Use of pdgf-d in regulating stem cell proliferation and / or differentiation

Abstract

The application provides application of PDGF-D in regulation of stem cell proliferation and / or differentiation. PDGF-D is combined with a PDGFRbeta receptor in stem cells to activate a downstream Erk channel to regulate cell stemness, and the application regulates expression of the PDGF-D, thereby effectively regulating proliferation and differentiation activities of embryonic stem cells.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of stem cell culture, and particularly relates to application of PDGF-D in regulating proliferation and / or differentiation of stem cells. BACKGROUND

[0002] Stem cells (SC) are a kind of cells with self-renewal ability and multi-differentiation potential, i.e. they can proliferate indefinitely in vitro, and can be induced to differentiate into almost all types of cells. Therefore, stem cells have broad application prospects and utilization value in regenerative medicine and tissue repair.

[0003] Platelet-derived growth factor (PDGF) is an important member of the growth factor family, which can promote the growth, differentiation and migration of various cells such as vascular cells and neuronal cells. The PGDF family contains four subtypes (PDGF-A, -B, -C and -D) and two tyrosine kinase receptors PDGFR-alpha / beta. Among them, PDGF-D is a new member of the PDGF family discovered by Dr. Li Xuri of Zhongshan Ophthalmic Center and his colleagues in 2001, which consists of 348 amino acids, has a CUB protein domain at the N terminal and a core domain at the C terminal. The CUB domain blocks the binding of the receptor in space, so it is initially secreted in the form of an inactivated precursor, and then the extracellular proteases such as urokinase-type plasminogen activator (uPA) and matriptase recognize and hydrolyze the CUB domain, so that the remaining core domain can bind and activate the PDGF receptor and the downstream pathway. PDGF proteins can form five homodimers or heterodimers through disulfide bonds, including PDGF-AA, PDGF-BB, PDGF-AB, PDGF-CC and PDGF-DD, which can bind and activate the tyrosine kinase of the two platelet-derived factor receptors alpha and beta (PDGFR-alpha, beta) on the cell membrane to different degrees, thereby activating the downstream signaling pathway. SUMMARY

[0004] The purpose of the present application is to provide application of PDGF-D in regulating proliferation and / or differentiation of stem cells, so as to regulate the proliferation and differentiation activities of stem cells by acting on the Erk signaling pathway of stem cells.

[0005] According to one aspect of the present application, there is provided application of PDGF-D in regulating proliferation and / or differentiation of stem cells.

[0006] Further, PDGF-D has the effect of promoting differentiation of stem cells.

[0007] Further, the differentiation direction of the stem cell is toward vascular endothelial cell.

[0008] According to an aspect of the present application, a method for promoting stem cell differentiation by using PDGF-D: using PDGF-D to activate Pdgfrβ, and then activating Erk signaling pathway in stem cell.

[0009] Optionally, the method comprises a step of up-regulating the expression level of PDGF-D in the stem cell.

[0010] Optionally, the method comprises a step of adding PDGF-DD protein into the culture medium of the stem cell.

[0011] Further, the differentiation direction of the stem cell is toward vascular endothelial cell.

[0012] Further, the activation of the Erk signaling pathway is manifested by up-regulation of the expression level of phosphorylated Erk1 / 2.

[0013] Further, the stem cell is embryonic stem cell.

[0014] According to an aspect of the present application, an additive for promoting stem cell differentiation: the active ingredient of the additive comprises PDGF-DD protein and / or agonist of PDGF-D gene.

[0015] According to another aspect of the present application, a method for improving the proliferation ability of embryonic stem cell is provided: comprising a step of down-regulating the expression level of PDGF-D.

[0016] Further, the method comprises a step of inhibiting the expression of PDGF-D by antigen-antibody immune reaction; or, a step of inhibiting the expression of PDGF-D by gene silencing; or, a step of inhibiting the expression of PDGF-D signaling pathway by using PDGF-D inhibitor, the PDGF-D inhibitor being selected from at least one of PDGF-D receptor Pdgfrβ inhibitor, PDGF-D ligand inhibitor.

[0017] According to another aspect of the present application, a composition for improving the proliferation ability of stem cell is provided: the active ingredient of the composition comprises PDGF-D inhibitor, the PDGF-D inhibitor being selected from at least one of PDGF-D ligand inhibitor, PDGF-D receptor inhibitor, and PDGF-D downstream signaling pathway inhibitor.

[0018] Further, the PDGF-D ligand inhibitor comprises at least one of nucleic acid effector molecule or monoclonal antibody targeting PDGF-D.

[0019] Furthermore, PDGF-D receptor inhibitors include Pdgfrβ inhibitors. Pdgfrβ inhibitors can be selected from neutralizing antibodies targeting PDGFRβ or inhibit Pdgfrβ expression through gene silencing.

[0020] Furthermore, PDGF-D downstream signaling pathway inhibitors include MAPK / Erk pathway inhibitors.

[0021] Furthermore, MAPK / Erk pathway inhibitors include PD0325901.

[0022] The regulation of stem cells by growth factors is very precise. PDGF-D in stem cells activates the downstream Erk pathway by binding to the PDGFRβ receptor, thereby regulating cell stemness. This invention achieves effective regulation of the proliferation and differentiation activities of embryonic stem cells by regulating the expression of PDGF-D.

[0023] Cardiovascular disease is one of the leading causes of death and disability worldwide, closely related to a reduction in the number and dysfunction of vascular endothelial cells. Due to the limited proliferative capacity and inability to self-renew of vascular endothelial cells, the differentiation of stem cells into vascular endothelial cells has become a key focus of current research and clinical applications. Although various methods exist for inducing stem cell differentiation into vascular endothelial cells, their efficiency and purity remain unsatisfactory. Vascular endothelial cells from different tissues exhibit heterogeneity; different cell subtypes and expressing different molecular markers emerge during vascular endothelial cell development and formation, and during stem cell differentiation into endothelial cells. This invention elucidates key proteins and mechanisms in the directed differentiation of stem cells into vascular endothelial cells, and utilizes PDGF-D to promote the differentiation of embryonic stem cells into vascular endothelial cells. Attached Figure Description

[0024] Figure 1 The results of RT-qPCR detection for inducing endothelial differentiation of mESCs cells in Example 1;

[0025] Figure 2 This is a bar chart showing the number of shCtrl and shPdgfd cells in the mESCs proliferation experiment in Example 2. In the same control group, the bars on the left correspond to the number of shCtrl cells, and the bars on the right correspond to the number of shPdgfd cells.

[0026] Figure 3 The results of the secondary plating experiments of the shCtrl and shPdgfd stable cell lines in the mESCs proliferation experiment in Example 2 are shown. In the control data of the same group in the bar chart, the bar on the left corresponds to the number of shCtrl cells, and the bar on the right corresponds to the number of shPdgfd cells.

[0027] Figure 4 The images show light micrographs and alkaline phosphatase staining results of the mESCs differentiation experiment in Example 2.

[0028] Figure 5 The results of RT-qPCR detection of stem cell pluripotency markers in the mESCs differentiation experiment in Example 2 are shown. In the control data of the same group, the bar on the left corresponds to the RNA expression level of the shCtrl marker, and the bar on the right corresponds to the RNA expression level of the shPdgfd marker.

[0029] Figure 6 The results of the Western Blot analysis of mESCs differentiation experiment in Example 2;

[0030] Figure 7 The results of qRT-PCR detection of vascular endothelial cell-related molecular markers in the mESCs differentiation experiment in Example 2 are shown. In the control data of the same group, the bar on the left corresponds to the RNA expression level of the shCtrl marker, and the bar on the right corresponds to the RNA expression level of the shPdgfd marker.

[0031] Figure 8 The results of GO analysis of mESCs (shPdgfd) in the stable knock-up Pdgf-d group in Example 2;

[0032] Figure 9 The statistical results of GSEA analysis on shCtrl and shPdgfd in Example 2;

[0033] Figure 10 This is the sampling area used for staining sections of the heart of the experimental mouse embryo in Example 3;

[0034] Figure 11 For the corresponding Figure 10 Observational view of stained sample sections and corresponding CD31 region density statistics;

[0035] Figure 12 This is the sampling area from which the brain of the experimental mouse embryo was stained during the sectioning process in Example 3;

[0036] Figure 13 For the corresponding Figure 12 Observational view of stained sample sections and corresponding CD31 region density statistics;

[0037] Figure 14 This is a photograph of the teratoma tissue from the teratoma formation experiment in Example 4.

[0038] Figure 15HE staining images of teratoma tissue sections after the teratoma formation experiment in Example 4;

[0039] Figure 16 qRT-PCR detection results of the teratoma formation experiment in Example 4, wherein, in the same group of control data, the column on the left corresponds to the marker RNA expression of shCtrl, and the column on the right corresponds to the marker RNA expression of shPdgfd;

[0040] Figure 17 qRT-PCR detection results of endothelial cell markers Ang2, Vegf-a, Vegfr-2, Tie2 of the test cells in Example 5;

[0041] Figure 18 qRT-PCR detection results of Sox2, VE-cadherin, Cd133 of the test cells in Example 5;

[0042] Figure 19 Western blot detection results of mESCs cultured with medium added with exogenous Pdgf-d in Example 6;

[0043] Figure 20 qRT-PCR detection results of mESCs cultured with medium added with exogenous Pdgf-d in Example 6;

[0044] Figure 21 Western blot detection results of mouse embryonic stem cells stimulated with PDGF-DD protein in Example 6;

[0045] Figure 22 Western blot detection results of mouse embryonic stem cells co-acted with PDGF-DD protein and Pdfgrβ neutralizing antibody in Example 6;

[0046] Figure 23 Phosphatase staining effect image of mouse embryonic stem cells in Example 6. DETAILED DESCRIPTION

[0047] In order to enable persons skilled in the art to better understand the technical solutions of the present application, the technical solutions in the embodiments of the present application will be described clearly and completely below. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments of the present application.

[0048] In order to enable persons skilled in the art to better understand the technical solutions of the present application, the technical solutions in the embodiments of the present application will be described clearly and completely below. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments of the present application.

[0049] The materials and methods used in the following examples are summarized as follows:

[0050] 1. Materials required for the experiment

[0051] (1) Cells

[0052] Mouse embryonic stem cell line E14 and HEK 293T cells: from the laboratory of the applicant.

[0053] (2) Plasmids

[0054] Mouse Pdgfd gene 4inl shRNA lentivirus vector: pLent-Pdgfd-4inl-shRNA, purchased from Vigene Biosciences Co., Ltd.;

[0055] Negative control vector: pLent-4inl shRNA-GFP-Puro (inserted is a nonsense sequence), purchased from Vigene Biosciences Co., Ltd.;

[0056] Lentivirus packaging plasmids pSPAX2 and pMD2G were purchased from Addgene Co., Ltd.

[0057] (3) Antibodies and proteins

[0058] The detailed information of the antibodies and proteins involved in this example is shown in Table 1.

[0059] Table 1 Antibodies and proteins used in this example

[0060]

[0061]

[0062] (4) shRNA sequence

[0063] The sequence encoding of the shRNA used in this example is shown in Table 2.

[0064] Table 2 Sequence encoding of shRNA

[0065]

[0066]

[0067] 2. Preparation of embryonic stem cell line

[0068] (1) Resuscitation and culture of mouse embryonic stem cells

[0069] 1) Preparation of complete medium for mouse embryonic stem cells: Knockout DMEM 500ml + 15% FBS + 0.1 mM MEM-NEAA + 1% P / S + 2 mM L-Glutamine + 0.1 mM 2-Me + 1000 U / mL LIF, store at 4°C.

[0070] 2) Preparation of 0.1% gelatin: dissolve 0.1 g of gelatin powder in 100 ml of ddH2O, mix well, sterilize at high temperature, and store at room temperature.

[0071] 3) Preparation of 10x PBS: potassium dihydrogen phosphate (KH2PO4) 2.7 g + sodium phosphate dibasic (Na2HPO4) 14.2 g + sodium chloride (NaCl) 80 g + potassium chloride (KCl) 2.0 g, add double distilled water to 1 L, mix well, sterilize at high temperature, and store at room temperature. When used, dilute with sterile double distilled water to 1x PBS.

[0072] 4) Add 0.1% gelatin solution to the culture dish, and let it stand at room temperature for about 30 min;

[0073] 5) Use a negative pressure pump to remove the gelatin solution, and add an appropriate amount of medium to the culture dish;

[0074] 6) Preheat 5 ml of medium or PBS in a centrifuge tube;

[0075] 7) Take the cryopreserved tube from the liquid nitrogen tank and place it in a 37°C constant temperature water bath for rapid thawing;

[0076] 8) Transfer the suspension to the centrifuge tube and centrifuge at 1000 rpm for 3 min, then remove the supernatant;

[0077] 9) Resuspend the cells and transfer them to a clean culture dish, and place it in a CO2 incubator for culture. After the cells adhere, change the medium every two days;

[0078] 10) Observe under a microscope, and when the cell clones grow and the cell density reaches 80%-90%, they can be passaged. After 2-3 passages, the cells can be used for experiments.

[0079] (2) Passage of mouse embryonic stem cells

[0080] 1) Add 0.1% gelatin solution to the culture dish and let it stand at room temperature for 30 min;

[0081] 2) Use a negative pressure pump to remove the gelatin solution;

[0082] 3) Rinse the cells with 1x PBS twice;

[0083] 4) Add 0.25% trypsin to digest the cells, incubate at room temperature for about 30 seconds, then gently shake the culture dish. Under the microscope, the cell clones are loose.

[0084] 5) Add medium to stop the digestion. The cells are plated in a new culture dish at a ratio of 1:3-1:6. After shaking the cell suspension, the culture dish is placed back in the 37°C CO2 incubator.

[0085] 3. Cell RNA extraction, reverse transcription of cDNA and qRT-PCR

[0086] 1) Take cells grown to 80% density, discard the culture medium, wash once with PBS, add 500 μl Trizol to lyse the cells, and transfer to a 1.5 ml centrifuge tube.

[0087] 2) Add 100 μl chloroform, shake vigorously for 20 s, stand for 3 min, then centrifuge at 4°C for 10 min at 12000 rpm.

[0088] 3) Take the supernatant to a new centrifuge tube, do not suck the middle layer; add isopropanol to the supernatant at a ratio of 1:1, mix well, stand for 10 min, then centrifuge at 4°C for 10 min.

[0089] 4) Discard the supernatant and add 1 ml 75% ethanol.

[0090] 5) Centrifuge at 4°C for 5 min, discard the supernatant, add 1 ml 75% ethanol, centrifuge at 4°C for 5 min, then discard the supernatant. Invert the centrifuge tube on a clean absorbent paper, and when the white precipitate at the bottom of the tube becomes transparent, add 50 μl ddH2O and store at -20°C.

[0091] 6) The total RNA obtained is used to synthesize cDNA using the FastKing RT kit with DNase (TIANGEN) kit.

[0092] 7) Use the synthesized cDNA as a template, refer to the SYBR Green (ROCHE) kit, and perform gene expression level detection on the ABI QuantStudio6 Flex device (Life Technologies) PCR instrument:

[0093] 8) Use GAPDH as an internal reference gene, and calculate the expression of each gene using the delta-delta Ct method. The primer sequences of each gene are obtained from the Primerbank website.

[0094] 4. Western blot experiment

[0095] 1) Prepare the liquid:

[0096] ① 10x Running buffer: add 144 g glycine, 10 g SDS powder, 30.3 g Tris powder, add ddH2O to 1 liter. When used, dilute to 1x Running buffer;

[0097] ② 5x SDS loading buffer: add SDS powder 4 g, bromophenol blue 20 mg, DTT 3.085 g, Tris-HCl (1 M pH 6.8) 10 ml, glycerol 20 ml, add ddH2O to 40 ml;

[0098] ③ 10x transfer buffer: add 30.3 g Tris powder, 144 g glycine, add ddH2O to 1 L. When used, dilute to 1x transfer buffer, i.e. 10x transfer buffer 100 ml + methanol 200 ml + distilled water 700 ml.

[0099] 2) Preparation of separation gel and concentration gel

[0100] ① Prepare 8% separation gel (10 ml) according to the formula in Table 3:

[0101] Table 3 Formula of 8% separation gel

[0102] Ingredients Amount ddH2O 4.6 mL 30% Acrylamide 2.7 mL 1.5 M pH 8.8 Tris-Hcl 2.5 mL 10% APS 100 μL 10% SDS 100 μL TEMED 4 μL

[0103] ② Prepare 5% concentration gel (5 mL) according to the formula in Table 4:

[0104] Table 4 Formula of 5% concentration gel

[0105] Ingredients Amount ddH2O 3.4 mL 30% Acrylamide 0.83 mL 0.5 M pH 6.8 Tris-Hcl 0.63 mL 10% APS 5 μL 10% SDS 5 μL TEMED 4 μL

[0106] 3) Protein gel electrophoresis: remove the electrophoresis tank, assemble the protein gel electrophoresis device, carefully remove the comb, add 1 liter of 1x SDS running buffer to the electrophoresis tank, and add the protein Marker and sample to the loading well in turn. Plug in the device power supply and set the program: constant voltage 100 V, 1.5 h, start electrophoresis, and stop electrophoresis when the bromophenol blue approaches the lower edge of the separation gel.

[0107] 4) Membrane transfer: remove the PVDF membrane and filter paper, soak the PVDF membrane in methanol for 30 s. Remove the electrophoresis device, remove the gel, and assemble the membrane transfer clamp (i.e. a "sandwich" structure) in order. Pay attention to expel air bubbles during assembly. Assemble the membrane transfer device, add the membrane transfer solution, and set the membrane transfer program: constant current 250 mA, 1.5-2 h, start membrane transfer.

[0108] 5) Blocking: After the end of the transfer, the PVDF membrane is taken out and placed in the prepared blocking solution, and blocked for 1 h at room temperature on a shaker;

[0109] 6) Incubation of primary antibody: The membrane is washed several times with 1x TBST until the milk is washed clean. The primary antibody is prepared with the blocking solution and placed in the PVDF membrane. The incubation box is placed in the refrigerator at 4°C overnight.

[0110] 7) The membrane is washed three times with 1x TBST, 10 min each time;

[0111] 8) The secondary antibody is prepared with the blocking solution at a ratio of 1:5000 and placed in the PVDF membrane. The incubation box is placed on a shaker at room temperature for 1 h.

[0112] 9) The PVDF membrane is washed as in the previous step.

[0113] 10) Development, exposure: In a dark environment, prepare the chemical developing solution and place the PVDF membrane in the chemical developing solution, with the front facing up, and incubate for 1-3 min. Place the PVDF membrane in the protein gel exposure system, with the front facing up and add a few drops of luminescent solution (avoid drying the membrane), expose, take a photo, record and save the results.

[0114] 5. Establishment of stable cell lines by lentivirus packaging method (using a 6-well plate as an example)

[0115] 1) Prepare complete HEK 293T cell culture medium: DMEM medium 500 ml + 10% FBS + 1% P / S, store at 4°C.

[0116] 2) Seed HEK 293T cells in a 6-well plate. When the cell density reaches 80%, replace the culture medium without secondary antibody.

[0117] 3) Prepare transfection reagents and plasmids:

[0118] A solution: Opti-MEM 100 μl (50 μl x 2), lentivirus packaging plasmids pSPAX2 and pMD2G each 2 μg, gently mix.

[0119] B solution: Opti-MEM 500 μl (250 μl x 2), lipo2000 20 μl (10 μl x 2), gently mix, stand at room temperature for 5 min.

[0120] 4) Divide A solution into two EP tubes, add shctrl, shPdgfd plasmid each 2 μg, and add 200 μl

[0121] Opti-MEM, stand at room temperature for 5 min;

[0122] 5) Divide B solution into EP tubes in step 3), mix gently, incubate at room temperature for 15 min;

[0123] 6) Add the mixed solution in 4) to 6-well plates gently, then put the plates into a 37°C CO2 incubator;

[0124] 7) Replace the medium without secondary antibody after 6 h;

[0125] 8) After 24 h and 48 h of transfection, use a 5-ml syringe to suck the supernatant, and then filter the supernatant through a 0.45-μm filter into a 15-ml centrifuge tube;

[0126] 9) Prepare the cells to be infected: routinely digest E14 cells, count the cells, and inoculate the cells into 6-well plates at a density of 2*10 5 cells / well;

[0127] 10) Add the filtered supernatant in step 7) to the plates, wrap the plates with tin foil, and centrifuge at 600 g for 90 min;

[0128] 11) Suck the supernatant, add fresh medium, resuspend the cells, and put the cells into a 37°C CO2 incubator after the cells are evenly distributed;

[0129] 12) After 72 h of transfection, replace the medium, and add puromycin (5 μg / ml) for drug screening, and the uninfected cells will die;

[0130] 13) Replace the medium and add puromycin for drug screening every day until the cells no longer die;

[0131] 14) Expand the cells, freeze the stock, and perform subsequent tests.

[0132] 6. Colony formation and alkaline phosphatase (AP) staining

[0133] 1) Inoculate mouse embryonic fibroblasts as feeder cells into a 6-well plate of cell culture plates at a density of 2x10 5 cells / well, and use high-sugar DMEM containing 10% fetal bovine serum as the culture medium.

[0134] 2) The next day, after the feeder cells reach 90% density, add 10 μg / ml of mitomycin for treatment, and stop the cell division. After 3 h of treatment in the incubator, remove the cells, wash once with PBS, and replace with the conventional embryonic stem cell culture medium.

[0135] 3) Digest, neutralize, and resuspend the mouse embryonic stem cells, and inoculate the cells into the 6-well plate of cell culture plates at a density of 1000 cells / well.

[0136] 4) Place the plate in the incubator for 7 days, and change the medium every 2 days. On the 7th day, perform the AP staining experiment. Prepare the reagents according to the requirements of the Vector blue alkaline phosphatase substrate kit (SK-5300, Vector Laboratories), then remove the cell culture medium, wash once with PBS, and add the staining reagent to the cells at a volume of 1.5 ml per well, and incubate in the dark for 10 minutes.

[0137] 5) Discard the staining reagent, wash once with PBS, add an appropriate amount of PBS, and place under an inverted microscope for observation and photography. Observe the state of blue-stained clones and the degree of coloring, and determine the self-renewal state of the cells.

[0138] 7) Non-directional induction and differentiation of mouse embryonic stem cells

[0139] 1) Induced differentiation in -LIF culture: Add no LIF factor to the mouse embryonic stem cell culture medium (-LIF culture medium), and continuously culture the mouse embryonic stem cells in this culture medium for 4 days to induce the differentiation of mouse embryonic stem cells into three germ layers, and collect samples every day.

[0140] 2) Embryo id body (EB) formation experiment: Digest and collect mouse embryonic stem cells as usual, resuspend the cells in -LIF-2i culture medium after centrifugation, count the cells, and inoculate 1 x 10 6 cells per dish in a bacterial culture dish, and culture in -LIF-2i culture medium. At different time points (0, 3, 6, and 9 days), observe the size and morphology of the embryo id bodies under a light microscope, take photographs, and collect protein and RNA samples.

[0141] 8) Embryonic stem cell proliferation experiment

[0142] 1) Digest shCtrl and shPdgfd embryonic stem cells as usual, count the cells, and inoculate 1 x 10

[0143] cells per well in a 12-well plate; 4

[0144] 2) Place the plate in a 37°C CO2 incubator for routine culture;

[0145] 3) After 72 h and 96 h of culture, digest the cells and count them, and count and compare the number of cells.

[0146] 9) Teratoma formation experiment

[0147] ​1) Preparation of cells: 3 shCtrl and shPdgfd embryonic stem cells were cultured in each 10 cm dish, and when the clones grew and covered, the cells were routinely digested, and the suspension containing 10 x 2 x 10 6 6

[0148] 2) Centrifuge at 1000 rpm for 3 min, discard the supernatant;

[0149] 3) Resuspend the cells in 1 ml PBS (each nude mouse is injected with 100 μl of cell suspension), and transfer the cell suspension to an EP tube, and wrap the EP tube with tin foil (to avoid ultraviolet radiation in the animal room transmission window, which can inactivate the cells);

[0150] 4) Inject mouse embryonic stem cells (operate in the barrier area of the animal room):

[0151] a. Connect the mouse respiratory anesthesia machine device, add isoflurane, and start the machine;

[0152] b. Place the nude mouse in the closed cage connected to the respirator;

[0153] c. After the nude mouse is anesthetized, take it out and put its mouth and nose into the soft tube connected to the respirator for continuous anesthesia;

[0154] d. Use a 1 ml syringe to aspirate 100 μl of cell suspension, note that the EP tube needs to be shaken gently before aspiration to mix the suspension and avoid cell sedimentation at the bottom of the tube;

[0155] e. Use forceps to pinch the skin behind the ear of the nude mouse, and subcutaneously inject the cell suspension. After about 30 s, pull out the needle. Inject shCtrl embryonic stem cells on the left side and shPdgfd embryonic stem cells on the right side, and inject the 8 nude mice in turn;

[0156] 5) Observe the growth state of the nude mice every week, and after 4 weeks, take out the nude mice, anesthetize them, and then take photos in turn;

[0157] 6) Euthanize the nude mice, take out the subcutaneous teratoma tissue, weigh it, and take a photo;

[0158] 7) Cut a small amount of teratoma tissue for subsequent RNA extraction and Western blot experiments;

[0159] 8) Fix the teratoma tissue in 4% PFA, and the volume of the fixing solution is more than 10 times the volume of the tissue;

[0160] 9) Send to servicebio biotechnology company for paraffin sectioning and HE staining.

[0161] ​​10. Gene chip sequencing analysis

[0162] The expression of Pdgf-d in E14 cell line was stably knocked down by shRNA, and shPdgf-d and control group shCtrl cell lines were constructed. The cells were expanded in large quantities, and not less than 106 cells were collected for each sample. 1 ml Trizol lysis solution was added, and three repeated samples were prepared for each group. The collected Trizol samples were sent to Shanghai Kangcheng Bioengineering Company for gene chip sequencing analysis. The sequencing data results were transmitted to the GEO database.

[0163] Example 1

[0164] In this example, mESCs were subjected to embryoid (Embryoid body, EB) culture to simulate in vivo embryonic development to induce mESCs to differentiate into endothelium. During the endothelial differentiation of mESCs, samples were collected at 0, 4, 7 days, and RT-qPCR detection was performed. As shown in Figure 1 , with the deepening of the endothelial differentiation of mESCs, RT-qPCR detected that Pdgf-d expression was more intense, consistent with endothelial markers VE-cadherin and Vegfr2. It is thus shown that Pdgf-d is conducive to the differentiation of mESCs into blood vessels.

[0165] Example 2

[0166] Conventional mouse embryonic stem cells and Pdgf-d stably knocked down mouse embryonic stem cells were used to construct control group (shCtrl) and Pdgf-d stably knocked down group (shPdgfd) respectively to carry out the culture and proliferation experiment of this example.

[0167] 1. mESCs proliferation experiment

[0168] The tested cells were inoculated in a 12-well plate at a density of 10000 / well. At 72h and 96h after inoculation, the number of cells of shCtrl and shPdgfd was counted respectively. As shown in Figure 2 , compared with shCtrl, the number of cells of shPdgfd was significantly more, indicating that knocking down the expression of Pdgf-d can significantly enhance the cell proliferation ability of mESCs.

[0169] Second plating experiment was performed using shCtrl, shPdgfd stable cell lines. Cells were seeded in 6-well plates at a density of 200, 400, 800 cells per well, and alkaline phosphatase staining was performed after 7 days (alkaline phosphatase activity is one of the phenotypes of self-renewal ability of embryonic stem cells). The size and number of mESCs clones were compared to determine the strength of stem cell colony formation ability. The results showed that after knocking down the expression of Pdgf-d, the number of clones increased significantly, and the size of the clones was larger, indicating that inhibiting the expression of Pdgf-d can significantly enhance the ability of mESCs to form clones. Figure 3 In summary, it can be concluded that inhibiting the expression of Pdgf-d can maintain the self-renewal and proliferation ability of mESCs.

[0170] 2. mESCs differentiation experiment

[0171] shCtrl, shPdgfd stable cell lines were cultured with +LIF medium, and alkaline phosphatase staining was performed after 2 days under a light microscope. The results are shown in Figure 4 In shCtrl, cell clones were flat, alkaline phosphatase activity was low, and cell differentiation was severe, while in shPdgfd, cell clone morphology was three-dimensional, corners were round, and alkaline phosphatase activity was high. RT-qPCR was used to detect the expression of embryonic differentiation markers. Figure 5 Compared with shCtrl, the expression of markers of three embryonic layers of shPdgfd embryonic differentiation was significantly inhibited. This indicates that when Pdgf-d is knocked down, the pluripotency of mESCs is enhanced. Western blot was used to detect stem cell pluripotency markers, and the results of Western blot experiment Figure 6 further verified that with Hsp90 as the internal reference, the expression of Sox2 was significantly increased after Pdgf-d was knocked down, while the expression of cell differentiation markers was significantly decreased, indicating that inhibiting the expression of Pdgf-d is beneficial to maintaining the self-renewal of mESCs.

[0172] Further, RT-qPCR was used to detect the expression of vascular endothelial cell related molecular markers Cd133, Cd34, Cd31 and Vegf-a in shCtrl, shPdgfd stable cell lines obtained by culture. As shown in Figure 7 Compared with shCtrl cells, the expression of Cd133, Cd34, Cd31 and Vegf-a in shPdgfd cells was significantly decreased, indicating that Pdgf-d knockdown can inhibit the differentiation of vascular endothelial cells.

[0173] In order to explore the molecular mechanism of Pdgf-d regulating mouse embryonic stem cells, gene chip data analysis was performed on mESCs to explore the influence of Pdgf-d on the whole genome transcription after stable knockdown of Pdgf-d in mouse embryonic stem cells. The difference of 1.5 times was set as the standard, and P<0.05 was used for differential transcript analysis to screen and determine the obvious differential expression genes between shCtrl and shPdgfd constructed in this embodiment. GO analysis and GSEA method were used to analyze the down-regulated genes after shPdgf-d, GO analysis ( Figure 8 ) found that the down-regulated genes after Pdgf-d knockdown were closely related to angiogenesis, development and vascular endothelial cell differentiation, and GSEA analysis ( Figure 9 ) found that the down-regulated genes after Pdgf-d knockdown were closely related to the classic angiogenesis pathway VEGF. The above data suggest that Pdgf-d can promote the differentiation of vascular endothelial cells.

[0174] Example 3

[0175] In this embodiment, Pdgf-d knockout mice were used as experimental objects to constitute an experimental group, and wild-type mice of the same litter as the aforementioned Pdgf-d knockout mice were used as experimental objects to constitute a control group, in order to explore the effect of Pdgf-d on vascular development.

[0176] The vascular staining of the heart and brain of E12.5-day embryos of wild-type (WT) and Pdgf-d knockout (KO) mice of the same litter was compared: Figure 10 The sampling area view of the heart section staining of E12.5-day embryos of experimental mice was shown, and the sample was stained and counted using CD31, as shown in Figure 11 After Pdgf-d knockout, the density of CD31 in the embryonic heart decreased, proving that the heart blood vessels decreased; Figure 12 The sampling area view of the brain section staining of E12.5-day embryos of experimental mice was shown, and the sample was stained and counted using CD31, as shown in Figure 13 After Pdgf-d knockout, the density of CD31 in the embryonic brain decreased, proving that the brain blood vessels decreased. In summary, in KO mice, the vascular density (CD31 positive) of the heart and brain was lower than that of wild type, indicating that the knockout of Pdgf-d would inhibit the development of blood vessels.

[0177] Example 4

[0178] In order to verify the differentiation potential of embryonic stem cells in animals, this embodiment sets up the following steps to set up the in vivo teratoma formation experiment: 2x10 6shCtrl and shPdgfd cells were injected into the subcutaneous space behind the ears of nude mice. The nude mice had immune deficiencies, and the mouse embryonic stem cells with multi-lineage differentiation potential could differentiate into tissues of different germ layers in the nude mice, forming teratomas.

[0179] The teratoma tissue was removed 4 weeks later, such as Figure 14 As shown, compared with the control group, the teratomas in nude mice injected with shPdgfd mESCs were significantly smaller. Paraffin sections and HE staining of the teratoma tissue were performed, and the results are as follows. Figure 15 As shown, the number of luminal tissues in blood vessels was significantly reduced after Pdgf-d knockdown compared to the control group (see...). Figure 15 (The location indicated by the middle arrow). qRT-PCR analysis showed ( Figure 16 In Pdgf-d stably knocked-down mESCs, the expression of mesodermal (blood vessels differentiate from the mesoderm) markers (Hand1, Brachyury, Eomes) and vascular endothelial cell markers (CD31, Cdc42, VE-Cadherin, etc.) were significantly downregulated. In conclusion, knocking down Pdgf-d expression can inhibit embryonic stem cell differentiation into vascular endothelial cells.

[0180] Example 5

[0181] The purpose of this embodiment is to investigate the effect of excessive Pdgf-d on the self-update of mESCs.

[0182] The control cell line (Ctrl) and the Pdgf-d overexpressing cell line (Pdgf-d OE) were constructed using conventional mouse embryonic stem cells and Pdgf-d overexpressing mouse embryonic stem cells, respectively, to carry out the culture and proliferation experiments of this embodiment.

[0183] qRT-PCR was performed on the control cell line and the Pdgf-d overexpressing cell line. The results are as follows: Figure 17 As shown, this indicates that Pdgf-d overexpression can promote the increase of expression levels of endothelial cell markers Ang2, Vegf-a, Vegfr-2, and Tie2 in mouse embryonic stem cells, proving that PDGF-D can promote the differentiation of embryonic stem cells into endothelial cells.

[0184] In addition, such as Figure 18As shown, compared to Ctrl, in Pdgf-d OE, Sox2 expression was downregulated, while the expression of vascular endothelial cell markers VE-Cadherin and Cd133 was upregulated. However, upon the addition of the MAPK / Erk pathway inhibitor PD0325901, Sox2 levels rebounded, while the expression of vascular endothelial cell markers decreased. These experimental results indicate that Pdgf-d regulates mESC self-renewal and vascular endothelial differentiation through the Erk pathway.

[0185] Example 6

[0186] This embodiment investigates the effect of excessive exogenous PDGF-DD protein on mESCs by adding exogenous PDGF-DD protein to the culture medium of mESCs.

[0187] After treatment with exogenous PDGF-DD protein for 24 h and 48 h, using Tubulin as an internal control, Western blot results were obtained ( Figure 19 The results showed a decrease in Sox2 expression. qRT-PCR detection results ( Figure 20 This indicates that, similarly, after 4 days of treatment with PDGF-DD protein, the expression of Sox2 and Nanog decreased daily. This suggests that exogenous addition of PDGF-DD protein can reduce the self-renewal maintenance capacity of mESCs.

[0188] Mouse embryonic stem cells were stimulated with PDGF-DD protein under serum-free and LIF-free culture conditions. Western blot analysis and alkaline phosphatase staining were performed on the cells at 15 min, 30 min, and 60 min of stimulation. Western blot results ( Figure 21 The results showed that, starting from 15 minutes, PDGF-DD protein stimulation significantly activated the Erk signaling pathway in mouse embryonic stem cells, with a significant increase in the expression of phosphorylated Erk1 / 2. Consistent with this, the two phosphorylation sites of the Pdgfrβ receptor at Y1021 and Y751 were also simultaneously activated. These two Pdgfrβ receptor phosphorylation sites are known to be activated by Pdgf-d. However, the simultaneous addition of Pdfgrβ neutralizing antibody to PDGF-DD protein stimulation resulted in a decrease in the expression of phosphorylated Erk1 / 2. Figure 22 As shown in the diagram, alkaline phosphatase staining experiments (alkaline phosphatase activity is one of the phenotypes of embryonic stem cell self-renewal capacity) showed that in the control group, cells were round, had high alkaline phosphatase activity, and low differentiation. After Pdgf-d overexpression, alkaline phosphatase activity was low, and cell differentiation was severe. Simultaneous addition of the MAPK / Erk pathway inhibitor PD0325901 during overexpression resulted in high alkaline phosphatase activity and reduced cell differentiation. Figure 23In conclusion, we can draw a conclusion that Pdgf-d can activate Erk signaling pathway in mouse embryonic stem cells by activating Pdgfrβ.

[0189] The above examples are only used to illustrate the technical solutions of the present application but not limit the protection scope of the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or equivalently replaced without departing from the spirit and scope of the present application. SEQUENCE LISTING <110> Sun Yat-sen University Sun Yat-sen Ophthalmic Center <120> Application of PDGF-D in regulating stem cell proliferation and / or differentiation <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 57 <212> DNA <213> Artificial Sequence <400> 1 gcgcgaactt tagctgctat cttcaagaga gatagcagct aaagttcgcg ctttttt 57 <210> 2 <211> 57 <212> DNA <213> Artificial Sequence <400> 2 gcaatcacct cacagacttg tttcaagaga acaagtctgt gaggtgattg ctttttt 57 <210> 3 <211> 57 <212> DNA <213> Artificial Sequence <400> 3 ggataacgtc aagaacaaac cttcaagaga ggtttgttct tgacgttatc ctttttt 57 <210> 4 <211> 57 <212> DNA <213> Artificial Sequence <400> 4 ggcaagatga tctggagaat tttcaagaga aattctccag atcatcttgc ctttttt 57

Claims

1. The application of downregulating PDGF-D in enhancing the proliferative capacity of embryonic stem cells in vitro, characterized by: PDGF-D expression was downregulated using shRNA; the shRNA was selected from at least one of shRNA1, shRNA2, shRNA3, and shRNA4, wherein... The sequence of shRNA1 is GCGCGAACTTTAGCTGCTATCTTCAAGAGAGATAGCAGCTAAAGTTCGCGCTTTTTT, the sequence of shRNA2 is GCAATCACCTCACAGACTTGTTTCAAGAGAACAAGTCTGTGAGGTGATTGCTTTTTT, the sequence of shRNA3 is GGATAACGTCAAGAACAAACCTTCAAGAGAGGTTTGTTCTTGACGTTATCCTTTTTT, and the sequence of shRNA4 is GGCAAGATGATCTGGAGAATTTTCAAGAGAAATTCTCCAGATCATCTTGCCTTTTTT.

2. A method for promoting stem cell differentiation in vitro using PDGF-D, characterized in that: PDGF-D is used to activate Pdgfrβ, thereby activating the Erk signaling pathway in stem cells. The stem cells differentiate towards vascular endothelial cells, and the stem cells are embryonic stem cells.

3. The method as described in claim 2, characterized in that: The treatment of activating Pdgfrβ using PDGF-D includes the step of upregulating the expression level of PDGF-D in the stem cells.

4. The method as described in claim 2, characterized in that: The procedure for upregulating the PDGF-D expression level of the stem cells includes adding PDGF-DD protein to the culture medium of the stem cells.

Images