A kind of Trichoderma thunbergii and its application

Abstract

The invention discloses a strain of Trichoderma thunbergii, a spore suspension of Trichoderma thunbergii, a fermentation liquid of Trichoderma thunbergii, and a preparation method and application thereof, and belongs to the field of microbial technology. The strain number of the Trichoderma thunbergii is T37, and the deposit number is GDMCC No: 61066. The preparation method of the Trichoderma thunbergii T37 and its spore suspension, fermentation liquid and fermentation powder is simple, safe and efficient to use, and has good antibacterial properties; it can be used for the prevention and treatment of crop diseases, especially crop diseases caused by Verticillium dahliae and canker pathogens. In addition, it also has the effect of promoting plant rooting and growth, and improving the cold resistance of crops, and has good application prospects and important value.

Description

Technical Field

[0001] The invention relates to the field of microbial technology, and in particular to a Trichoderma crassifolia strain, a Trichoderma crassifolia spore suspension, and a preparation method and application of a Trichoderma crassifolia fermentation broth. Background Art

[0002] Chilling injury refers to the damage to crops caused by temperatures above zero degrees Celsius, which usually occurs in early spring and late autumn. When crops suffer from chilling injury during their growing season, the mildest consequences are reduced production and yield, and the worst are total crop failure. At present, the main measures to deal with crop chilling injury are to apply exogenous plant hormones such as abscisic acid to induce plant tolerance to low temperatures and to cultivate cold-resistant varieties. On the one hand, the cost of applying plant hormones is too high, and on the other hand, plant hormones are likely to be involved in regulating other aspects of crop physiological growth, causing problems such as precocious maturity; the cultivation of cold-resistant varieties often takes a long time and is difficult to meet demand in a short period of time. Therefore, there is currently a lack of a more practical method for preventing and controlling crop chilling injury in the field.

[0003] Thick Trichoderma is a fungus of the genus Trichoderma (Trichoderma Pers.), which is distributed worldwide and mainly exists in humid habitats such as forests, gullies, farmlands, grasslands, etc. Soil, plant residues such as dead branches and leaves, and fruiting bodies of other fungi are all its growth substrates. It has rich species diversity and is an important group of ascomycetes. Trichoderma, including its sexual stage ("Hypocrea"), is an important natural biological resource with high economic value. Some species of this genus have strong killing ability against plant pathogenic fungi, and are therefore widely used as biological control agents; some of them can produce enzymes such as cellulase, hemicellulase, ligninase and pectinase, which have attracted much attention. They are currently widely used in agriculture, industry, environmental protection and other related fields. Trichoderma fungi can produce a variety of secondary metabolites. Currently, more than 180 metabolites have been isolated from them, mainly including polyketides, terpenes, amino acids and their derivatives. Their biological activities are mainly manifested in: anti-plant pathogenic fungi activity, plant growth promotion activity, anti-yeast activity, anti-bacterial activity, anti-viral activity, etc. They are widely used in plant disease prevention and control, and have certain application value in the fields of biology and medicine.

[0004] The known reported Trichoderma strains mainly promote plant growth by competing for nutrients and space and changing environmental conditions. They usually play a biological control role on fungal plant pathogens indirectly through fungal parasitic mechanisms. However, there are few reports on bacterial diseases. Moreover, not all Trichoderma crassum can be effectively used for biological control of pathogens; Trichoderma crassum M82 has been reported as the causative pathogen of tomato leaf spot and wilt, see "First Report of Trichodermacrassum Causing Leaf Spot on Tomato (Solanum lycopersicum) in Ohio". Therefore, it is a huge challenge to screen out Trichoderma crassum that can be effectively used for the prevention and control of a variety of plant diseases including fungal diseases and bacterial diseases.

[0005] Trichoderma harzianum is the most widely studied and used species under the genus Trichoderma, and it has been proven that it can be used effectively to prevent and treat a variety of plant diseases; it is a species recognized to have good preventive effect. It has been reported that Trichoderma harzianum is better than Trichoderma crassum in preventing and treating Verticillium wilt (the pathogen is Verticillium dahliae), see "Study of Antagonistic Effects of Trichoderma Species on Growth ofVerticillium dahliae, the Causal Agent of Verticillium Wilt of Pistachio under Laboratory Condition"; it is of great significance to screen out new strains that can have a control effect comparable to that of Trichoderma harzianum, or even better than that of Trichoderma harzianum. In addition, the scope of use of Trichoderma harzianum is also limited. For example, it is generally used in high temperature and high humidity environments, or saline-alkali land, and there are few reports on its cold resistance. Moreover, the strains of Trichoderma harzianum in the market are highly homogenized. Screening out new strains with control effects comparable to that of Trichoderma harzianum and being able to achieve a cold-resistant and cold-tolerant environment is an important mission for science and technology innovation enterprises.

[0006] In view of this, a safe, cold-resistant and efficient fungi-inhibiting Trichoderma strain was screened out, and its control effect on ulcerative bacterial diseases and Verticillium wilt disease was comparable to or even better than that of Trichoderma harzianum. It can be widely used in the biological control of field plant diseases, promote the growth of crops, and carry out commercial production, and has high economic value in the agricultural field.

[0007] In terms of theoretical research, due to the rich species diversity of this group, it has become an important research material for exploring the evolution of fungal systems. Therefore, continuously exploring new natural resources of the genus Trichoderma has both theoretical significance and application prospects. Summary of the invention

[0008] Based on the above background technology, the purpose of the present invention is to screen out a safe Trichoderma strain that is cold-resistant and more efficient in inhibiting fungi.

[0009] In order to achieve the above objectives, the technical solution of the present invention is: the present invention discloses a yet-to-be-reported Trichoderma crassum, the fungus is named Trichoderma crassum T37, and its preservation information is: deposited in Guangdong Provincial Microbiological Culture Collection Center, the preservation address is Guangdong Provincial Institute of Microbiology, No. 100 Xianlie Middle Road, Guangzhou, the preservation number is GDMCCNo:61066, and the preservation date is June 30, 2020.

[0010] The Trichoderma thunbergii sample involved in the present invention was collected from guava leaves in Guangxi. After separation and identification, the strain was found to be Trichoderma thunbergii. The nucleotide sequence of ITS1 / ITS4 is shown in SEQ ID NO.1, and the nucleotide sequence of tef1 is shown in SEQ ID NO.2.

[0011] Furthermore, the present invention also claims to protect a spore suspension of Trichoderma thunbergii, a fermentation liquid of Trichoderma thunbergii or a fermentation powder; the spore suspension, the fermentation liquid of Trichoderma thunbergii and the fermentation powder are prepared from the Trichoderma thunbergii.

[0012] The Trichoderma thunbergii T37 of the present invention can be cultured in a PDA medium and cultured at 28° C. for 5 to 7 days to obtain green spores. The spores can be resuspended in a solution to obtain a spore suspension.

[0013] The preferred concentration of the spore suspension is 1×10 7 sp / mL. It can be diluted 300 times for the prevention and treatment of citrus canker. As a plant growth regulator, it can be diluted 500 times to promote root growth.

[0014] After being activated, the Trichoderma thunbergii T37 of the present invention is placed in a liquid culture medium for shaking culture to prepare a fermentation liquid, and the fermentation liquid is further freeze-dried to obtain the baking powder.

[0015] The present invention also claims to protect a composition or microbial preparation, comprising at least one of the following components: the Trichoderma thunbergii T37, the Trichoderma thunbergii T37 spore suspension, the Trichoderma thunbergii T37 fermentation liquid and the Trichoderma thunbergii T37 fermentation fungus powder.

[0016] Furthermore, the present invention also claims protection for the use of the Trichoderma T37, the Trichoderma T37 spore suspension, the Trichoderma T37 fermentation liquid, the Trichoderma T37 fermentation powder, the composition or the microbial preparation in promoting the root growth of crops.

[0017] At the same time, the present invention also claims to protect the use of the Trichoderma T37, the Trichoderma T37 spore suspension, the Trichoderma T37 fermentation liquid, the Trichoderma T37 fermentation powder, the composition or the microbial preparation in promoting and inducing the cold resistance of crops.

[0018] At the same time, the present invention also claims to protect the use of the Trichoderma T37, the Trichoderma T37 spore suspension, the Trichoderma T37 fermentation liquid, the Trichoderma T37 fermentation powder, the composition or the microbial preparation in preventing and controlling crop diseases.

[0019] The Trichoderma T37 of the present invention, as well as the preparation of the Trichoderma T37 spore suspension, the Trichoderma T37 fermentation powder and the Trichoderma T37 fermentation liquid have all the effects of Trichoderma, and can be effectively used to promote the root growth of crops, promote the induction of cold resistance of crops, and be used to prevent and control crop diseases.

[0020] As a preferred embodiment of the present invention, the crops are citrus, pitaya or cucumber.

[0021] As a preferred embodiment of the present invention, the crop diseases include fungal diseases and / or bacterial diseases.

[0022] Preferably, the crop diseases include at least one of damping-off, head blight, wilt and canker caused by fungal diseases and / or bacterial diseases.

[0023] More preferably, the crop diseases include diseases caused by at least one of Neoscytalidium dimidiatum, Rhizoctonia solani, Fusarium graminearum, Verticillium dahliae and Xanthomonas axonopodis pv citri;

[0024] More preferably, the crop diseases include damping-off, head blight, wilt and / or canker caused by at least one of the pathogens of pitaya canker, Rhizoctonia solani, Fusarium graminearum, Verticillium dahliae and citrus canker.

[0025] After testing, the thick Trichoderma of the present invention can effectively inhibit the effects of Rhizoctonia solani, Fusarium graminearum, Fusarium equisetum, Verticillium dahliae, pitaya canker pathogens, and citrus canker pathogens. Although the present invention cannot test all pathogens and their sub-categories, it is not difficult for those skilled in the art to think that the thick Trichoderma of the present invention can also have a good inhibitory effect when used for the prevention and treatment of other pathogens, especially pathogens that are closely related to the test bacteria of the present invention.

[0026] The crop diseases are crop diseases caused by Verticillium dahliae, pitaya canker pathogens or citrus canker pathogens.

[0027] The Trichoderma thunbergii of the present invention has a better effect of inhibiting the pathogens of pitaya canker, citrus canker and Verticillium dahliae than other tested bacteria, and has a better application prospect in treating crop diseases caused by related pathogens.

[0028] As a preferred embodiment of the present invention, the method for preventing and controlling crop diseases includes: applying an effective amount of any one of the Trichoderma thunbergii T37, the Trichoderma thunbergii spore suspension, the Trichoderma thunbergii fermentation liquid or fermentation powder, the composition or the microbial preparation to the crops.

[0029] As a preferred embodiment of the present invention, the present invention also claims to protect the effect of the Trichoderma thunbergii, the Trichoderma thunbergii spore suspension, the Trichoderma thunbergii fermentation liquid or fermentation powder, the composition or microbial preparation in preventing and treating ulcer disease;

[0030] Preferably, the ulcer disease is pitaya canker or citrus canker.

[0031] The Trichoderma thunbergii, the Trichoderma thunbergii spore suspension, the Trichoderma thunbergii fermentation liquid or the fermentation bacterial powder have particularly outstanding effects in preventing and treating ulcer diseases, especially pitaya ulcer disease or citrus ulcer disease.

[0032] The present invention also claims protection for the use of the Trichoderma T37, the Trichoderma T37 spore suspension, the Trichoderma T37 fermentation liquid, the Trichoderma T37 fermentation powder, the composition or the microbial preparation in the preparation of microbial fertilizers or biological pesticides, including plant growth regulators, seed coating agents, microbial pesticides, microbial fertilizers, microbial powders, and microbial agents.

[0033] Beneficial effects of the present invention:

[0034] The invention discloses a thick Trichoderma derived from Guangxi guava leaves, named as Thick Trichoderma T37; Thick Trichoderma T37 and its spore suspension, fermentation liquid and fermentation bacterial powder have simple preparation methods, safe and efficient use, and good antibacterial properties; can be used for the prevention and treatment of crop diseases, especially crop diseases caused by Verticillium dahliae and ulcer pathogens. In addition, it also has the effect of promoting plant rooting and growth, and improving the cold resistance of crops, and has good application prospects and important value. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The results of plate culture of Trichoderma thunbergii T37 strain of the present invention;

[0036] Figure 2 The results of the experiment on inducing cold resistance of cucumber by fermentation liquid of Trichoderma thunbergii T37;

[0037] Figure 3 The results of the antibacterial test of Trichoderma thunbergii T37 are shown;

[0038] Figure 4 The inhibitory effect of Trichoderma thunbergii T37 spore suspension on citrus canker;

[0039] Figure 5 These are the results of a test on promoting root growth of pitaya using spore suspension of Trichoderma thunbergii T37. DETAILED DESCRIPTION

[0040] The present invention is further explained by the following examples, but it does not constitute a limitation of the present invention. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. The reagents and materials involved in the preparation method in the examples are all biochemical reagents and can be obtained in the market. The experimental methods involved in the relevant experiments are methods well known to those skilled in the art.

[0041] Example 1 Isolation and screening of Trichoderma thunbergii strains

[0042] The sample comes from guava leaves in Guangxi.

[0043] The separation method is as follows: weigh 5g of plant leaf samples, disinfect them with 75% alcohol for 30s, and then rinse them with sterile water for 3 times. Use sterilized scissors to cut the leaf samples as finely as possible, put them into a plant tissue grinder, add 45mL of sterilized Tween 80 0.1% aqueous solution, and beat them into a homogenate. Take 5mL of the homogenate liquid and dilute it with sterilized Tween water to a concentration of 10-3 or 10-4, then spread it on PDA solid inorganic salt medium, invert and culture it in a constant temperature incubator at 28℃ for 4d, pick a single fungal colony after 4d, inoculate it on PDA solid medium, and invert and culture it in a constant temperature incubator at 28℃ for 5d.

[0044] The colony grows fast on the PDA plate. After 3 days at 28℃, the colony radius is 50-52mm. The mycelium layer is thick, white and flat at the beginning, and green in the later stage due to the production of conidia. The back of the colony is colorless, sometimes light yellow, and has no obvious odor. (Refer to Figure 1 )

[0045] Molecular biological identification: The ITS1 / ITS4 and tef1 sequences of the strain were used for species identification. Colonies were picked and isolated, and genomic DNA was extracted using the Biospin Fungus Genomic DNA Extraction Kit (BioFlux, Bioer Technology Co., Ltd.). The extracted genomic DNA was used as a template for amplification using the following primers, and the amplified product was sequenced.

[0046] ITS genes:

[0047] ITS1(5'-TCCGTA-GGTGAACCTGCGG-3'),

[0048] ITS4(5'-TCCTCCGCTTA-TTGATATGC-3').

[0049] TEF-1α gene:

[0050] EF1-728F(5'-CATCGAGAAGTTCGAGAAGG-3'),

[0051] TEF1LLErev(5'-AACTTGCAGGCAATGTGG-3').

[0052] The gene amplification reaction system is as follows:

[0053] Prepare the reaction system in a PCR tube: 2×Taq PCR Master Mix 12 μL, DMSO 1 μL, primers (10 μmol / L) 0.6 μL each, ddHO 2 O 10.8 μL, template DNA 2 μL.

[0054] The gene amplification conditions were as follows:

[0055] Pre-denaturation at 95°C for 4 min; denaturation at 95°C for 40 s, annealing at 55°C for 40 s, extension at 72°C for 1 min, 35 cycles from denaturation to extension; extension at 72°C for 10 min, and insulation at 10°C for 5 min.

[0056] The samples after PCR were sent to Genewise for sequencing. The sequences obtained are as follows:

[0057] ITS1 / ITS4 sequences

[0058] GGGACATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTATTGTATACCCCCTCGCGGGTTTTTTACTATCTGAGCCATCTCGGCGCCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTTTACGGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCCAAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCCGGAGGA

[0059] tef1 sequence

[0060] TCCCCTTCAATTCAATTGTGCTCGACAATTCTCTTCAGAATCATCGAAGCAACAATTTTTTCGTCACCCCGCTTTCGTTCCATTTACCCCTCCTTTGCAGCGACGCAAAATTTTTTGCTGCCTCTGGTTT TTAGTGGGGGTGCACCAGCAACCCCACCACTACCTCGCTGCTCTTTGCCCTTGTCCTATCACCTCCCAGTCCTCGTCCAACGATCTGTGTCTCGATAATTGCAGCGATGCTAACCACCGTTCCCTCAACAG GAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCAC CGTCATTGGTATGTCTCATCACTTTTCATCCAGCTCCCGCAAACCAGTGCTAACCAGGACCTCACAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCC

[0061] The nucleotide sequence of ITS1 / ITS4 of the isolated bacteria obtained by sequencing is shown in SEQ ID NO. 1, and the nucleotide sequence of tef1 is shown in SEQ ID NO. 2. After comparison, the isolated bacteria were identified as Trichoderma macrassum.

[0062] The Trichoderma strain is numbered as Trichoderma T37 and is preserved in the Guangdong Provincial Microbial Culture Collection Center. The preservation address is Guangdong Provincial Institute of Microbiology, No. 100 Xianlie Middle Road, Guangzhou. The preservation number is GDMCC No: 61066 and the preservation date is June 30, 2020.

[0063] Example 2 Preparation of Trichoderma thunbergii T37 spore suspension

[0064] The strain stored in -80℃ refrigerator was activated on PDA solid medium and cultured in a 28℃ constant temperature incubator for 5-7 days until the green spores filled the plate. The spores on the surface of the medium were washed with sterile distilled water and the spore count was adjusted to 1×10 7 sp / mL, which is the spore suspension to be used.

[0065] Example 3 Preparation of Trichoderma T37 fermentation broth

[0066] The strain stored in -80℃ refrigerator was activated on PDA solid medium and placed in a 28℃ constant temperature incubator for 3-4 days. A sterile punch with a diameter of 5mm was used to punch out the bacterial cake, 240mL PDB liquid medium was placed in a 500mL conical flask, 18 thick Trichoderma cakes were added to the conical flask, and shaken and cultured at 28℃ for 7 days. The bacterial cells were filtered with double gauze, and the filtrate obtained was the thick Trichoderma fermentation broth to be used.

[0067] Example 4 Trichoderma T37 induced cold resistance test of cucumber

[0068] (1) Grouping:

[0069] At normal temperature 25℃ / 20℃ (day / night), low temperature 15℃ / 10℃ (day / night)

[0070] A blank control group, a positive control group, and a Trichoderma fermentation liquid group were set up in the two environments, respectively. In each environment, each group was set up with 3 replicates, each replicate had 6 pots, and each pot had 3 cucumbers.

[0071] The root humidity is maintained at 70% to 90% and the light intensity is between 700 and 1200 μmol / s.

[0072] Test method: When the cucumbers grow to the 12th day, the treatment is carried out, and each group is sprayed with 1.5L of the treatment solution. After 7 days of spraying, the cucumbers are transferred to a normal temperature or low temperature environment (the control group is transferred to a normal temperature environment, and the experimental group is transferred to a low temperature environment) according to the treatment, and then the various indicators are tested after 14 days of cultivation.

[0073] The blank control group used clean water as the treatment solution, the positive control group used 1000-fold diluted paclobutrazol, and the Trichoderma fermentation solution group used the Trichoderma fermentation solution obtained by the method of Example 3.

[0074] (3) The electrolyte permeability, soluble sugar content, chlorophyll increase, root activity increase, stem diameter and dry weight of each cucumber were measured as indicators of cucumber cold resistance.

[0075] (4) Test results:

[0076] By the end of the experiment, the growth of cucumbers in the normal temperature environment was better than that in the low temperature environment (see Figure 2 ). The results of the determination of relevant indicators are shown in Table 1. Figure 2 It can be seen that in a low temperature environment, T37 fermentation liquid can significantly reduce the relative electrolyte exudation rate of cucumber, significantly increase the soluble sugar content, chlorophyll content and root activity, and has a significant growth-promoting effect, and its effect is better than that of the positive control group. The overall growth of cucumber is closer to that of a normal temperature environment. This shows that after being treated with T37 fermentation liquid, the cold tolerance of cucumber is enhanced.

[0077] Table 1 Results of cold resistance test of T37 fermentation broth

[0078]

[0079] Note: Different lowercase letters indicate significant differences after LSD test

[0080] Example 5 Determination of the antibacterial spectrum of Trichoderma thunbergii T37

[0081] (1) Test pathogens: Neoscytalidium dimidiatum, Rhizoctonia solani, Fusarium graminearum, Verticillium dahliae, Xanthomonas axonopodis pv citri

[0082] (2) Grouping: divided into blank control group and Trichoderma T37 group, with 5 replicates in each group.

[0083] (3) Test method:

[0084] Blank control group:

[0085] (Treatment of fungi) A bacterial cake (5 mm in diameter) was taken from the edge of a fungal pathogen colony activated for 3 days, placed 2.5 cm from the center of a PDA plate, and cultured at a constant temperature of 28°C.

[0086] (Bacterial treatment) 100 μL of the pathogen of citrus canker was pipetted onto the LA plate, spread evenly and allowed to dry.

[0087] Thick Trichoderma T37 group:

[0088] (Inhibitory fungal test) A cake (5 mm in diameter) was taken from the edge of a fungal pathogen colony activated for 3 days and placed 2.5 cm from the center of the PDA plate. A cake with a diameter of 5 mm was taken from a colony of Trichoderma thunbergii T37 activated for 3 days and placed in the center of the other side of the PDA plate so that the center line of the pathogen and Trichoderma thunbergii T37 passed through the center of the plate and cultured at a constant temperature of 25°C.

[0089] (Bacterial inhibition test) 100 μL of the pathogen of citrus canker was pipetted onto the LA plate, spread evenly and air-dried, and a thick Trichoderma cake with a diameter of 5 mm was placed in the center of the plate.

[0090] (4) After inoculation, the plate was inverted for culture. After 24 hours, the diameter of the pathogen / width of the inhibition zone was measured, and the inhibition rate was calculated according to the following formula. The inhibition rate calculation formula is as follows:

[0091] Inhibition rate = (blank control colony diameter - thick Trichoderma T37 colony diameter) / blank control colony diameter × 100%,

[0092] Inhibition zone width = (inhibition zone diameter - thick Trichoderma diameter) / 2,

[0093] Antagonism index = width of inhibition zone / radius of Trichoderma thunbergii.

[0094] (5) Results: The results are shown in Table 2 and Figure 3 .

[0095] Table 2 Results of antibacterial experiment of Trichoderma thunbergii T37

[0096]

[0097] From Table 2 and Figure 3 It can be obtained that Thick Trichoderma T37 has a good inhibitory effect on fungal pathogens and bacterial pathogens. In particular, the inhibition rates of Neoscytalidium dimidiatum and Verticillium dahliae, the pathogens of pitaya canker, are as high as 86.9% and 90.4%, respectively. Verticillium dahliae is the pathogen of Verticillium wilt, and the inhibition of the strain T37 of the present invention on Verticillium dahliae indicates that it can be used for the prevention and treatment of Verticillium wilt. For fungal diseases, the strain Thick Trichoderma T37 of the present invention has a good application prospect in the antibacterial of crops, especially in the anti-ulcer disease.

[0098] Further, a strain of Trichoderma harzianum was selected from the fungus library to observe its inhibitory effect on Verticillium dahliae. Figure 3 .Depend on Figure 2 It can be seen from the plate experiment in that the inhibitory effect of the strain T37 of the present invention on Verticillium dahliae is comparable to that of Trichoderma harzianum.

[0099] For the bacterial disease Xanthomonas axonopodis pv citri, the plate confrontation experiment shows that the strain T37 of the present invention can effectively inhibit Xanthomonas axonopodis pv citri.

[0100] Example 6: Indoor detached leaf test on the control of citrus canker by Trichoderma thunbergii T37

[0101] (1) Grouping: divided into blank control group, negative control group, positive control group, and Trichoderma thunbergii T37 treatment group. Each group had 3 leaves, and each leaf was pricked with 18 acupuncture points.

[0102] (2) Cultivation of the pathogen of citrus canker (Xanthomonas axonopodis pv citri): Inoculate the activated pathogen of citrus canker into LB liquid culture medium using an inoculation loop in a clean bench, and then culture it on a shaker (200 r / min, 28°C) for 24 hours. Dilute the bacterial suspension with sterile water to 1×10 8 CFU / mL is reserved.

[0103] (3) Rinse the harvested citrus leaves with tap water to remove dust from the surface, disinfect with 75% alcohol, and then wash with sterile water three times. Use a needle to pierce the citrus leaf tissue and spray the treatment solution respectively. The spray amount is based on the uniform wetting of the leaf surface.

[0104] Among them, the treatment solution of the blank control group and the negative control group was clean water, the treatment solution of the positive control group was a 1000-fold dilution of Zhongshengmycin, and the treatment solution of the Thick Trichoderma T37 group was the spore suspension prepared in Example 2.

[0105] After the treatment liquid on the leaves is air-dried, use sterile filter paper discs to absorb enough suspension of citrus canker pathogens and stick them on the acupuncture points in groups of 3, with a total of 6 filter paper discs per leaf. The treated leaves are placed on water agar culture dishes to keep them moist, placed in a 28℃ greenhouse, cultured for 16 hours under light, and then cultured for 8 hours without light. After 24 hours of treatment, the filter paper discs can be removed. The blank control group is not treated with the suspension of citrus canker pathogens.

[0106] (4) Calculation of results: After 7 days of disease occurrence in the negative control group, the disease occurrence on the leaves of each group was observed and counted, and the incidence rate and relative control efficacy were calculated. The results are shown in Table 3. Figure 4 shown.

[0107] Table 3 Results of the indoor detached leaf test on the control of citrus canker by Trichoderma thunbergii T37

[0108] Blank control Negative control group Positive control group T37 spore suspension Incidence (%) 0.0 100.0 51.9 44.4 Relative efficacy (%) \ \ 48.2 55.6

[0109] The results showed that the lesions of citrus leaf canker were significantly reduced after treatment with T37 spore suspension, indicating that TH37 spore suspension had a good preventive and therapeutic effect on citrus leaf canker.

[0110] Example 7: Field test of Trichoderma thunbergii T37 for controlling citrus canker

[0111] (1) Grouping: The cells were divided into blank control group, positive control group and Trichoderma thunbergii T37 spore suspension group.

[0112] Among them, the blank control group was also treated with clean water; the positive control group was treated with zhongshengmycin, and the application method was spraying with a 1000-fold diluted solution, and the dosage was in accordance with the product instructions; the treatment solution of the Thick Trichoderma T37 group was a 300-fold diluted solution of the TH37 spore suspension prepared in Example 2, and the application method was spraying, with a dosage of 7 g per tree.

[0113] (2) Test location: Sihui, Zhaoqing City, Guangdong Province

[0114] Test material: Mandarin orange

[0115] Test time: 2020.3.18-2020.5.1

[0116] Test method: Plan each plot to have an area of ​​18m 2 , 50 trees were treated in each group.

[0117] (3) Survey method: In accordance with the method of GB / T 35272-2017 Technical Specifications for Monitoring Citrus Canker, 10 trees were selected from each plot for each test treatment. For each tree, 20 leaves and 20 fruits were collected from the spring, summer and autumn shoots in 5 different directions: east, south, west, north and center. (If there are less than 100 fruits, all fruits on the tree were surveyed.)

[0118] (4) Test results are shown in Table 4

[0119] Table 4 Thick Trichoderma T37 for the prevention and treatment of citrus canker - field test

[0120] Clear water control Zhongshengmycin T37 spore suspension Disease index 0.35 0.08 0.11 Relative efficacy (%) / 77.1 68.6

[0121] The results showed that compared with the blank control, the disease index of citrus canker in the samples treated with Trichoderma T37 was significantly reduced, indicating that Trichoderma T37 has a good preventive effect on citrus canker.

[0122] Example 8 Trichoderma T37 root growth promotion test of pitaya

[0123] (1) Grouping: blank control group, Trichoderma treatment group, positive control group

[0124] (2) Cut the pitaya branches into stem segments of about 30 cm in length, trim the base of the pitaya until 2 to 3 cm of the wood is exposed, and then insert the cuttings into loose and breathable soil mixed with vermiculite and Cuiyun soil in a ratio of 1:1.

[0125] After cutting, the plants were placed in an artificial climate chamber (25°C, 16 h light, 8 h dark) and watered with the treatment solution on the day of cutting and on the 7th day, with 200 mL per dragon fruit. On the 20th day, the dragon fruits were pulled out and the number and length of roots were recorded.

[0126] The blank control group was treated with water, the thick Trichoderma treatment group was a 500-fold dilution of the thick Trichoderma T37 spore suspension prepared in Example 2, and the positive control group was a spore suspension of Trichoderma harzianum (spore number was 1×10 7 sp / mL) 500-fold dilution.

[0127] Each treatment was replicated three times, and each replicate had six pots with a total of six pitaya plants.

[0128] (3) Observation results: The results are shown in Table 5 and Figure 5 .

[0129] Table 5 Thick Trichoderma T37 Pitaya Growth Promotion Test - Indoor Test

[0130]

[0131] From the results, it can be seen that compared with the blank control group, the pitaya roots treated with Trichoderma T37 group were significantly longer and had significantly more roots; the results showed that Trichoderma T37 had a significant promoting effect on the rooting of pitaya.

[0132] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A Trichoderma crassum strain, characterized in that The deposit number of the strain is GDMCC No: 61066.

2. A Trichoderma spore suspension, Trichoderma fermentation liquid or fermentation powder, characterized in that: The spore suspension, Trichoderma thunbergii fermentation liquid or Trichoderma thunbergii fermentation powder is prepared from the Trichoderma thunbergii as claimed in claim 1.

3. A composition or microbial preparation, characterized in that: It comprises at least one of the following components: the Trichoderma thunbergii strain as claimed in claim 1, the Trichoderma thunbergii spore suspension as claimed in claim 2, the Trichoderma thunbergii fermentation liquid or the fermentation fungus powder.

4. Use of the Trichoderma strain as claimed in claim 1, or the Trichoderma spore suspension, Trichoderma fermentation liquid or fermentation powder as claimed in claim 2, or the composition or microbial preparation as claimed in claim 3 in promoting the root growth of crops.

5. Use of the Trichoderma strain as claimed in claim 1, or the Trichoderma spore suspension, Trichoderma fermentation liquid or fermentation powder as claimed in claim 2, or the composition or microbial preparation as claimed in claim 3 in inducing cold resistance and cold tolerance in crops.

6. Use of the Trichoderma strain according to claim 1, or the Trichoderma spore suspension, Trichoderma fermentation liquid or fermentation powder according to claim 2, or the composition or microbial preparation according to claim 3 in preventing and controlling crop diseases, wherein the crop diseases are fungal diseases and / or bacterial diseases.

7. The use according to any one of claims 4 to 6, wherein the crop is citrus, pitaya or cucumber.

8. The use according to claim 6, wherein the crop disease is at least one of damping-off, head blight, wilt and canker caused by fungi and / or bacteria.

9. The use according to claim 6, characterized in that The crop diseases include Neoscytalidium dimidiatum, Rhizoctonia solani, Fusarium graminearum, graminearum), Verticillium dahliae, and Xanthomonas Axonopodis pv citri) is a pathogenic bacteria.

10. The use according to claim 6, wherein the crop diseases include damping-off, head blight, wilt and / or canker caused by at least one of the pathogens of pitaya canker, Rhizoctonia solani, Fusarium graminearum, Verticillium dahliae and citrus canker.

11. The use according to any one of claims 4 to 6, characterized in that: The method comprises applying an effective amount of any one of the Trichoderma strain according to claim 1, the Trichoderma spore suspension, the Trichoderma fermentation liquid or fermentation powder according to claim 2, the composition or the microbial preparation according to claim 3 to crops.

12. Use of the Trichoderma strain according to claim 1, or the Trichoderma spore suspension, Trichoderma fermentation liquid or fermentation powder according to claim 2, or the composition or microbial preparation according to claim 3 in preventing and treating ulcer disease.

13. The use according to claim 12, wherein the ulcer disease is pitaya canker or citrus canker.

14. Use of the Trichoderma strain according to claim 1, or the Trichoderma spore suspension, Trichoderma fermentation liquid or fermentation powder according to claim 2, or the composition or microbial preparation according to claim 3 in the preparation of plant growth regulators, seed coating agents, microbial pesticides, microbial fertilizers, microbial powders, and microbial agents.

Images