Lentiviral vector and use thereof

By introducing the PI3Kδ-shRNA sequence into the CD38-CAR vector and downregulating the expression of the PI3Kδ gene, CD38-CAR/PI3Kδ-shRNA cells were constructed, which solved the problems of limited efficacy and CRS side effects of CAR-T cells in AML treatment, and achieved highly efficient killing of CD38-positive tumors and enhanced safety.

CN115707780BActive Publication Date: 2026-05-01SHENZHEN SECOND PEOPLES HOSPITAL (SHENZHEN INST OF TRANSLATIONAL MEDICINE)
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHENZHEN SECOND PEOPLES HOSPITAL (SHENZHEN INST OF TRANSLATIONAL MEDICINE)
Filing Date
2021-08-20
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

Existing CAR-T cell therapies have limited efficacy in treating acute myeloid leukemia (AML), lack ideal targets, and have the side effect of cytokine release syndrome (CRS). The PI3Kδ signaling pathway regulates T cell function and cytokine release.

Method used

By introducing the PI3Kδ-shRNA sequence into the CD38-CAR vector and downregulating the expression of the PI3Kδ gene through a lentiviral vector, CD38-CAR/PI3Kδ-shRNA cells were constructed to achieve specific killing of CD38-positive tumors by CAR-T cells while reducing cytokine release.

Benefits of technology

It improved the killing efficacy of CAR-T cells against CD38-positive tumors, reduced the incidence and severity of CRS, and improved the safety and effectiveness of treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115707780B_ABST
    Figure CN115707780B_ABST
Patent Text Reader

Abstract

The application discloses a lentivirus vector and application thereof. A U6 promoter and a PI3Kdelta small molecule interfering RNA (PI3Kdelta-shRNA) sequence are cloned to the upstream of an EF1 promoter of a CD38-CAR lentivirus vector, and the CD38-CAR lentivirus vector information is the same as that of a prior application patent (application number 201710560649.2) of the present applicant. The modified chimeric antigen receptor is used for modifying T lymphocytes, the PI3Kdelta expression of the modified CD38-CAR-T cells is reduced, the killing of CD38 positive tumors is reduced, and the secretion of cytokines is reduced. The method can be used for down-regulating PI3Kdelta or other target genes of other target CAR-T cells, and further regulating the biological functions of the CAR-T cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of cell immunotherapy for tumors, specifically to a method for modifying CAR lentiviral vectors, which downregulates the PI3Kδ gene using shRNA based on CD38-CAR, and the application of the modified lentiviral vector in the preparation of CAR-T cells and tumor therapy. Background Technology

[0002] In recent years, CAR-T cells have emerged as a novel cellular immunotherapy approach in hematological malignancies, with major achievements including CD19-targeted therapy for B-cell tumors and BCMA-targeted therapy for multiple myeloma. Acute myeloid leukemia (AML), the most common hematological malignancy, has limited efficacy with CAR-T cells due to the lack of ideal targets. CD38 is widely expressed in AML, and CAR-T cells targeting CD38 show potential therapeutic efficacy. The nanobody CD38-CAR-T cells developed at our center have been able to prolong the survival of AML mice.

[0003] Chinese Patent 201710560649.2 discloses a chimeric antigen receptor comprising, in tandem, an anti-human CD38 nanobody, a human CD8α hinge region and a transmembrane region, a human CD137 intracellular region, and a CD3ζ intracellular region. This chimeric antigen receptor is used to modify T lymphocytes, and the modified T cells (CAR-T cells) can be used to treat CD38-positive tumors.

[0004] The main side effect of CAR-T cells is cytokine release syndrome (CRS). PI3Kδ is an important signaling pathway protein that regulates T cell physiological function and cytokines. Studies have shown that PI3Kδ inhibitors can promote the differentiation of CAR-T cells into naïve and memory cells, prolong in vivo survival time, and improve therapeutic efficacy. Summary of the Invention

[0005] This invention provides a chimeric antigen receptor modified vector comprising a U6 promoter, PI3Kδ-shRNA, and an anti-human CD38-CAR nanobody in tandem, the nucleic acid sequence of which is shown in SEQ ID NO.1. The lentiviral vector contains the U6 promoter, the nucleic acid sequence of which is shown in SEQ ID NO.2. The nucleic acid sequence of the PI3Kδ-shRNA is shown in SEQ ID NO.3.

[0006] The remaining portion of the lentiviral vector contains a CD38 chimeric antigen receptor nanobody and functional modules such as EF1, T2A, and copGFP, the nucleic acid sequence of which is shown in SEQ ID NO.4. The small interfering RNA in this lentiviral vector can target other genes, and the chimeric antigen receptor can target other proteins. This lentiviral vector has the potential for application in the preparation of CAR-T cells.

[0007] Preferably, the present invention also provides a pharmaceutical composition for the prevention or treatment of tumors, comprising a therapeutically effective amount of an active ingredient and pharmaceutically acceptable excipients; wherein the active ingredient comprises the aforementioned CAR-T cells.

[0008] In this invention, the lentiviral expression vector backbone is pCDH-EF1-MCS-T2A-copGFP (empty vector MOCK), and the constructed nanobody anti-human CD38-CAR expression vector is detailed in the applicant's prior application (patent application number 201710560649.2). A U6 promoter tandemly linked to a PI3Kδ-shRNA sequence was synthesized and inserted upstream of the EF1 promoter, resulting in a modified CAR vector named CD38-CAR / PI3Kδ-shRNA. The target plasmid and packaging plasmid were co-transfected into 293T cells to package the virus, which then infected human T cells. Flow cytometry was used to assess transfection efficiency, and Western blot was used to identify CAR and PI3Kδ protein expression. The proliferation and phenotype of CD38-CAR-T and CD38-CAR-T / PI3Kδ-shRNA cells were compared. CAR-T cells were co-cultured with tumor cell lines in vitro. Flow cytometry was used to detect target cell residue, and LDH release assays were used to assess tumor-killing activity. ELISA was used to compare the levels of cytokines IL-2, IFN-γ, and TNF-α in the co-culture supernatant. This confirmed that CD38-CAR-T / PI3Kδ-shRNA cells specifically killed CD38-positive cells, and that cytokine release was reduced. Therefore, the chimeric antigen receptor modified in this invention can be applied in tumor therapy to alleviate CRS (Cellular Respiratory Syndrome). Attached Figure Description

[0009] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments are briefly introduced. In the drawings:

[0010] Figure 1 A schematic diagram of the CD38-CAR / PI3Kδ-shRNA lentiviral expression vector;

[0011] Figure 2 The transfection efficiency and protein expression of two types of CAR-T cells were analyzed; among them, Figure 2 A represents the GFP positivity rate. Figure 2 B represents the PI3Kδ mRNA level detected by RQ-PCR. Figure 2 C represents the levels of CAR and PI3Kδ proteins detected by Western blot;

[0012] Figure 3 This section compares the proliferation capacity and subtypes of two types of CAR-T cells; among them, Figure 3 A represents the fold increase in proliferation rate as counted under a microscope. Figure 3 B represents the CCK8 proliferation curve. Figure 3 C represents the cell subtype detected by flow cytometry;

[0013] Figure 4 This is a comparison of the killing abilities of two types of CAR-T cells; among them Figure 4 A represents the flow cytometry analysis of CD38 expression in several cell lines. Figure 4 B is CD38-CAR-T against CD38 + Specific killing of tumor cells; Figure 4 C represents the effect of CD38-CAR-T / PI3Kδ-shRNA on CD38 + The ability of tumor cells to kill;

[0014] Figure 5 The levels of IL-2, IFN-γ, and TNF-α in the supernatants of different co-culture systems; among them, Figure 5 A represents a target-effectiveness ratio of 1:1; Figure 5 B represents a target-effectiveness ratio of 1:4; Figure 5 C represents the relative value between the CD38-CAR-T / PI3Kδ-shRNA cell co-culture group and the CD38-CAR-T cell co-culture group. Detailed Implementation

[0015] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings.

[0016] This invention treats CD38-CAR-T cells with a PI3K inhibitor, which does not affect their anti-tumor activity but reduces cytokine release. Cloning PI3Kδ small interfering RNA into a CD38-CAR lentiviral vector results in T cells transfected with this modified vector expressing CD38-CAR while simultaneously exhibiting decreased PI3Kδ expression, thus reducing cytokine release while maintaining anti-tumor activity, demonstrating potential application prospects. This modification method can also be used for modifying CARs targeting other tumors and downregulating other genes.

[0017] Example 1: Determination of CD38-CAR / PI3Kδ-shRNA gene sequence and construction of lentiviral expression plasmid

[0018] 1.1 Three siRNAs were set up based on the PI3Kδ gene transcript, cloned into the pHBLV-U6-MCS-EF1-mcherry-T2A-PURO vector, packaged with virus, infected Jurkat cells, and the siRNA sequence with a significant decrease in PI3Kδ expression was screened out.

[0019] 1.2 The U6 and PI3Kδ-shRNA sequences were tandemly synthesized into a complete gene, with SpeI and AsiSI restriction sites at both ends. The gene was then cloned upstream of the EF1 promoter of the EF1-CD38-CAR-T2A-copGFP vector via restriction enzyme digestion and ligation, thus constructing the CD38-CAR / PI3Kδ-shRNA vector (see schematic diagram). Figure 1 For details on each sequence, please refer to the sequence list.

[0020] Example 2: Preparation and identification of anti-human CD38-CAR-T and CD38-CAR-T / PI3Kδ-shRNA cells

[0021] 2.1 Isolation, purification, and stimulation culture of T cells

[0022] Peripheral blood was collected from healthy donors and combined with RosetteSep TM Human T cell enrichment antibody mixture was incubated at room temperature, the white membrane was separated by Ficoll, washed with PBS, and the cell pellet was treated with X-VIVO containing 5% FBS. TM Resuspend in culture medium at 15°C, stimulate with 1:1 anti-human CD3 / CD28 magnetic beads and 100 IU / ml rhIL-2, and culture at a cell density of 1×10⁻⁶. 6 / ml, inoculated into 24-well plates.

[0023] 2.2 Viral infection and amplification of T cells

[0024] T24 hours after T cell activation, concentrated lentiviral buffer containing MOCK, CD38-CAR, and CD38-CAR / PI3Kδ-shRNA was added to a concentration of 10. Polybrene was then added to a final concentration of 8 μg / ml to promote transfection. After 24 hours of culture, the cells were centrifuged at 250xg for 5 minutes, the supernatant was discarded, and fresh culture medium was added to achieve a cell density of (0.5–1) × 10⁶ cells / mL. 6 / ml culture for amplification, 100IU / ml rhIL-2 for maintenance.

[0025] 2.3 Detection of CAR protein and PI3Kδ expression

[0026] 96 hours post-infection, T cell infection efficiency was assessed by flow cytometry. GFP-positive cells were CAR-T cells, while there was no difference in infection efficiency between CD38-CAR-T and CD38-CAR-T / PI3Kδ-shRNA cells (see results). Figure 2 A). RQ-PCR and Western blot detected decreased PI3KδmRNA and protein levels in CD38-CAR-T / PI3Kδ-shRNA cells (see results). Figure 2B, 2C). Western blot antibodies: CD3ζ (BD), PI3Kδ (CST), GAPDH (Absin).

[0027] RQ-PCR primers:

[0028] PI3Kδ-F: 5'AGCCGGAAGACTACACGCT 3'

[0029] PI3Kδ-R: 5'GGTCAGGTGAGGGGTCAAC 3'

[0030] GAPDH-F: 5'GGAGCGAGATCCCTCCAAAAT 3'

[0031] GAPDH-R: 5'GGCTGTTGTCATACTTCTCATGG 3'

[0032] Example 3: Comparison of proliferation and phenotype of anti-human CD38-CAR-T and CD38-CAR-T / PI3Kδ-shRNA cells

[0033] 3.1 CAR-T cell proliferation detection

[0034] T cells from the same donor were used to simultaneously prepare CD38-CAR-T and CD38-CAR-T / PI3Kδ-shRNA cells, with the same initial cell number. After 2 weeks of culture, the cells were counted under a microscope, and the fold increase in cell proliferation was calculated (results are shown in [link to results]). Figure 3 A). Simultaneously, cells cultured for one week were used to perform a CCK8 cell proliferation experiment (results are shown in...). Figure 3 B). It can be seen that downregulating PI3Kδ in CD38-CAR-T cells can accelerate cell proliferation.

[0035] 3.2 CAR-T cell subtype detection

[0036] Cells were labeled with antibodies against CD4-PE / Cy7, CD8-PB, CD45RA-APC, and CCR7-PE, and T cells were detected by flow cytometry. CM (CD45RA - CCR7 + ), T EM (CD45RA - CCR7 - ), T N (CD45RA + CCR7 + ), T EFF (CD45RA + CCR7 - The proportion of (results are shown in) Figure 3C). There was no statistically significant difference in cell phenotype between CD38-CAR-T and CD38-CAR / PI3Kδ-shRNA.

[0037] Example 4: Comparison of the cytotoxic functions of anti-human CD38-CAR-T and CD38-CAR-T / PI3Kδ-shRNA cells

[0038] 4.1 Flow cytometry detection of CD38 expression in different cell lines

[0039] CD38-Percp / Cy5.5 antibody-labeled cells. CD38 + Leukemia cell lines: NB4, U937, THP-1, HL-60, MV4-11, and NALM-6. CD38 - Leukemia cell line: K562. CD38 - Adherent cell lines: BEAS-2B, MRC-5, HFF-1, and HMEC-1. Results are shown below. Figure 4 A

[0040] 4.2 Flow cytometry monitoring of residual target cells in co-culture systems

[0041] Effector cells MOCK-T, CD38-CAR-T, or CD38-CAR-T / PI3Kδ-shRNA were co-cultured with different target cells at effector-target ratios of 1:1, 1:4, 1:16, 1:64, and 0:1. After 48 hours of co-culture, cells were collected, labeled with 7AAD and CD3-ECD antibodies, and flow cytometry beads were added. The proportion of target cells was detected by flow cytometry, and the target cell lysis rate was calculated using the formula: Lysis (%) = 1 - (number of target cells surviving in treatment wells) / (number of target cells surviving in non-treatment wells) × 100%. This demonstrates the highly efficient and specific killing effect of CD38-CAR-T cells on CD38-positive tumor cells (see results below). Figure 4 B). The cell-killing ability of CD38-CAR-T / PI3Kδ-shRNA was not affected (see results). Figure 4 C). Among them: original CD38 + The cells were bone marrow mononuclear cells (BMMCs) derived from AML patients.

[0042] Example 5: Comparison of cytokine secretion by anti-human CD38-CAR-T and CD38-CAR-T / PI3Kδ-shRNA cells

[0043] ELISA method for detecting the levels of cytokines IL-2, IFN-γ, and TNF-α:

[0044] The ELISA kit was purchased from R&D Company. The supernatant from co-culturing at effector-target ratios of 1:1 and 1:4 for 48 hours was collected and the procedure was performed according to the instructions. OD was measured using a microplate reader. 450 (Detection wavelength) and OD 570 (Corrected wavelength) A 4-parameter (4-PL) linear standard curve was plotted, and the concentration of the sample was determined by its OD value. It can be seen that the cytokine secretion of CD38-CAR-T / PI3Kδ-shRNA cells co-cultured with the above target cells was lower than that of the CD38-CAR-T group (see results). Figure 5 ).

[0045] in conclusion

[0046] The main innovation of this invention lies in introducing a PI3Kδ-shRNA sequence into the CD38-CAR nanobody vector. This allows T cells to express specific CAR proteins while simultaneously downregulating PI3Kδ expression. These CAR-T cells not only specifically kill CD38-positive tumor cells but also reduce cytokine release, which is beneficial for reducing the incidence and severity of CRS, improving safety, and lowering treatment risks and costs, thus showing promising clinical application prospects. This vector modification method can also be extended to the regulation of CAR-T cells targeting other genes and other gene expression.

[0047] The embodiments of the present invention have been described above with reference to the accompanying drawings. However, the present invention is not limited to the specific embodiments described above. The specific embodiments described above are merely illustrative and not restrictive. Those skilled in the art can make other improvements under the guidance of the present invention without departing from the spirit and scope of the claims. sequence list <110> Shenzhen Second People's Hospital <120> A Lentiviral Vector and Its Application <130> <160> 4 <210> 1 <211> 8721 <212> DNA <213> Artificial sequence <400> 1 acgcgtgtag tctttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 60 acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 120 cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga 180 attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 240 tctggtaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 300 agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 360 ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 420 cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 480 tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaaatttt 540 gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 600 aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt 660 aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 720 agaaacatca gaaggctgta gacaaatact gggacagcta caccatccc ttcagacagg 780 atcagaagaa cttagatcat tatataatac agtagcaacc ctctattgtg tgcatcaaag 840 gagagata aagahaacca aggaagcttt agagagata gaggagagc aaaaaaaaag 900 taagaccacc gcacagcaag cggccactga tcttcagacc tggagga gatatgagggg 960 acaattgag aagtgatta tataatata aagtagtaa attgaacca tggagtag 1020 cacccaccaa ggcaaagaga agagtggtgc aggagaaaa agagcagtg ggaataggag 1080 ctttgttcct tgggttctg ggagcagcag gaagcactat gggcgcagcg tcaatgacgc 1140 tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga 1200 gggctattga ggcgcacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1260 aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1320 gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gatgctagt tggagtaata 1380 aatctctgga acgatttgg aatcacacga cctggatgga gtgggacaga gaattaca 1440 attack cttaatacac tccttaattg aagaatcgca aaaccagca gaaagaatg 1500 aaaagaatt attggaatta gataaatggg caagtttgtg gatttggtttt aacaataaca 1560 attggctgtg gtatataaaa ttattcataa tgagtagg aggctgta ggtttaagaa 1620 tagttttgc tgtactttct atagtgaata gagttaggca gggatattca ccattatcgt 1680 ttcagaccca cctcccaacc ccgagggac ccgacaggcc cgaaggaata gagagaag 1740 gtggagagag agacagagac agatccattc gattagtgaa cggatctcga cggtatcggt 1800 taacttttaa aagaaaggg gggattgggg ggtacagtgc agggaaga atagtagaca 1860 tatagcaac agacatacaaactaagaat tacaaaaaaaaaa ttcaaattt 1920 tatcgatact agtgaggggcc tattcccat tattccttca tatttgcata tacgatacaa 1980 ggctgttaga gagataatta gattaattt gactgtaaac aaagaat tgtacaaa 2040 tacgtgacgt agaagtaat aatttctttgg gtagtttgca gttttaaaat tatgttttaa 2100 aatggactat catatgctta ccgtaacttg aaagtatttc gatttcttgg ctttatatat 2160 cttgtggaaa ggacgaggat ccgccacaac gtgtccaag acacatcaag agatgtctt 2220 tggacacgtt gtggtttt gattcgcga tcgctccggt gcccgtcagt gggcagagcg 2280 cacatcgccc acagtccccg agaagttggg gggaggggtc ggcaattgaa cgggtgccta gagaaggtgg cgcggggtaa actgggaaag tgatgtcgtg tactggctcc gcctttttcc cgagggtggg ggagaaccgt atataagtgc agtagtcgcc gtgaacgttc tttttcgcaa cgggtttgcc gccagaacac agctgaagct tcgaggggct cgcatctctc cttcacgcgc 2520. ccgccgccct acctgaggcc gccatccacg ccggttgagt cgcgttctgc cgcctcccgc 2580 ctgtggtgcc tcctgaactg cgtccgccgt ctaggtaagt ttaaagctca ggtcgagacc 2640. gggcctttgt ccggcgctcc cttggagcct acctagactc agccggctct ccacgctttg 2700 cctgaccctg cttgctcaac tctacgtctt tgtttcgttt tctgttctgc gccgttacag atccaagctg tgaccggcgc ctactctaga gccaccatgg ccttaccagt gaccgccttg ctcctgccgc tggccttgct gctccacgcc gccaggccgg gatccgaaca aaaactcatc 2880 tcagaagagg atctggcagc aagcggcgcg catgcccagg tgcagctggt ggagtctggg 2940. ggaggctcgg tgcaggctgg agggtctctg agactctcct gtgcagcctc tggatacacc 3000 3060. gatagtgatt acatcatggc ctggttccgc caggctccag ggaaggagcg cgaggtggtc gcaactattt atattggtgg tacgtacatc cactatgccg actccgtgaa gggccgattc accatctccc gagacaatgc cgagacacg gtgtatctgc aaatgacaa cctgaaacct gaagacactg ccatgtacta ctgtgcggcc acgaaatggc gcccctttat atcgactcgg 3240 gcagctgagt ataactctg gggtcagggg accctggtca ccgtctcctc agctagcgaa ttcaccacga cgccagcgcc gcgaccacca acaccggcgc ccaccatcgc gtcgcagccc ctgtccctgc gcccagaggc gtgccggcca gcggcgggggg gcgcagtgca cacgagggggg 3420 ctggacttcg cctgtgatat ctacatctgg gcgcccttgg ccgggacttg tggggtcctt 3480 3540. ctcctgtcac tggttatcac cctttacaaa cggggcagaa agaaactcct gtatatattc aaacaaccat ttatgagacc agtacaaact actcaagagg aagatggctg tagctgccga tttccagaag aagaagaagg aggatgtgaa ctgagagtga agttcagcag gagcgcagac gcccccgcgt accagcaggg ccagaaccag ctctaacg agctcaatct aggacgaaga gaggatacg atgttttgga caagacgt ggccgggacc ctgagatggg gggaaagccg 3780 agaagaaga accctcagga aggcctgtac aatgaactgc agaaagataa gatggcggag 3840 gcctacagtg agattgggat gaaggcgag cgccggaggg gcaaggggca cgatggcctt 3900 taccagggtc tcagtacagc caccaaggac acctacgacg cccttcacat gcaggccctg 3960 ccccctcgcg cggccgctga gggcagagga agtctcttaa catgcggtga cgtgggaggag 4020 aatcccggcc cttccggaat ggagagcgac gagagcggcc tgcccgccat ggagatcgag 4080 tgccgcatca ccggcaccct gaacggcgtg gagttcgagc tggtgggcgg cggagagggc 4140 accccccaagc agggccgcat gaccaacaag atgaagca ccaaaggcgc cctgaccttc 4200 agcccctacc tgctgagcca cgtgatgggc tacggcttct accacttcgg cacctacccc 4260 agcggctacg agaacccctt cctgcacgcc atcaacaacg gcggctacac caacacccgc 4320 atcgagaagt acgaggacgg cggcgtgctg cacgtgagct tcagctaccg ctacgaggcc 4380 ggccgcgtga tcggcgactt caaggtggtg ggcaccggct tccccgagga cagcgtgatc 4440 ttcaccgaca agatcatccg cagcaacgcc accgtggagc acctgcaccc catgggcgat 4500 aacgtgctgg tgggcagctt cgcccgcacc ttcagcctgc gcgacggcgg ctactacagc 4560 ttcgtggtgg acagccacat gcacttcaag agcgccatcc accccagcat cctgcagaac 4620 gggggcccca tgttcgcctt ccgccgcgtg gaggagctgc acagcaacac cgagctgggc 4680 atcgtggagt accagcacgc cttcaagacc cccatcgcct tcgccagatc ccgcgctcag 4740 tcgtccaatt ctgccgtgga cggcaccgcc ggacccggct ccaccggatc tcgctagagc 4800 tgaatctaag tcgacaatca acctctggat tacaaaattt gtgaaagatt gactggtatt 4860 cttaactatg ttgctccttt tacgctatgt ggatacgctg ctttaatgcc tttgtatcat 4920 gctattgctt cccgtatggc tttcattttc tcctccttgt ataaatcctg gttgctgtct 4980 ctttatgagg agttgtggcc cgttgtcagg caacgtggcg tggtgtgcac tgtgtttgct 5040 gacgcaaccc ccactggttg gggcattgcc accacctgtc agctcctttc cgggactttc 5100 gctttccccc tccctattgc cacggcggaa ctcatcgccg cctgccttgc ccgctgctgg 5160 acaggggctc ggctgttggg cactgacaat tccgtggtgt tgtcggggaa atcatcgtcc 5220 tttccttggc tgctcgcctg tgttgccacc tggattctgc gcgggacgtc cttctgctac 5280 gtcccttcgg ccctcaatcc agcggacctt ccttcccgcg gcctgctgcc ggctctgcgg 5340 cctcttccgc gtcttcgcct tcgccctcag acgagtcgga tctccctttg ggccgcctcc 5400 ccgcctggta cctttaagac caatgactta caaggcagct gtagatctta gccacttttt 5460 aaaagaaaag gggggactgg aagggctaat tcactcccaa cgaaaataag atctgctttt 5520 tgcttgtact gggtctctct ggttagacca gatctgagcc tgggagctct ctggctaact 5580 agggaaccca ctgcttaagc ctcaataaag cttgccttga gtgcttcaag tagtgtgtgc 5640 ccgtctgttg tgtgactctg gtaactagag atccctcaga cccttttagt cagtgtggaa 5700 aatctctagc agtagtagtt catgtcatct tattattcag tatttataac ttgcaaagaa 5760 atgaatatca gagagtgaga ggaacttgtt tattgcagct tataatggtt acaaataaag 5820 caatagcatc acaaatttca caaataaagc atttttttca ctgcattcta gttgtggttt 5880 gtccaaactc atcaatgtat cttatcatgt ctggctctag ctatcccgcc cctaactccg 5940 cccagttccg cccattctcc gccccatggc tgactaattt tttttattta tgcagaggcc 6000 gaggccgcct cggcctctga gctattccag aagtagtgag gaggcttttt tggaggccta 6060 gacttttgca gagacggccc aaattcgtaa tcatggtcat agctgtttcc tgtgtgaaat 6120 tgttatccgc tcacaattcc acacaacata cgagccggaa gcataaagtg taaagcctgg 6180 ggtgcctaat gagtgagcta actcacatta attgcgttgc gctcactgcc cgctttccag 6240 tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt 6300 ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg 6360 ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg 6420 gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag 6480 gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga 6540 cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct 6600 ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc 6660 tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg 6720 gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc 6780 tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca 6840 ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag 6900 ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct 6960 ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc 7020 accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga 7080 tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca 7140 cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat ccttttaaat 7200 taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc tgacagttac 7260 caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc atccatagtt 7320 gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccac tgccccagt 7380 gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc aaaaccag 7440 ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgccctc catccagtct 7500 attaattgtt gccgggaagc tagagtagt agttcgccag ttaatagttt gcgcaacgtt 7560 gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc ttcattcagc 7620 tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa aaagcggtt 7680 agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt atcactcatg 7740 gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg cttttctgtg 7800 actggtgagt actcaaccaa gtcattctga gatagtgta tgcggcgacc gagttgctct 7860 tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa agtgctcatc 7920 attggaaaac gttcttcggg gcgaaaactc tcaggatct taccgctgtt gagatccagt 7980 tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttactt caccagcgtt 8040 tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag ggcgacacgg 8100 aaatgttgaa tactcatact cttcctttt caatattatt gaagcattta tcagggttat 8160 tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat aggggttccg 8220 cgcacatttc cccgaaaagt gccacctgac gtctaagaaa ccattattat catgacatta 8280 acctataaaa ataggcgtat cacgaggccc ttcgtctcg cgcgtttcgg tgatgacggt 8340 gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc 8400 gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggctggctt 8460 aactatgcgg catcagagca gattgtactg agagtgcacc atatgcggtg tgaaataccg 8520 cacagatgcg taaggagaaa ataccgcatc aggcgccatt cgccattcag gctgcgcaac 8580 tgttgggaag ggcgatcggt gcgggcctct tcgctattac gccagctggc gaaaggggga 8640 tgtgctgcaa ggcgattaag ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa 8700 acgacggcca gtgccaagct g 8721 <210> 2 <211> 241 <212> DNA <213> Artificial sequence <400> 2 gagggcctat ttcccattat tccttcatat ttgcatatac gatacaaggc tgttagagag 60 ataattagaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120 aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180 atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240 c 241 <210> 3 <211> 72 <212> DNA <213> Artificial sequence <400> 3 gaggatccgc cacaacgtgt ccaaagacaa ttcaagagat tgtctttgga cacgttgtgg 60 ttttttgaat tc 72 <210> 4 <211> 8414 <212> DNA <213> Artificial sequence <400> 4 acgcgtgtag tcttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 60 acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 120 cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga 180 attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 240 tctggttaga ccagatctga gcctgggagc tctctggcta actagggac ccactgctta 300 agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgccgtctg tgtgtgact 360 ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 420 cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 480 tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaatttt 540 gactagcgga gggtagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 600 aattagatcg cgatgggaa aaattcggtt aaggccagggg ggaaagaaaaataatt 660 aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 720 agaaacatca gaaggctgta gaaatact gggacagcta caccaccc ttcagacagg 780 atcagagaa cttagatcat tatatatac agtagcaacc ctctattgtg tgcatcaaag 840 gagagata aagahaacca aggaagcttt agagagata gaggagagc aaaaaaaaag 900 taagaccacc gcacagcaag cggccactga tcttcagacc tggaggagga gatatgaggg 960 acaattggag aagtgaatta tataaatata aagtagtaaa aattgaacca ttaggagtag 1020 cacccaccaa ggcaaagaga agagtggtgc agagagaaaa aagagcagtg ggaataggag 1080 ctttgttcct tgggttcttg ggagcagcag gaagcactat gggcgcagcg tcaatgacgc 1140 tgacggtaca ggccagacaa ttatgtctg gtatagtgca gcagcagaac aatttgctga 1200 gggctattga ggcgcaacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1260 aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1320 gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gaatgctagt tggagtaata 1380 aatctctgga acagatttgg aatcacacga cctggatgga gtgggacaga gaaattaaca 1440 attacacaag cttaatacac tccttaattg aagaatcgca aaaccagcaa gaaaagaatg 1500 aacaagaatt attggaatta gataaatggg caagtttgtg gaattggttt aacataacaa 1560 attggctgtg gtatataaa ttatcataa tgatagtagg aggcttggta ggtttaagaa 1620 tagtttttgc tgtactttct atagtgaata gagttaggca gggatattca ccattatcgt 1680 ttcagaccca cctcccaacc ccgaggggac ccgacaggcc cgaaggaata gaagaaag 1740 gtggagagag agagagag agatccattc gattagtgaa cggatctcga cggtatcggt 1800 taacttttaa aagaaaaggg gggattgggg ggtacagtgc aggggaaaga atagtagaca 1860 taatagcaac agacatacaa actaaagaat tacaaaaaca aattacaaaa ttcaaaaattt 1920 tatcgatact agtggatctg cgatcgctcc ggtgcccgtc agtgggcaga gcgcacatcg 1980 cccacagtcc ccgagaagtt gggggagg gtcggcaatt gaacgggtgc ctagagaagg 2040 tggcgcgggg taaactggga aagtgatgtc gtgtactggc tccgcctttt tcccgagggt 2100 gggggaac cgtatataag tgcagtagtc gccgtgaacg ttctttttcg caacgggttt 2160 gccgccagaa cacagctgaa gcttcgaggg gctcgcatct ctccttcacg cgcccgccgc 2220 cctacctgag gccgccatcc acgccggttg agtcgcgttc tgccgcctcc cgcctgtggt 2280 gcctcctgaa ctgcgtccgc cgtctaggta agtttaaagc tcaggtcgag accgggcctt 2340 tgtccggcgc tcccttggag cctacctaga ctcagccggc tctccacgct ttgcctgacc 2400 ctgcttgctc aactctacgt ctttgtttcg ttttctgttc tgcgccgtta cagatccaag ctgtgaccgg cgcctactct agagccacca tggccttacc agtgaccgcc ttgctcctgc 2520 2580. cgctggcctt gctgctccac gccgccaggc cgggatccga acaaaaactc atctcagaag aggatctggc agcaagcggc gcgcatgccc aggtgcagct ggtggagtct gggggaggct 2640 cggtgcaggc tggagggtct ctgagactct cctgtgcagc ctctggatac accgatagtg 2700 attackcat ggcctggttc cgccaggctc caggagga gcgcgaggtg gtcgcaacta 2760 tttatattgg tggtacgtac atccactatg ccgactccgt gaagggccga ttcaccatct cccgagacaa tgccgagaac acggtgtatc tgcaaatgaa caacctgaaa cctgaagaca ctgccatgta ctactgtgcg gccacgaaat ggcgcccctt father cgggcagctg we are ctggggtcag gggaccctgg tcaccgtctc ctcagctagc gaattcacca cgacgccagc gccgcgacca ccaacaccgg cgcccaccat cgcgtcgcag cccctgtccc 3060 tgcgcccaga ggggtgccgg ccagcggcgg gggcgcgt gcacacgagg gggctggact 3120 tcgcctgtga tatctacatc tggcgccct tggccggc tgtggggtc cttctcctgt 3180 cactggttat caccctttac aaacggggca gaagaaact cctgtatata ttcaacaac 3240 catttatgag accagtacaa actactcaag aggagatgg ctgtagctgc cgatttccag 3300 aagagaga aggagt gaactgagag tgagttcag caggagcgca gaccccccg 3360 cgtaccagca gggccagaac cagctctata acgagctca tctaggacga aggaggagt 3420 acgatgtttt ggacagaga cgtggccggg accctgagat gggggaaag ccgagaagga 3480 agaaccctca ggaggcctg tacaatgaac tgcagaaga gagatggcg gaggcctaca 3540 gtgagattgg gatgaaggc gagcgccgga ggggcaaggg gcacgatggc ctttaccagg 3600 gtctcagtac agccaccaag vakacctacg acgccctca catgcaggcc ctgccccctc 3660 gcgcggccgc tgaggcaga ggaagtcttc taacatgcgg tgacgtggag gagaatcccg 3720 gcccttccgg aatggagc gacgagagcg gcctgcccgc catggagatc gagtgccgca 3780 tcaccggcac cctgaacggc gtggagttcg agctggtggg cggcggagag ggcaccccca 3840 agcagggccg catgaccaac aagatgaaga gcaccaaagg cgccctgacc ttcagcccct 3900 acctgctgag ccacgtgatg ggctacggct tctaccactt cggcacctac cccagcggct 3960 acgagaaccc cttcctgcac gccatcaaca acggcggcta caccaacacc cgcatcgaga 4020 agtacgagga cggcggcgtg ctgcacgtga gcttcagcta ccgctacgag gccggccgcg 4080 tgatcggcga cttcaaggtg gtgggcaccg gcttccccga ggacagcgtg atcttcaccg 4140 acaagatcat ccgcagcaac gccaccgtgg agcacctgca ccccatgggc gataacgtgc 4200 tggtgggcag cttcgcccgc accttcagcc tgcgcgacgg cggctactac agcttcgtgg 4260 tggacagcca catgcacttc aagagcgcca tccaccccag catcctgcag aacgggggcc 4320 ccatgttcgc cttccgccgc gtggaggagc tgcacagcaa caccgagctg ggcatcgtgg 4380 agtaccagca cgccttcaag acccccatcg ccttcgccag atcccgcgct cagtcgtcca 4440 attctgccgt ggacggcacc gccggacccg gctccaccgg atctcgctag agctgaatct 4500 aagtcgacaa tcaacctctg gattacaaaa tttgtgaaag attgactggt attcttaact 4560 atgttgctcc ttttacgcta tgtggatacg ctgctttaat gcctttgtat catgctattg 4620 cttcccgtat ggctttcatt ttctcctcct tgtataaatc ctggttgctg tctctttatg 4680 aggagttgtg gcccgttgtc aggcaacgtg gcgtggtgtg cactgtgttt gctgacgcaa 4740 cccccactgg ttggggcatt gccaccacct gtcagctcct ttccgggact ttcgctttcc 4800 ccctccctat tgccacggcg gaactcatcg ccgcctgcct tgcccgctgc tggacagggg 4860 ctcggctgtt gggcactgac aattccgtgg tgttgtcggg gaaatcatcg tcctttcctt 4920 ggctgctcgc ctgtgttgcc acctggattc tgcgcgggac gtccttctgc tacgtccctt 4980 cggccctcaa tccagcggac cttccttccc gcggcctgct gccggctctg cggcctcttc 5040 cgcgtcttcg ccttcgccct cagacgagtc ggatctccct ttgggccgcc tccccgcctg 5100 gtacctttaa gaccaatgac ttacaaggca gctgtagatc ttagccactt tttaaaagaa 5160 aaggggggac tggaagggct aattcactcc caacgaaaat aagatctgct ttttgcttgt 5220 actgggtctc tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac 5280 ccactgctta agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg 5340 ttgtgtgact ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct 5400 agcagtagta gttcatgtca tcttattatt cagtatttat aacttgcaaa gaaatgaata 5460 tcagagagtg agaggaactt gtttattgca gcttataatg gttacaaata aagcaatagc 5520 atcacaaatt tcacaaataa agcatttttt tcactgcatt ctagttgtgg tttgtccaaa 5580 ctcatcaatg tatcttatca tgtctggctc tagctatccc gcccctaact ccgcccagtt 5640 ccgcccattc tccgccccat ggctgactaa ttttttttat ttatgcagag gccgaggccg 5700 cctcggcctc tgagctattc cagaagtagt gaggaggctt ttttggaggc ctagactttt 5760 gcagagacgg cccaaattcg taatcatggt catagctgtt tcctgtgtga aattgttatc 5820 cgctcacaat tccacacaac atacgagccg gaagcataaa gtgtaaagcc tggggtgcct 5880 aatgagtgag ctaactcaca ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa 5940 acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta 6000 ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc 6060 gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca ggggataacg 6120 caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt 6180 tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa 6240 gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct 6300 ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc 6360 cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg 6420 tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct 6480 tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag 6540 cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga 6600 agtggtggcc taactacggc tacactagaa ggacagtatt tggtatctgc gctctgctga 6660 agccagttac cttcggaaaa aggttggta gctcttgatc cggcaaacaa accccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag 6780 aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaac tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatg agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc agtgctgcaa 7080 tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga agctagc agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt 7320 cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg gttagctcct 7380. tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc atggttatgg 7440 cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg 7500 agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg 7560 cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattggaa 7620 aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc agttcgatgt 7680 aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc gtttctgggt 7740 gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt 7800 gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca 7860 tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat 7920 ttccccgaaa agtgccacct gacgtctaag aaaccattat tatcatgaca ttaacctata 7980 aaaataggcg tatcacgagg ccctttcgtc tcgcgcgttt cggtgatgac ggtgaaaacc 8040 tctgacacat gcagctcccg gagacggtca cagcttgtct gtaagcggat gccgggagca 8100 gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggctgg cttaactatg 8160 cggcatcaga gcagattgta ctgagagtgc accatatgcg gtgtgaaata ccgcacagat 8220 gcgtaaggag aaaataccgc atcaggcgcc attcgccatt caggctgcgc aactgttggg 8280 aagggcgatc ggtgcgggcc tcttcgctat tacgccagct ggcgaaaggg ggatgtgctg 8340 caaggcgatt aagttgggta acgccagggt tttcccagtc acgacgttgt aaaacgacgg 8400 ccagtgccaa gctg 8414

Claims

1. A lentiviral vector, characterized in that, It includes the U6 promoter, PI3Kδ-shRNA and anti-human CD38-CAR nanobody in tandem; its nucleic acid sequence is shown in SEQ ID NO.

1.

2. The lentiviral vector according to claim 1, characterized in that, The U6 promoter has the nucleic acid sequence shown in SEQ ID NO.

2.

3. The lentiviral vector according to claim 1, characterized in that, The nucleic acid sequence of the PI3Kδ-shRNA is shown in SEQ ID NO.

3.

4. The lentiviral vector according to claim 1, characterized in that, It contains a nanobody anti-human CD38-CAR and functional modules EF1, T2A, and copGFP, and its nucleic acid sequence is shown in SEQ ID NO.

4.

5. The use of the lentiviral vector as described in any one of claims 1-4 in the preparation of CAR-T cells.

6. A pharmaceutical composition for the prevention or treatment of tumors, characterized in that, It contains a therapeutically effective amount of an active ingredient and pharmaceutically acceptable excipients; the active ingredient comprises the CAR-T cells as described in claim 5.

Citation Information

Patent Citations

  • Chimeric antigen receptor and application thereof

    CN109232742A