Low temperature amylase and its use in textile

The construction of recombinant low-temperature amylase RPA339 has solved the problems of low efficiency and high cost in the application of low-temperature amylase in dyeing pretreatment, and achieved efficient desizing effect and stability under low temperature conditions, thus promoting the large-scale development of the industry.

CN115678874BActive Publication Date: 2026-05-15TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Filing Date
2022-11-14
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

The application efficiency of existing low-temperature amylases in pretreatment of printing and dyeing is low and the production cost is high, which leads to the cold-pile process being carried out at room temperature, thus limiting the large-scale development of the industry.

Method used

By using bioinformatics data mining, specific amino acid sequences of the intermediate-temperature amylase BAA, the low-temperature amylase CPA, and PPA were screened for recombination to construct the recombinant low-temperature amylase RPA339. The N-terminal 35-220 amino acid sequence of CPA and the C-terminal 346-451 amino acid sequence of PPA were fused, and its enzyme activity and stability under low-temperature conditions were optimized.

Benefits of technology

The modified low-temperature amylase RPA339 still retains 50% enzyme activity at 15℃ and 82% enzyme activity after being placed at room temperature for 16 hours. It is suitable for cold piling process in pretreatment of printing and dyeing, which improves desizing effect and reduces production cost.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
  • Figure SMS_4
    Figure SMS_4
Patent Text Reader

Abstract

The present application recombines the different regions of low-temperature amylase and mesophilic amylase by bioinformatics analysis, and modifies into a new low-temperature amylase, and the amylase after recombination and modification has improved enzyme activity and temperature stability compared with low-temperature amylase CPA and PPA, and the optimum temperature is lower than that of mesophilic amylase. Among them, the optimal recombination and modification of RPA339 amylase is obtained, and the enzyme activity is still retained by 82% after being placed at room temperature for 16 hours. Therefore, the obtained amylase after modification is more suitable for application in the textile field, especially in the cold pile process of pre-treatment of printing and dyeing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of textile applications and relates to the development of a low-temperature amylase and its application in pretreatment of dyeing and printing. Background Technology

[0002] σ-amylase hydrolyzes σ-1,4-glucosidic bonds within starch, leading to partial depolymerization. Based on their thermal stability and optimal reaction temperature, σ-amylases are typically classified into high-temperature σ-amylases, medium-temperature σ-amylases, and low-temperature σ-amylases. High-temperature amylases generally refer to those with an optimal reaction temperature of 90-95℃ and thermal stability above 90℃; medium-temperature amylases are those with an optimal reaction temperature around 60℃; and low-temperature amylases generally have an optimal reaction temperature below 40℃. Low-temperature amylases are widely used in papermaking, food, pharmaceutical, and textile industries. The cold-pile process for pretreatment in dyeing and printing has a broad market, mainly due to its cost-effectiveness and low energy consumption. However, a key technology hindering its development is the low efficiency of applying low-temperature starch in the cold-pile desizing process. Therefore, there is an urgent need to develop a high-performance low-temperature amylase.

[0003] To date, low-temperature amylase-producing bacteria have generally suffered from low enzyme activity and low yield, resulting in high production costs. Furthermore, in the cold-pile process before dyeing and printing, due to climate and cost considerations, the cold-pile process in factories is usually carried out at room temperature. Therefore, developing a low-temperature amylase with high temperature stability and high activity at 10-20℃ would be more conducive to promoting the large-scale development of the industry.

[0004] To solve such problems, high-yielding strains with excellent properties can be obtained through mutagenesis, genetic engineering, or further optimization of culture conditions.

[0005] Examples of successful amylase fusion enzyme construction have been reported: α-amylases from Cryptococcus sp. S-2, Thermobifida fusxa strain NTU 22, and Clostridium Butyricum T-7 were fused with CBM to successfully construct fusion enzymes AmyP-Cr, AmyP-Th, and AmyP-Cl. Soluble fusion enzymes were successfully induced to express in Escherichia coli BL21 (DE3). The specific activity and degradation rate of starch by the fusion enzymes were improved, and the thermostability of fusion enzyme A-S2 was also increased to 5.1 times that of the wild type. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide a low-temperature amylase that maintains high enzyme activity and activity stability under low-temperature conditions.

[0007] This invention first provides a recombinant low-temperature amylase, which was obtained through bioinformatics data mining and screening. The sequence of the mesophilic amylase BAA (GeneBank No.: WP_013352208.1), the sequence of the low-temperature amylase CPA (GeneBank: AAZ27074.1), and the sequence of the low-temperature amylase PPA (GeneBank: AHM24948.1) were obtained.

[0008] Therefore, the present invention provides a recombinant amylase, characterized in that it is obtained by recombining the sequence of amino acids 35-220 near the N-terminus of low-temperature amylase CPA and the sequence of amino acids 346-451 near the C-terminus of low-temperature amylase PPA with that of medium-temperature amylase BAA. Preferably, the connection order is as follows: amino acid sequence 1-58 of medium-temperature amylase BAA, amino acid sequence 35-220 near the N-terminus of low-temperature amylase CPA, amino acid sequence 346-451 near the C-terminus of low-temperature amylase PPA, and amino acid sequence 346-451 of medium-temperature amylase BAA are connected sequentially.

[0009] Among them, the GeneBank number of the medium-temperature amylase BAA sequence is WP_013352208.1, the GeneBank number of the low-temperature amylase CPA sequence is AAZ27074.1, and the GeneBank number of the low-temperature amylase PPA sequence is AHM24948.1.

[0010] The present invention also provides a polynucleotide encoding the recombinant amylase described above.

[0011] Recombinant vectors containing the aforementioned polynucleotides and their recombinant bacteria are also provided.

[0012] This invention further provides a method for preparing the aforementioned nucleotides: Fragment 1 is obtained by amplifying the nucleotide sequence of the medium-temperature amylase BAA; Fragment 2 is obtained by amplifying the nucleotide sequence of the low-temperature amylase CPA using primers CPA339-F (CGATTGCAGAATGATGCGGACTATATTGCTAGTTTAGGGG) and CPA339-R (tacgacgctatTGTTCTTAACTCTTTAGCTTTCGC); Fragment 3 is obtained by amplifying the nucleotide sequence of the low-temperature amylase PPA using primers PPA339-F (AGTTAAGAACAatagcgtcgtattggcaac) and PPA339-R (TTTTGTCCCGTACATATCtccgtaatacatttgagcaatgc); and the three amplified fragments are mixed using a seamless cloning enzyme and ligated in a water bath.

[0013] Further verification was achieved by transforming the bacteria into E. coli and then sequencing them.

[0014] The present invention also provides a method for preparing the recombinant modified amylase, comprising the steps of the recombinant bacteria and isolating the recombinant modified amylase.

[0015] The present invention further provides the application of the recombinant and modified amylase in the cold piling process of pretreatment before printing and dyeing, more specifically, it is used for desizing treatment, preferably with a cold piling temperature of below 20°C, and further with padding at a temperature of below 15°C.

[0016] Beneficial effects of the invention: Existing research on the recombination and modification of amylases mostly focuses on the recombination of the starch-binding domain of amylases. The difference in this invention lies in inferring which regions of the N-terminus or C-terminus affect the psychrophilic domain by truncating the C-terminal and N-terminal sequences of low-temperature amylases. Specifically, it was found that low-temperature amylase CPA retains activity and its optimal temperature remains unchanged even after truncating 50 amino acids from the N-terminus, but its activity disappears after truncating 100 amino acids; while low-temperature amylase PPA retains activity and its optimal temperature remains unchanged even after truncating 100 amino acids from the C-terminus. Therefore, the N-terminal 35-220 amino acids of low-temperature amylase CPA are fused with the amino acids in the C-terminal 346-451 region of low-temperature amylase PPA and inserted to replace the amino acids in the 59-394 region of mesophilic amylase. In other words, the catalytic regions of CPA and PPA are fused and replaced with the catalytic region of the mesophilic amylase BAA, but the N-terminal and C-terminal domains of the mesophilic amylase are retained. The modified enzyme successfully lowered the optimal reaction temperature of the mesophilic amylase BAA, but the enzyme activity of the modified enzyme was higher than that of the original low-temperature amylase. The low-temperature amylase RPA339 obtained in this invention has an optimal temperature of 35℃, an optimal pH of 6.5, and retains 82% activity after 16 hours at room temperature (25℃). The modified low-temperature amylase RPA339 is more suitable for use in the cold-pile process of pretreatment in dyeing and printing. Attached Figure Description

[0017] Figure 1 The optimal temperature for the recombinant and modified amylase.

[0018] Figure 2 The optimal pH value of the recombinant and modified amylase.

[0019] Figure 3 Temperature stability of recombinant and modified amylase. Detailed Implementation

[0020] The present invention will be further described below through specific embodiments in order to better understand the present invention, but this does not constitute a limitation on the present invention.

[0021] Example 1: Mining of Low-Temperature Amylase Sequences

[0022] Bioinformatics analysis was performed on existing members of the amylase family in the CAZy database to clarify the sequence and structural characteristics of this family. Secondly, based on the bioinformatics analysis results, a technical approach was constructed to mine potential members of the low-temperature amylase family from the massive sequence data in the public database NCBI using the Hidden Markov Model (HMMER, http: / / www.hmmer.org / ). Finally, domain annotation (Batch CD-Search) was used to further investigate these potential members. https: / / www.ncbi.nlm.nih.gov / cdd / ) and same-origin modeling (SWISS-MODEL: https: / / swissmodel.expasy.org / interactive Low-temperature amylases were screened from similar sequences obtained through mining. Most of them belong to the GH13 family and the CBM20 domain. The low-temperature amylase CPA sequence (GeneBank: AAZ27074.1) and the low-temperature amylase PPA (GeneBank: AHM24948.1) with low N-terminal and C-terminal sequence similarity were selected.

[0023] Example 2 Expression and purification of amylase

[0024] The LB medium consisted of: 10 g / L peptone, 5 g / L yeast extract, and 10 g / L sodium chloride; the TB medium consisted of: 2% tryptone, 2.4% yeast extract, 72 mM K2HPO4, 17 mM KH2PO4, and 0.4% glycerol.

[0025] 1. Fermentation culture of recombinant amylase

[0026] Inoculate 1% of the target bacterial strain into LB medium and incubate at 37°C for 14 hours. After activation, inoculate 1% of the strain into TB medium containing ampicillin and incubate at 37°C and 220 rpm for about 2 hours. When the OD600nm value reaches 0.6-0.8, immediately add 0.2 mM IPTG inducer to the bacterial culture and incubate at 16°C and 220 rpm for 24 hours to induce expression. Collect the bacterial culture, centrifuge at 12000 rpm and discard the supernatant. Resuspend the precipitate in buffers of different pH values, sonicate and centrifuge at 12000 rpm to collect the supernatant, which is the crude enzyme solution.

[0027] 2. Purification of recombinant amylase

[0028] All of the induced bacterial culture was transferred to a 500 mL centrifuge cup and centrifuged at 5000 rpm for 15 min at 4°C. The supernatant was discarded, and the bacterial cells were collected and resuspended in buffer. Protein purification was performed using an AKTA purifier 10 (GE) protein purifier. After purification using the HisTrap™ HP (GE) affinity chromatography column method, a protein solution containing a small amount of imidazole was obtained. This protein solution was dialyzed to remove free metal ions and other impurities. The solvent buffer was replaced with dialyzing buffer (20 mM sodium phosphate buffer, pH 6.0).

[0029] Example 3: Determination of the enzymatic properties of amylase

[0030] Amylase activity is defined and calculated as follows: 1 ml of liquid enzyme, at 40°C and pH 6.0, liquefies 1 g of soluble starch in 1 hour, which is defined as 1 unit of enzyme activity, expressed in U / ml. The calculation formula is as follows: X = C N. In the formula, X represents the enzyme activity of the sample (U / ml); C represents the enzyme concentration of the test solution (U / ml); and N represents the dilution factor of the sample.

[0031] According to the method specified in the national standard GB 1886.174-2016 for enzyme preparations in the food industry, the activity of heat-resistant α-amylase was determined by scaling down the test system proportionally. The specific steps are as follows:

[0032] 1) The crude enzyme solution was serially diluted with pH 6.0 phosphate buffer to find the optimal dilution factor and ensure that the enzyme activity of the test enzyme solution was in the range of 60 U / mL-65 U / mL.

[0033] 2) Take 2 mL of EP tube, add 1 mL of soluble starch (solarbio) and 250 μL of pH 6.0 phosphate buffer, and preheat in a 70℃ metal bath at 800 rpm for 5 min.

[0034] 3) Add 50 μL of the crude enzyme solution to be tested to a preheated 2 mL EP tube and react for 5 min.

[0035] 4) Take 100 μL of the reaction solution and add it into a 1.5 mL EP tube containing 500 μL of dilute iodine solution and 50 μL of hydrochloric acid solution, and mix well.

[0036] 5) Add 200 μL of the color-changing solution to a 96-well plate. Use dilute iodine solution and hydrochloric acid solution without added reaction solution as blank controls. Measure the absorbance at a wavelength of 660 nm. The absorbance in the range of 0.29-0.39 is optimal.

[0037] 6) Calculate enzyme activity based on the absorbance and α-amylase concentration comparison table given in the national standard.

[0038] Example 4 Construction of recombinant amylase RPA

[0039] 1. N-terminal truncation analysis of amylases CPA and PPA

[0040] Based on the multiple sequence alignment and structural analysis results of Example 1, the N-terminus of CPA and PPA amylase sequences were truncated in 50-amino acid units, and the changes in the optimal reaction temperature for enzyme activity under pH 7.0 conditions were measured.

[0041] Specific vector construction method: The gene sequences of CPA amylase with 50, 100, 150, and 200 amino acids shortened from the N-terminus were inserted between the PET32a ECOR I and Not I restriction sites, and named CPA50-, CPA100-, CPA150-, and CPA200-, respectively.

[0042] The gene sequences of PPA amylase, which were truncated by 50, 100, 150, and 200 amino acids from the N-terminus, were inserted between the EcoRI and NotI restriction sites of PET32a, and named PPA50-, PPA100-, PPA150-, and PPA200-, respectively.

[0043] The constructed CPA50-, CPA100-, CPA150-, CPA200-, PPA50-, PPA100-, PPA150-, and PPA200- enzymes were transformed into *E. coli* BL21 for expression. Enzyme activities were measured at pH 7.0 and reaction temperatures of 15℃, 20℃, 25℃, 30℃, 35℃, and 40℃. As shown in Table 1, by constructing different C-terminal truncated mutants, it was found that the C-terminal domain was not related to psychrophilic properties; however, further truncation of the C-terminus led to enzyme inactivation. The activity of CPA amylase began to decrease after truncating the C-terminus by 50 amino acids.

[0044] Table 1

[0045]

[0046] 2. C-terminal truncation analysis of amylases CPA and PPA

[0047] The C-terminus of CPA and PPA amylase sequences were truncated in 50-amino acid units, and the changes in the optimal reaction temperature for enzyme activity at pH 7.0 were measured.

[0048] Specific vector construction method: The gene sequences of CPA amylase with 50, 100, 150, and 200 amino acids truncated at the C-terminus were inserted between the PET32a ECOR I and Not I restriction sites, and named CPA50C-, CPA100C-, CPA150C-, and CPA200C-, respectively.

[0049] The gene sequences of PPA amylase, which were truncated by 50, 100, 150, and 200 amino acids respectively at the C-terminus, were inserted between the EcoRI and NotI restriction sites of PET32a and named PPA50C-, PPA100C-, PPA150C-, and PPA200C-.

[0050] The completed CPA50C-, CPA100C-, CPA150C-, CPA200C-, PPA50C-, PPA100C-, PPA150C-, and PPA200C- will be generated.

[0051] The enzyme was transformed into E. coli BL21 for expression, and its activity was measured at pH 7.0 and reaction temperatures of 15℃, 20℃, 25℃, 30℃, 35℃, and 40℃. As shown in Table 2, it was found that by constructing different N-terminal truncated mutants, the N-terminal domain was not related to psychrophilic properties; however, further truncating the N-terminus led to enzyme inactivation.

[0052] Table 2

[0053]

[0054] In summary, it is speculated that the domains affecting psychrophilicity in CPA and PPA amylase are not located at the C and N ends.

[0055] 3. Construction of recombinant amylase RPA339

[0056] Based on the experimental results in point 2 above, the sequence of CPA (35-220 amino acids near the N-terminus) and PPA (346-451 amino acids near the C-terminus) were extracted to construct the recombinant plasmids as follows.

[0057] The recombinant plasmid was obtained by using the plasmid PET32a-BAA (BAA sequence GeneBank number: WP_013352208.1) from our laboratory as the backbone template, and the primers BAA339-F: CGCATCATTCTGCAATCG, Baa339-R: GATATTGTACGGGACAAAAGGG to amplify the plasmid backbone to obtain fragment 1;

[0058] Using the CPA sequence (GeneBank: AAZ27074.1) as a template, fragment 2 was amplified using primers CPA339-F: CGATTCAGAATGATGCGGACTATATTGCTAGTTTAGGGG and CPA339-R: tacgacgctatTGTTCTTAACTCTTTAGCTTTCGC;

[0059] Using PPA (GeneBank: AHM24948.1) as a template, primers PPA339-F (AGTTAAGAACAatagcgtcgtattggcaac) and PPA339-R (TTTTGTCCCGTACATATCtccgtaatacatttgagcaatgc) were used to amplify fragment 3. The three amplified fragments were then mixed using a seamless cloning enzyme, ligated in a 50°C water bath for 30 min, and transformed into *E. coli* DH5α. After overnight incubation at 37°C, single clones were picked for verification. The verified and sequenced plasmid was transformed into expression strain BL21, which was named RPA 339 BL21. The activities of mesophilic amylase BAA, hypothermic amylase CPA, hypothermic amylase PPA, and the recombinant hypothermic amylase RPA339 were determined according to the method described in Example 3. Their respective enzyme activities are shown in Table 3 below.

[0060] Table 3 Enzyme activity of recombinant amylase

[0061]

[0062] 1) Determination of optimal temperature

[0063] Following the enzyme activity assay method described in Example 3, starch was mixed with buffer solution and then added to BAA and RPA339 crude enzyme solutions, respectively. The assay temperatures were 15℃, 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, 55℃, 60℃, and 70℃. The relative enzyme activities were calculated, see [see details]. Figure 1 The results showed that the optimal temperature of the recombinant amylase was lower than that of the control group BAA amylase. The optimal temperature of RPA339 was 35℃, and RPA339 still had 50% enzyme activity at 15℃.

[0064] 2) Determination of optimal pH

[0065] Following the enzyme activity assay method described in Example 3, crude BAA and RPA339 enzyme solutions were mixed with buffer solutions and substrates at different pH values, and enzyme activities were measured under pH conditions of 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, and 9. The relative enzyme activities were calculated (see...). Figure 2 The results showed that the optimal pH for RPA339 changed to pH 6.5.

[0066] 3) Temperature stability measurement

[0067] According to the enzyme activity assay method in Example 3, starch and buffer solution were mixed and then BAA and RPA339 crude enzyme solution were added respectively. The mixture was placed at 25°C and pH 6.5 for 16 hours, and samples were taken every 2-4 hours to determine the enzyme activity.

[0068] Calculate its relative residual enzyme activity (see Figure 3 The results showed that the recombinant amylase had improved temperature stability compared to the control group BAA amylase, with RPA339 retaining 82% enzyme activity after 16 hours at room temperature.

[0069] 3.5 km and Kcat value determination

[0070] Starch solutions of different concentrations (final starch concentrations in the reaction buffer were 1.0, 1.25, 1.5, 2.0, 2.5, 3.0, 4.0, 5.0, 6.0, 8.0, and 10.0 mg / mL) were prepared using pH 6.0 phosphate buffer and then subjected to a reaction at 25°C. o After preheating at C for 5 min, 50 μL of appropriately diluted mutant protease solution was added, and enzyme activity was measured at different substrate concentrations. Finally, a double reciprocal curve of 1 / V - 1 / [S] was constructed, and its K value was calculated. m Value, V max value, k cat value and k cat / K m Values. As shown in Table 4, the results show: K m With k cat All values ​​were lower than those in the control group.

[0071] Table 4. K values ​​for various recombinant amylases m value and k cat / K m value

[0072]

[0073] Example 5: Application of recombinant amylase in textile pretreatment processes before dyeing and printing

[0074] In Example 2, the purified enzyme was added to water at a ratio of 1:20 and mixed to prepare an 800 U / mL amylase solution. Then, 900 U / mL cellulase, 10000 U / mL xylanase, 800 U / mL pectinase, 2 g / L calcium chloride, and 80 g / L JFC surfactant were added. Cotton fabric (20×16mm) was immersed in the bio-enzyme solution at 15°C, one immersion and one immersion, with a 100% liquid retention rate. The fabric was then cold-piled at 10°C, 15°C, 20°C, and 25°C for 16 hours. The cotton fabric was washed twice with hot water at 70℃ and once with cold water (room temperature). Then, it was bleached with an oxygen bleaching solution comprising 10 g / L oxygen bleaching agent, 15 g / L hydrogen peroxide, 8 g / L chelating agent, and 2 g / L penetrant, with a 100% liquid retention rate. It was then steamed at 100℃ saturated steam for 30 minutes, followed by two more washes with hot water at 70℃, and then dried. The desizing rate of the pretreated cotton fabric was determined using iodine solution, employing the German TEGEWA standard color chart. This color chart has nine grades, with grade 1 being the worst and grade 9 the best. Generally, a grade of 7 or higher is considered a good desizing rate. The results are shown in Table 5.

[0075] Table 5

[0076]

[0077] As shown in Table 5, the recombinant amylase can achieve good desizing effect under low temperature conditions.

Claims

1. A recombinant modified amylase, characterized in that, It was obtained by recombining the sequence of amino acids 35-220 near the N-terminus of low-temperature amylase CPA and the sequence of amino acids 346-451 near the C-terminus of low-temperature amylase PPA with the sequence of mesophilic amylase BAA. The ligation sequence is as follows: amino acid sequence 1-58 of mesophilic amylase BAA, amino acid sequence 35-220 near the N-terminus of low-temperature amylase CPA, amino acid sequence 346-451 near the C-terminus of low-temperature amylase PPA, and amino acid sequence 346-451 of mesophilic amylase BAA are ligated sequentially. Among them, the GeneBank number of the medium-temperature amylase BAA sequence is WP_013352208.1, the GeneBank number of the low-temperature amylase CPA sequence is AAZ27074.1, and the GeneBank number of the low-temperature amylase PPA sequence is AHM24948.

1.

2. A polynucleotide encoding the recombinant amylase as described in claim 1.

3. A recombinant vector containing the polynucleotide as described in claim 2.

4. Recombinant bacteria containing the recombinant vector as described in claim 3.

5. A method for preparing the recombinant modified amylase as described in claim 1, characterized in that, The method includes the step of culturing the recombinant bacteria as described in claim 4 and isolating the recombinant modified amylase.

6. The application of the recombinant and modified amylase as described in claim 1 in the cold pile process of pretreatment before dyeing and printing.

7. The application as described in claim 6, characterized in that, Used for desizing.

8. The application as described in claim 7, characterized in that, The temperature of the cold reactor is below 20°C.

9. The application as described in claim 8, characterized in that, The temperature of the cold reactor is below 15°C.