine. This is beneficial to the research on the large-scale production of nicotine using tobacco and is of great significance for obtaining nicotine raw materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the PCR amplification electrophoresis diagram of the PMT1 promoter in an embodiment of the present application, where NtPMT1 uses N.tabacum K326 as a template; NsPMT1 uses Nicotiana sylvestris N.sylvestris as a template.

[0025] Figure 2 This is the PCR of the tobacco nicotine promoter vector plasmid and SpeⅠ and SacⅡ double-digestion verification electrophoresis diagram in an embodiment of the present application. Among them, 1: double-digestion of pCAMBIA-NPT- NtPMT1 -1N-Pro-GUS; 2: pCAMBIA-NPT- NtPMT1- Double digestion with 4N-Pro-GUS; 3: pCAMBIA-NPT- NtPMT1 - Double digestion with 10N-Pro-GUS; M2: 10000 bp DNA Maker.

[0026] Figure 3 This is the electrophoresis diagram of plasmid PCR identification after Agrobacterium transformation with the recombinant expression vector in an embodiment of this application. Among them, A: Plasmid PCR identification after Agrobacterium transformation with pCAMBIA-NPT-NtPMT1-1N-Pro:GUS; among them, M: Maker, 1: 1N-GUS strain; B: Plasmid PCR identification after Agrobacterium transformation with pCAMBIA-NPT-NtPMT1-4N-Pro:GUS; among them, M: Maker 1: 4N-GUS strain; C: Plasmid PCR identification after Agrobacterium transformation with pCAMBIA-NPT-NtPMT1-10N-Pro:GUS; among them, M: Maker, 1: 10N-GUS strain.

[0027] Figure 4 This is pC-NPT- in an embodiment of this application NtPMT1 -1N-Pro:GUS, pC-NPT- NtPMT1 -4N-Pro:GUS, pC-NPT- NtPMT1 Genetic transformation diagram of tobacco transformed with pC-NPT-1N-Pro:GUS, pC-NPT-4N-Pro:GUS, pC-NPT-10N-Pro:GUS; among them, A is the negative control, the untransformed tobacco leaf; B is the positive control, the differentiation of the untransformed tobacco leaf; C is the differentiation of the transgenic tobacco; D is the rooting of the transgenic tobacco.

[0028] Figure 5 This is the PCR identification diagram of transgenic tobacco in an embodiment of this application. Among them, M: Maker; positive: positive control; negative: negative control; 1-3: Transformed with pCAMBIA-NPT-PMT1-1N-Pro-PMT1; 4-6: Transformed with pCAMBIA-NPT-PMT1-4N-Pro-PMT1; 7-8: Transformed with pCAMBIA-NPT-PMT1-10N-Pro-PMT1.

[0029] Figure 6 This is the GUS staining diagram of transgenic tobacco leaves in an embodiment of this application. Among them, A is the negative control, the staining diagram of the untransformed tobacco leaf; B, E are the positive controls, the staining diagrams of pC-NPT-1N-Pro:GUS transgenic tobacco leaves; C, F are the positive controls, the staining diagrams of pC-NPT-4N-Pro:GUS transgenic tobacco leaves; D, G are the positive controls, the staining diagrams of pC-NPT-10N-Pro:GUS transgenic tobacco leaves.

[0030] Figure 7In one embodiment of the present application, pC-NPT- NtPMT1 -10N-Pro:GUS transgenic tobacco T0 generation seedling GUS expression level analysis chart, where 1N: pC-NPT- NtPMT1 -1N-Pro:GUS; 4N: pC-NPT- NtPMT1 -4N-Pro:GUS; 10N: pC-NPT- NtPMT1 -10N-Pro:GUS.

[0031] Figure 8 In one embodiment of the present application NtPMT1 PCR amplification of gene CDS and PCR identification of ligation to T vector chart, where A is NtPMT1 PCR amplification of mRNA; B is PMT1 Colony PCR identification of gene T vector ligation; in the figure, M: Marker; positive: positive control; negative: negative control 1: NtPMT1 Gene amplification; 2-7: T vector ligation colonies.

[0032] Figure 9 In one embodiment of the present application NtPMT1 Schematic diagram of gene expression vector construction.

[0033] Figure 10 In one embodiment of the present application, the NtPMT1 Gene vector PCR verification chart, where M: Maker; 1: pCAMBIA-NPT- NtPMT1 -1N-Pro- PMT1 vector; 2: pCAMBIA-NPT- NtPMT1 -4N-Pro- PMT1 vector; 3: pCAMBIA-NPT- NtPMT1 -10N-Pro- PMT1 vector.

[0034] Figure 11 In one embodiment of the present application NtPMT1 Gene tobacco genetic transformation plant photo, where A and F: positive control; B and G: negative control; C-E: Differentiation of transgenic tobacco K326; H-J: Differentiation of transgenic tobacco NC89; K-M: Rooting culture of transgenic plants.

[0035] Figure 12 In one embodiment of the present application, the NtPMT1 Gene plant DNA identification chart, where M: Maker; positive: positive control; negative: negative control; 1-3: Transgenic pCAMBIA-NPT- NtPMT1 -1N-Pro- PMT1 ; 4-6: Transgenic pCAMBIA-NPT-NtPMT1 -4N-Pro- PMT1 ; 7 - 9: Transformed pCAMBIA-NPT- NtPMT1 -10N-Pro- PMT1 。

[0036] Figure 13 This is the comparison chart of nicotine content in transgenic tobacco at 40 days after transplanting in an embodiment of this application. Among them, WT1 and WT2: non-transgenic controls; 1N8, 1N13, 1N17: transgenic pCAMBIA-NPT- NtPMT1 -1N-Pro- PMT1 -1N-Pro- PMT1 tobacco; 4N12, 4N13, 4N20: transgenic pCAMBIA-NPT- PMT1 -4N-Pro- PMT1 tobacco; 10N2, 10N15, 10N23: transgenic pCAMBIA-NPT- PMT1 -10N-Pro- PMT1 tobacco.

[0037] Figure 14 This is the comparison chart of organ expression analysis of nicotine synthesis-related genes in transgenic tobacco in an embodiment of this application. Among them, WT1 and WT2: non-transgenic controls; 1N8, 1N13: transgenic pCAMBIA-NPT- PMT1 -1N-Pro- PMT1 -1N-Pro- PMT1 tobacco; 4N12, 4N20: transgenic pCAMBIA-NPT- PMT1 -4N-Pro- PMT1 tobacco; 10N2, 10N21: transgenic pCAMBIA-NPT- PMT1 -10N-Pro- PMT1 tobacco; *: significant difference; **: extremely significant difference.

[0038] Figure 15 This is the comparison chart of nicotine synthesis gene expression in transgenic tobacco in an embodiment of this application. Among them, WT1 and WT2: non-transgenic controls; 1N8, 1N13: transgenic pCAMBIA-NPT- NtPMT1 -1N-Pro- NtPMT1 -1N-Pro- PMT1 tobacco; 4N12, 4N20: transgenic pCAMBIA-NPT- NtPMT1 -4N-Pro- PMT1 tobacco; 10N2, 10N21: transgenic pCAMBIA-NPT- NtPMT1 -10N-Pro- PMT1 tobacco; *: significant difference; **: extremely significant difference. Detailed implementation manners

[0039] In the experimental methods described in the embodiments of the present invention, unless otherwise specified, they are all conventional methods; those skilled in the art should understand that the reagents, enzymes, vectors, etc. used in the following embodiments are all analytical pure reagents, enzymes, or vectors that can be commercially purchased from reagent companies, unless otherwise specified. The materials, methods, and examples are for illustration purposes only and are not intended to be limiting.

[0040] To better understand the technical solutions of the present application, the above technical solutions will be described in detail below in conjunction with the accompanying drawings of the specification and specific embodiments.

[0041] Example 1 This example discloses the isolation and sequence improvement of a tobacco nicotine promoter gene, including the following steps:

[0042] (1) Preparation of tobacco genomic DNA

[0043] Collect tobacco N. tabacum K326 planted in the greenhouse for two months, take its young leaves, extract genomic DNA by the CTAB method, and store it at -20 °C after detection by agarose gel electrophoresis.

[0044] (2) Nicotine NtPMT1 Cloning and sequence analysis of the promoter

[0045] Using tobacco genomic DNA as a template, perform PCR amplification with the PMT1-Pro upstream primer (CGGCGCGCCAAGCTTATTTTTTATTAAATACTATC) and the downstream primer (TACAGCCATGAATTCGATATGACTTCCATTTTC).

[0046] The PCR reaction conditions are: pre-denaturation at 94 °C for 10 min, denaturation at 94 °C for 30 s, annealing at 55 °C for 45 s, extension at 72 °C for 45 min, a total of 30 cycles, and storage at 4 °C.

[0047] Connect the obtained PCR product to the commercially available pCAMBIA-NPT-GUS vector and replace the existing 35S promoter in the vector to obtain the recombinant plasmid pCAMBIA-NPT- Nt PMT1-Pro:GUS. Perform plasmid PCR detection, and see the PCR amplification electrophoresis diagram in Figure 1 .

[0048] Then, combined with long-term practical research and using the PLACE software (http: / / www.dna.affrc.go.jp / PLACE / ) to predict and analyze the cis-acting elements in the promoter sequence, it was found that in addition to the basic conserved elements TATA-box and CAAT-box of eukaryotic promoters, this promoter also contains plant hormone response elements such as MeJA and gibberellin, as well as elements such as G-Box (as shown in Table 1).

[0049] Table 1 Cis-acting elements and predicted functions in the promoter sequence of promoter PMT1

[0050] 。

[0051] (3) Sequence design of nicotinic PMT1-1N, PMT1-4N, and PMT1-10N promoters

[0052] Specifically, the sequence "ATGCACGTTGTAAT" containing the G-box (CACGTT) element on the promoter was doubled, and three PMT1 promoters containing 1, 4, and 10 G-box sequences were designed for sequence synthesis, and named PMT1-1N, PMT1-4N, and PMT1-10N promoters, and their sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 respectively.

[0053] Example 2 This example discloses a method for constructing a plant expression vector, including the following steps:

[0054] Digest the pCAMBIA-NPT-GUS vector with EcoRI / HindIII enzymes and recover the large fragment for later use.

[0055] Hand over the PMT1-1N, PMT1-4N, and PMT1-10N promoters designed in Example 1 to a gene company for synthesis, and ligate the target fragment into the digested pCAMBIA-NPT-GUS. In a 10 μl system, the target fragment and the vector fragment are directionally ligated with T4 ligase to obtain a recombinant plasmid, and positive recombinants are determined by PCR identification and double digestion identification ( Figure 2 ) Thus, each promoter in this example is fused with GUS genes to obtain plant recombinant expression vectors pCAMBIA-NPT- GUS -1N-Pro:GUS, pCAMBIA-NPT- NtPMT1 -4N-Pro:GUS, and pCAMBIA-NPT- NtPMT1 -10N-Pro:GUS. NtPMT1 -10N-Pro:GUS.

[0056] Example 3. This example discloses a method for identifying the activity of a tobacco promoter, which includes the following steps:

[0057] (1) Agrobacterium-mediated plant transformation

[0058] Each plant recombinant expression vector pCAMBIA-NPT- GUS -1N-Pro:GUS, pCAMBIA-NPT- NtPMT1 -4N-Pro:GUS, and pCAMBIA-NPT- NtPMT1 -10N-Pro:GUS constructed in Example 2 was separately transformed into Agrobacterium tumefaciens LBA4404. The transformed Agrobacterium was cultured, and the plasmid was extracted for PCR identification (see NtPMT1 ), and then it was determined that the plasmid had been transferred into Agrobacterium. Figure 3

[0059] Tobacco seeds were taken, disinfected with alcohol and sodium hypochlorite, and then sown on MS medium. When the tobacco seedlings grew to 5 - 8 leaves, the tobacco leaves were cut and placed into the Agrobacterium bacterial solution transformed with the plasmid for infection.

[0060] The specific operation was as follows: The above Agrobacterium was cultured in an incubator at 28°C. When OD 600 = 0.8, 20 mg / L of AS (acetosyringone) was added. The cut tobacco leaves were placed into the Agrobacterium bacterial solution for 8 minutes of infection. After the infected leaves were blotted to remove excess bacterial solution, they were placed on the medium for culture and screening. After screening on MS medium containing kanamycin (the pCAMBIA-NPT- Nt PMT1-Pro:GUS vector carried kanamycin resistance), the T0 generation of transgenic tobacco was obtained. See Figure 4 .

[0061] When the transgenic tobacco leaves grew to about 6 leaves, the DNA of the T0 generation of tobacco leaves was extracted, and PCR identification was performed using the PMT1-Pro upstream primer (CGGCGCGCCAAGCTTATTTTTTATTAAATACTATC) and GUS the downstream primer (TGTTCGGCGTGGTGTAGAGCA). If a PCR amplification product of about 1300 bp was shown (see Figure 5 ), the plant was a PMT1-10N-Pro transgenic plant. The PCR reaction conditions were: pre-denaturation at 94°C for 10 min, denaturation at 94°C for 30 s, annealing at 58°C for 45 s, extension at 72°C for 45 s, for a total of 30 cycles, and stored at 4°C.

[0062] (2) Analysis of expression activity of transgenic plants GUS ​

[0063] GUS buffer: It is composed of a solvent and solutes. The solvent is a 50 mmol / L sodium hydrogen phosphate buffer at pH 7.0. Solutes and their concentrations: 10 mmol / L EDTA, 0.1% Triton X-100 (by volume), 2 mmol / L potassium ferricyanide, and 2 mmol / L potassium ferrocyanide; store for later use at 4 °C. GUS staining solution: Dissolve X-Gluc powder with N,N-dimethylformamide to prepare a 20 mmol / L solution, and store for later use at -20 °C.

[0064] Take the leaves of the T0 generation of transgenic tobacco for GUS histochemical staining. When the leaves of transgenic tobacco grow to about 6, take one leaf for GUS histochemical staining (the results are shown in Figure 6); from Figure 6 it can be seen that those with strong GUS activity show a very deep blue color, and no blue color indicates relatively low GUS activity.

[0065] (3) Transgenic plants GUS Analysis of gene expression levels

[0066] Take the seeds of the T0 generation of transgenic tobacco, disinfect them with alcohol and sodium hypochlorite, and then sow them on MS medium. When the tobacco seedlings grow to 5 leaves, take 5 seedlings to extract RNA, and then reverse transcribe into cDNA, and use GUS primers for RT-PCR to analyze the GUS expression level ( Figure 7 ); Figure 7 The results show that the GUS expression level of the T0 generation seedlings of PMT1-10N-Pro transgenic tobacco is significantly higher than that of the control.

[0067] Example 4 Application of nicotine PMT1-1N, PMT1-4N, and PMT1-10N promoters in tobacco transformation:

[0068] (1) PMT1 PCR amplification and identification of gene CDS sequence

[0069] Using K326 cDNA as a template, design primers according to the PMT1 -mRNA sequence of Nicotiana sylvestris to amplify the NtPMT1 gene sequence ( Figure 8 A), and connect it to the T vector for sequencing and identification. Finally, obtain a 1162 bp NtPMT1 gene CDS sequence ( Figure 8 B).

[0070] (2) PMT1 Construction and PCR identification of gene expression vector

[0071] As Figure 9 shown, use Spe I andBstE II Double-digest three constructed PMT1 promoter plant expression vectors, and ligate the amplified PMT1 genes to the Nt sites of pCAMBIA-NPT- Spe I and BstE II in the PMT1-Pro-GUS vector respectively, replacing the original GUS gene, and obtaining three recombinant plasmids containing chimeric genes (shown as SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6): pCAMBIA-NPT- Nt PMT1-1N-Pro-PMT1(1N-PMT1), pCAMBIA-NPT- NtPMT1 -4N-Pro-PMT1(4N-PMT1) and pCAMBIA-NPT- NtPMT1 -10N-Pro-PMT1(10N-PMT1).

[0072] Perform PCR identification on the above three recombinant plasmids, and the results show that the NtPMT1 gene has been successfully constructed into the pCAMBIA-NPT- NtPMT1 -Pro-GUS vector (see Figure 10 ).

[0073] (3) PMT1 Gene tobacco genetic transformation

[0074] Transfer the constructed recombinant plasmids into tobacco K326 and NC89 by Agrobacterium-mediated transformation method, and screen positive plants by kanamycin resistance. Place uninfected sterile leaves on a differentiation medium without kanamycin for culture as a positive control ( Figure 11 A and F in Figure 11 ), and at the same time place uninfected sterile leaves on a differentiation medium containing 30 mg / L kanamycin as a negative control (

[0075] B and G in PMT1 ). After culturing on the selection medium for a period of time, the positive control differentiates normally, the negative control leaves turn white and die gradually, and the transgenic plants differentiate normally.

[0076] Extract total DNA from the positive tobacco plants obtained by kanamycin screening. At the same time, extract total DNA from untransformed tobacco K326 and NC89 plants as negative controls, and use the correctly verified recombinant plasmid as a positive control. Perform PCR detection on the transgenic tobacco plants with PMT1 gene-specific primers (see Figure 12 ).

[0077] Embodiment 5 PMT1 Analysis of conventional chemical components and related gene expression of genetic tobacco strains:

[0078] (1) Transfer PMT1 Routine chemical analysis of genetically modified tobacco

[0079] Transgenic PMT1 The gene-positive plants were rooted and cultured for about 30 days before being transplanted. Samples were taken 40 days after transplanting, and the nicotine, reducing sugar, total sugar and potassium contents were determined by conventional chemical content determination using continuous flow analysis. The results showed that the nicotine content of the three transgenic lines was significantly increased compared to the non-transgenic control. The nicotine content of the 1N-PMT1 transgenic line was more than doubled compared to the control on average, and the nicotine content of the 4N-PMT1 and 10N-PMT1 transgenic lines was more than twice as high as the control on average. The highest nicotine content in the 4N-PMT1 and 10N-PMT1 transgenic lines was 2.5 times higher than that in the control. Among the three transgenic lines, the nicotine content of the 4N-PMT1 and 10N-PMT1 transgenic lines was significantly higher than that of the 1N-PMT1 transgenic line. There was no significant difference in nicotine content between the 4N-PMT1 and 10N-PMT1 transgenic lines (see Figure 13 ).

[0080] (2) Transfer PMT1 Tissue expression analysis of nicotine biosynthesis genes in tobacco

[0081] RNA was extracted from the roots and leaves of tobacco plants, and the expression of genes related to nicotine synthesis was determined by fluorescent quantitative PCR. The expression of nicotine synthesis genes in the roots of each strain was used as a control to analyze the data and draw a bar graph. Figure 14 As shown in Figure 1, seven nicotine biosynthesis genes are specifically expressed in roots and not expressed or expressed in trace amounts in leaves. PMT1 Genetic tobacco PMT1 The proportion of gene expression in leaves increased, but was still significantly lower than its expression in roots.

[0082] (3) Transfer PMT1 Gene Tobacco Nicotine Synthesis Gene Expression

[0083] Total RNA was extracted from the roots of the transgenic lines 40 days after transplantation, and then fluorescent quantitative PCR was performed. Figure 15 As shown: The expression levels of MYC2a and MYC2b in the transgenic lines were significantly higher than those in the control lines. PMT1 The gene expression level was significantly higher than that of the control, but there was no obvious difference among the three transgenics.

[0084] Although some preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they learn the basic creative concept. Therefore, the appended claims are intended to be construed to include the preferred embodiments as well as all changes and modifications that fall within the scope of the present invention.

[0085] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of this application and their equivalent technologies, the present invention also intends to include these modifications and variations. SEQUENCE LISTING <110> Henan Agricultural University <120> High-expression nicotine NtPMT1 promoter, its expression vector and application <130> / <160> 6 <170> PatentIn version 3.2 <210> 1 <211> 587 <212> DNA <213> PMT1-pro1N <400> 1 attttttatt aaatactatc tggtgacaag cattcgtttg cttccgttga ttacgttgat 60 tttgggatct actctatacc aaccgaagcc gttgtccttg atcttcgctt tcatttaatt 120 catcttccgt ctgcctccga tttcacaagt catgcaccca ttcaattatt taatggaaac 180 caattttacc ccgtcaaata ctttacttgg atataaacaa ttttgcccga ggagtaaaca 240 gatgcgaaga aagaaagcag acgattaaag aaatttttaa aaaaggagag agaaatgaac 300 acacacatgt actaataaaa ttagggtact actttactaa taattggaca gagactaaat 360 tcatatttta gttccaaaat gtctcgggca gtccaaccat gcacgttgta atgatttttt 420 aactctatta tatcgagttg cgccctccac tcctcggtgt ccaaattgta tataaatgca 480 tatgtgtcta ttgggagtgt acatcaagct ttcataaagt acaaatcgta atacttgttg 540 aaacataata ctttctcttc tccaatttgt ttagtttaat tttgaaa 587 <210> 2 <211> 629 <212> DNA <213> PMT1-pro4N <400> 2 attttttatt aaatactatc tggtgacaag cattcgtttg cttccgttga ttacgttgat 60 tttgggatct actctatacc aaccgaagcc gttgtccttg atcttcgctt tcatttaatt 120 catcttccgt ctgcctccga tttcacaagt catgcaccca ttcaattatt taatggaaac 180 caattttacc ccgtcaaata ctttacttgg atataaacaa ttttgcccga ggagtaaaca 240 gatgcgaaga aagaaagcag acgattaaag aaatttttaa aaaaggagag agaaatgaac 300 acacacatgt actaataaaa ttagggtact actttactaa taattggaca gagactaaat 360 tcatatttta gttccaaaat gtctcgggca gtccaaccat gcacgttgta atatgcacgt 420 tgtaatatgc acgttgtaat atgcacgttg taatgatttt ttaactctat tatatcgagt 480 tgtaatatgc acgttgtaat atgcacgttg taatgatttt ttaactctat tatatcgagt 480 tgcgccctcc actcctcggt gtccaaattg tatataaatg catatgtgtc tattgggagt 540 tgcgccctcc actcctcggt gtccaaattg tatataaatg catatgtgtc tattgggagt 540 gtacatcaag ctttcataaa gtacaaatcg taatacttgt tgaaacataa tactttctct 600 gtacatcaag ctttcataaa gtacaaatcg taatacttgt tgaaacataa tactttctct 600 tctccaattt gtttagttta attttgaaa 629 tctccaattt gtttagttta attttgaaa 629 <210> 3 <211> 713 <212> DNA <213> PMT1-pro10N <400> 3 attttttatt aaatactatc tggtgacaag cattcgtttg cttccgttga ttacgttgat 60 attttttatt aaatactatc tggtgacaag cattcgtttg cttccgttga ttacgttgat 60 tttgggatct actctatacc aaccgaagcc gttgtccttg atcttcgctt tcatttaatt 120 tttgggatct actctatacc aaccgaagcc gttgtccttg atcttcgctt tcatttaatt 120 catcttccgt ctgcctccga tttcacaagt catgcaccca ttcaattatt taatggaaac 180 catcttccgt ctgcctccga tttcacaagt catgcaccca ttcaattatt taatggaaac 180 caattttacc ccgtcaaata ctttacttgg atataaacaa ttttgcccga ggagtaaaca 240 caattttacc ccgtcaaata ctttacttgg atataaacaa ttttgcccga ggagtaaaca 240 gatgcgaaga aagaaagcag acgattaaag aaatttttaa aaaaggagag agaaatgaac 300 gatgcgaaga aagaaagcag acgattaaag aaatttttaa aaaaggagag agaaatgaac 300 acacacatgt actaataaaa ttagggtact actttactaa taattggaca gagactaaat 360 acacacatgt actaataaaa ttagggtact actttactaa taattggaca gagactaaat 360 tcatatttta gttccaaaat gtctcgggca gtccaaccat gcacgttgta atatgcacgt 420 tcatatttta gttccaaaat gtctcgggca gtccaaccat gcacgttgta atatgcacgt 420 tgtaatatgc acgttgtaat atgcacgttg taatatgcac gttgtaatat gcacgttgta 480 atatgcacgt tgtaatatgc acgttgtaat atgcacgttg taatatgcac gttgtaatga 540 ttttttaact ctattatatc gagttgcgcc ctccactcct cggtgtccaa attgtatata 600 aatgcatatg tgtctattgg gagtgtacat caagctttca taaagtacaa atcgtaatac 660 ttgttgaaac ataatacttt ctcttctcca atttgtttag tttaattttg aaa 713 <210> 4 <211> 1754 <212> DNA <213> PMT1-pro1N+mRNA <400> 4 attttttatt aaatactatc tggtgacaag cattcgtttg cttccgttga ttacgttgat 60 tttgggatct actctatacc aaccgaagcc gttgtccttg atcttcgctt tcatttaatt 120 catcttccgt ctgcctccga tttcacaagt catgcaccca ttcaattatt taatggaaac 180 caattttacc ccgtcaaata ctttacttgg atataaacaa ttttgcccga ggagtaaaca 240 gatgcgaaga aagaaagcag acgattaaag aaatttttaa aaaaggagag agaaatgaac 300 acacacatgt actaataaaa ttagggtact actttactaa taattggaca gagactaaat 360 tcatatttta gttccaaaat gtctcgggca gtccaaccat gcacgttgta atgatttttt 420 aactctatta tatcgagttg cgccctccac tcctcggtgt ccaaattgta tataaatgca 480 tatgtgtcta ttgggagtgt acatcaagct ttcataaagt acaaatcgta atacttgttg 540 aaacataata ctttctcttc tccaatttgt ttagtttaat tttgaaagaa ttcatggaag 600 tcatatctac caacacaaat ggctcgacca tcttcaagaa tggtgccatt cccatgaatg 660 gccaccagag tggcacttcc aaacacctca acggctacca gaacggcact tccaaacacc 720 aaaacggcca ccataatggc acttccgaac atcggaacgg ccaccagaat gggatttccg 780 aacaccaaaa cggccaccag aatgggactt ccgaacaaca gaacgggaca atcagccatg 840 acaatggcaa cgagctactg ggaaactcca actctattaa gcttggttgg ttttcagagt 900 ttagcgcatt atggccaggt gaagcattct cccttaaggt tgagaagtta ctatttcagg 960 ggaagtctga ctaccaagat gtcatgctct ttgagtcagc aacatatggg aaggttttga 1020 ctttggatgg agcaattcaa cacacagaga atggtggatt tccatacact gaaatgattg 1080 ttcatcttcc acttggttcc atcccaaacc caaaaaaggt tttgatcatc ggcggaggaa 1140 ttggttttac attattcgaa atgcttcgtt atcctacaat cgaaaaaatt gacattgttg 1200 aaatcgatga cgtggtagtt gatgtatcta gaaaatcttt cccttatctc gcagctaatt 1260 ttaatgatcc tcgtgtaacc ctcgttctcg gagatggggc tgcatttgta aaggctgcac 1320 aagcaggata ttatgatgct attatagtgg actcttctga tcccattggt ccagcaaaag 1380 atttgtttga gaggccattc tttgaggcag tagccaaagc cctaaggcca ggaggagttg 1440 tatgcacaca ggccgaaagc atttggcttc atatgcatat tattaagcaa atcattgcta 1500 actgtcgtca agtctttaag ggctctgtca actacgcttg gactactgtt ccaacatatc 1560 ccactggtgt aattgggtat atgctctgct ctactgaagg gccagaagtt gacttcaaga 1620 atccaataaa tccaattgac aaagagacaa ctcaagtcaa gtccaaatta gcacctctca 1680 agttttacaa ttctgatatt cacaaagcag cattcatttt gccatctttc gccagaagta 1740 tgatcgagtc ttaa 1754 <210> 5 <211> 1796 <212> DNA <213> PMT1-pro4N+mRNA <400> 5 attttttatt aaatactatc tggtgacaag cattcgtttg cttccgttga ttacgttgat 60 tttgggatct actctatacc aaccgaagcc gttgtccttg atcttcgctt tcatttaatt 120 catcttccgt ctgcctccga tttcacaagt catgcaccca ttcaattatt taatggaaac 180 caattttacc ccgtcaaata ctttacttgg atataaacaa ttttgcccga ggagtaaaca 240 gatgcgaaga aagaaagcag acgattaaag aaatttttaa aaaaggagag agaaatgaac 300 acacacatgt actaataaaa ttagggtact actttactaa taattggaca gagactaaat 360 tcatatttta gttccaaaat gtctcgggca gtccaaccat gcacgttgta atatgcacgt 420 tgtaatatgc acgttgtaat atgcacgttg taatgatttt ttaactctat tatatcgagt 480 tgcgccctcc actcctcggt gtccaaattg tatataaatg catatgtgtc tattgggagt 540 gtacatcaag ctttcataaa gtacaaatcg taatacttgt tgaaacataa tactttctct 600 tctccaattt gtttagttta attttgaaag aattcatgga agtcatatct accaacacaa 660 atggctcgac catcttcaag aatggtgcca ttcccatgaa tggccaccag agtggcactt 720 ccaaacacct caacggctac cagaacggca cttccaaaca ccaaaacggc caccataatg 780 gcacttccga acatcggaac ggccaccaga atgggatttc cgaacaccaa aacggccacc 840 agaatgggac ttccgaacaa cagaacggga caatcagcca tgacaatggc aacgagctac 900 tgggaaactc caactctatt aagcttggtt ggttttcaga gtttagcgca ttatggccag 960 gtgaagcatt ctcccttaag gttgagaagt tactatttca ggggaagtct gactaccaag 1020 atgtcatgct ctttgagtca gcaacatatg ggaaggtttt gactttggat ggagcaattc 1080 aacacacaga gaatggtgga tttccataca ctgaaatgat tgttcatctt ccacttggtt 1140 ccatcccaaa cccaaaaaag gttttgatca tcggcggagg aattggtttt acattattcg 1200 aaatgcttcg ttatcctaca atcgaaaaaa ttgacattgt tgaaatcgat gacgtggtag 1260 ttgatgtatc tagaaaatct ttcccttatc tcgcagctaa ttttaatgat cctcgtgtaa 1320 ccctcgttct cggagatggg gctgcatttg taaaggctgc acaagcagga tattatgatg 1380 ctattatagt ggactcttct gatcccattg gtccagcaaa agatttgttt gagaggccat 1440 tctttgaggc agtagccaaa gccctaaggc caggaggagt tgtatgcaca caggccgaaa 1500 gcatttggct tcatatgcat attattaagc aaatcattgc taactgtcgt caagtcttta 1560 agggctctgt caactacgct tggactactg ttccaacata tcccactggt gtaattgggt 1620 atatgctctg ctctactgaa gggccagaag ttgacttcaa gaatccaata aatccaattg 1680 acaaagagac aactcaagtc aagtccaaat tagcacctct caagttttac aattctgata 1740 ttcacaaagc agcattcatt ttgccatctt tcgccagaag tatgatcgag tcttaa 1796 <210> 6 <211> 1880 <212> DNA <213> PMT1-pro10N+mRNA <400> 6 attttttatt aaatactatc tggtgacaag cattcgtttg cttccgttga ttacgttgat 60 tttgggatct actctatacc aaccgaagcc gttgtccttg atcttcgctt tcatttaatt 120 catcttccgt ctgcctccga tttcacaagt catgcaccca ttcaattatt taatggaaac 180 caattttacc ccgtcaaata ctttacttgg atataaacaa ttttgcccga ggagtaaaca 240 gatgcgaaga aagaaagcag acgattaaag aaatttttaa aaaaggagag agaaatgaac 300 acacacatgt actaataaaa ttagggtact actttactaa taattggaca gagactaaat 360 tcatatttta gttccaaaat gtctcgggca gtccaaccat gcacgttgta atatgcacgt 420 tgtaatatgc acgttgtaat atgcacgttg taatatgcac gttgtaatat gcacgttgta 480 atatgcacgt tgtaatatgc acgttgtaat atgcacgttg taatatgcac gttgtaatga 540 ttttttaact ctattatatc gagttgcgcc ctccactcct cggtgtccaa attgtatata 600 aatgcatatg tgtctattgg gagtgtacat caagctttca taaagtacaa atcgtaatac 660 ttgttgaaac ataatacttt ctcttctcca atttgtttag tttaattttg aaagaattca 720 tggaagtcat atctaccaac acaaatggct cgaccatctt caagaatggt gccattccca 780 tgaatggcca ccagagtggc acttccaaac acctcaacgg ctaccagaac ggcacttcca 840 aacaccaaaa cggccaccat aatggcactt ccgaacatcg gaacggccac cagaatggga 900 tttccgaaca ccaaaacggc caccagaatg ggacttccga acaacagaac gggacaatca 960 gccatgacaa tggcaacgag ctactgggaa actccaactc tattaagctt ggttggtttt 1020 cagagtttag cgcattatgg ccaggtgaag cattctccct taaggttgag aagttactat 1080 ttcaggggaa gtctgactac caagatgtca tgctctttga gtcagcaaca tatgggaagg 1140 ttttgacttt ggatggagca attcaacaca cagagaatgg tggatttcca tacactgaaa 1200 tgattgttca tcttccactt ggttccatcc caaacccaaa aaaggttttg atcatcggcg 1260 gaggaattgg ttttacatta ttcgaaatgc ttcgttatcc tacaatcgaa aaaattgaca 1320 ttgttgaaat cgatgacgtg gtagttgatg tatctagaaa atctttccct tatctcgcag 1380 ctaattttaa tgatcctcgt gtaaccctcg ttctcggaga tggggctgca tttgtaaagg 1440 ctgcacaagc aggatattat gatgctatta tagtggactc ttctgatccc attggtccag 1500 caaaagattt gtttgagagg ccattctttg aggcagtagc caaagcccta aggccaggag 1560 gagttgtatg cacacaggcc gaaagcattt ggcttcatat gcatattatt aagcaaatca 1620 ttgctaactg tcgtcaagtc tttaagggct ctgtcaacta cgcttggact actgttccaa 1680 catatcccac tggtgtaatt gggtatatgc tctgctctac tgaagggcca gaagttgact 1740 tcaagaatcc aataaatcca attgacaaag agacaactca agtcaagtcc aaattagcac 1800 ctctcaagtt ttacaattct gatattcaca aagcagcatt cattttgcca tctttcgcca 1860 gaagtatgat cgagtcttaa 1880

Claims

1. A highly expressed nicotine NtPMT1 promoter, the nucleotide sequence of which is shown in SEQ ID NO.2 or SEQ ID NO.

3.

2. A plant expression vector containing the highly expressed nicotine described in claim 1 NtPMT1 promoter.

3. A recombinant plasmid containing the highly expressed nicotine described in claim 1 NtPMT1 promoter.

4. A method for cultivating tobacco plants with high expression of nicotine, comprising the following steps: (1) Synthesize the highly expressed nicotine NtPMT1 promoter and insert it into the GUS vector at the EcoR I and Hind III sites to replace the 35S promoter, obtaining the plant expression vector pCAMBIA-NPT- NtPMT1 - GUS ; (2)Using tobacco cDNA as a template, primers were designed to amplify the NtPMT1 gene CDS sequence; (3) Use Spe I and BstE II The plant expression vector obtained in the double enzyme digestion step (1) is amplified in step (2) NtPMT1 Gene ligated to pCAMBIA-NPT- NtPMT1 - GUS Carrier Spe I and BstE II site, replace the original GUS Gene, obtain recombinant plasmid; (4) Transfer the recombinant plasmid obtained in the previous step into the leaves of tobacco seedlings by the Agrobacterium transformation method, and screen on the MS medium containing kanamycin to obtain T0 generation transgenic tobacco.

Images