A recombinant plasmid, genetically engineered bacteria and preparation method for biocatalytic synthesis of 5-HTP

Abstract

The present invention belongs to the field of bioengineering technology, and specifically relates to a recombinant plasmid, genetically engineered bacteria and a preparation method for biocatalytic synthesis of 5-HTP. The inventors inserted the expression genes of glucose dehydrogenase (GDH) and pterin-4α-methanolamine dehydratase (PCD), tryptophan hydroxylase (TPH) and dihydromonopterin reductase (DHPR) into a host bacterium through genetic recombination engineering, and obtained a recombinant host bacterium; the host bacterium was fermented and freeze-dried, and tryptophan and glucose were used as substrates. The above-mentioned freeze-dried bacterial agent was used for enzyme catalysis to obtain a large amount of 5-HTP, so that the synthesis amount of 5-HTP reached 30g / l; compared with the live bacteria catalysis technology, the conversion rate of 5-HTP was significantly improved.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to a recombinant plasmid, a genetic engineering bacterium and a preparation method for biocatalytically synthesizing 5-HTP. Background Art

[0002] 5-Hydroxytryptophan (5-HTP) is an amino acid substance that can be used as a precursor of 5-hydroxytryptamine (serotonin) in the human body, helping to increase 5-hydroxytryptamine levels and is clinically effective in treating depression. In addition to depression, 5-HTP has been shown to be effective in treating insomnia, fibromyalgia, obesity, cerebellar ataxia, chronic headaches, etc. In most European countries, 5-HTP is a commonly used prescription drug for a variety of therapeutic purposes. 5-HTP is also considered a potential feed additive for farm animals that can resist bovine mastitis; and has a regulatory effect on the lactation function of mammals and can increase milk production.

[0003] However, currently 5-HTP is mainly produced by extracting from the seeds of Griffonia suffruticosa, a woody climbing shrub growing in Africa. The supply of this raw material depends on the season and region, the production cost is high and the supply is limited, which limits its widespread production and clinical application.

[0004] PCT patent WO2015175793A1 discloses a method for biosynthesizing 5-HTP, wherein a modified bacterial phenylalanine-4-hydroxylase (P4H) host is constructed by genetic engineering, and P4H can catalyze the conversion of tryptophan into 5-HTP via tryptophan, and the host further includes a plasmid PhhB expressing pterin-4α-methanolamine dehydratase (PCD) and a plasmid DHPR expressing dihydromonopterin reductase (DHPR) in the MH4 recycling system. The host contains a co-MH4 recycling system, so there is no need to add expensive pterin coenzymes or precursors, and a simple renewable carbon source (glucose) can be used to achieve large-scale production of 5-HTP. However, the biosynthesis of 5-HTP mentioned above has the following problems: ① The biosynthesis process of 5-HTP mentioned above relies on live bacteria for biosynthesis, wherein tryptophan, when added as a substrate, will be consumed by live bacteria in large quantities, resulting in a decrease in the conversion rate of 5-HTP; ② The yield of tryptophan fully synthesized with glucose as a substrate and then converted to 5-HTP is not high, with the highest tryptophan yield being only 35 g / l, and the highest 5-HTP yield finally obtained being only 12 g / l; ③ Due to the continuous generation of tryptophan in the live bacteria system, tryptophan will accumulate, and the chemical and physical properties of tryptophan and 5-HTP are highly similar, which affects the separation and purification of 5-HTP; ④ In the live bacteria system, tryptophan will be utilized in a variety of ways and undergo a variety of reactions, resulting in a large number of by-products; ⑤ Since the MH4 recycling system involves the conversion process of NH2 to NH4, a large amount of NADPH is required to participate and be converted into NADP + However, NADPH in the above reaction process is obtained from the tricarboxylic acid cycle. Therefore, even if the above system is applied to the dead bacteria enzyme catalysis system, due to the limited NADPH content, the MH4 content is low and the MH4 recycling system cannot be maintained, which limits the biosynthesis of 5-HTP.

[0005] Therefore, in the process of biosynthesis of 5-HTP, how to increase the production of 5-HTP is the most concerned issue at present. The inventors simultaneously inserted the expression genes of glucose dehydrogenase (GDH), pterin-4α-carbinolamine dehydratase (PCD), tryptophan hydroxylase (TPH) and dihydromonopterin reductase (DHPR) into the host bacteria through genetic recombination engineering, and obtained a recombinant host bacteria; the host bacteria were fermented and freeze-dried, and tryptophan and glucose were used as substrates. The freeze-dried bacteria were used for enzyme catalysis to obtain a large amount of 5-HTP, so that the synthesis amount of 5-HTP reached 30g / l; compared with the live bacteria catalysis technology, the conversion rate of 5-HTP was significantly improved. Summary of the invention

[0006] The purpose of the present invention is to provide a recombinant plasmid, genetically engineered bacteria and preparation method for biocatalytic synthesis of 5-HTP; specifically, the following contents are included:

[0007] In a first aspect, the present invention provides a recombinant plasmid, comprising a pterin-4α-carbinolamine dehydratase (PC D1) gene, a dihydromonopterin reductase (DHPR) gene, a tryptophan hydroxylase (TPH) gene, and a glucose dehydrogenase (GDH) gene.

[0008] Preferably, the TPH gene is selected from the human TPH gene TPH145, or the Saccoglossus kowalevskii TPH gene TPHsk.

[0009] Preferably, the gene sequence of TPH145 is as shown in SEQ ID NO.1; the gene sequence of TPHsk is as shown in SEQ ID NO.2; the gene sequence of PCD1 is as shown in SEQ ID NO.3; the gene sequence of DHPR is as shown in SEQ ID NO.4; and the gene sequence of GDH is as shown in SEQ ID NO.5.

[0010] Preferably, the recombinant plasmid is based on pET-28a(+) plasmid, and TPH gene, PCD gene, DHPR gene, GDH gene, or a fusion gene of TPH gene, PCD1 gene, DHPR gene, GDH gene are sequentially inserted between the restriction enzyme sites NcoI and NotI of pET-28a(+).

[0011] In a second aspect, the present invention provides a method for preparing the recombinant plasmid described in the first aspect, the method comprising: inserting the TPH gene, PCD1 gene, DHPR gene, GDH gene, or a fusion gene of the TPH gene, PCD1 gene, DHPR gene, and GDH gene into a vector to obtain a recombinant plasmid containing the PCD gene, DHPR gene, TPH gene, and GDH gene.

[0012] Preferably, the method comprises the following steps:

[0013] (1) amplifying the TPH gene, PCD1 gene, DHPR gene, and GDH gene, and sequentially fusing the above genes to form a fusion gene using a fusion PCR method;

[0014] (2) Insert the fusion gene described in step (1) into the restriction enzyme cutting sites NcoI and NotI of pET-28a(+) to construct a recombinant plasmid.

[0015] Preferably, the amplification primers of the TPH gene, PCD1 gene, DHPR gene and GDH gene are respectively:

[0016] TPH145 P1:AACTTTAAGAAGGAGATATACCATGGGCatggaagaactggaagatgtgcc;

[0017] TPH145 P2:caggcgatgtgctttaccggccatatgtatatctccttcttaaagttaaacaaattacacgttttcaatgctgcgggtatc tttca;

[0018] TPHsk P1:TTTTGTTTAACTTTAAGAAGGAGATATACCATGGGCatgctgaccgcgaagaaag;

[0019] TPHsk P2:cgctcaggcgatgtgctttaccggccatatgtatatctccttcttaaagttaaacaaattaagactgtaacttctccaacgc gctactt;

[0020] PCD1 P1:tgaaagatacccgcagcattgaaaacgtgtaatttgtttaactttaagaaggagatatacatatggccggtaaagcacat cgcctg;

[0021] PCD1 P2:ctgctgccgctgccatagttaatttctcctctttaatttaggtcatactaactgccacctgttcaataa;

[0022] DHPR P1:ttattgaacaggtggcagttagtatgacctaaattaaagaggagaaattaactatggcagcggcagcag;

[0023] DHPR2 P2:TTTCCTTTTAAGTCCGGGTACATatgtatatctccttctta;

[0024] GDH P1:ggccgcaccgaactgaccccggcgtatttttaatttgtttaactttaagaaggagatatacatATGTACCCGGAC TTAAAAGGAAA;

[0025] GDH P2: TGGTGGTGCTCGAGTgcggccgcttaGCCACGACCTGCCTGG.

[0026] In a third aspect, the present invention provides a recombinant genetically engineered bacterium containing the recombinant plasmid described in the first aspect.

[0027] Preferably, the method for preparing the recombinant genetically engineered bacteria is: introducing the recombinant plasmid described in the first aspect into a host cell to obtain the recombinant genetically engineered bacteria.

[0028] Preferably, the host cell includes Escherichia coli, Bacillus subtilis, and Corynebacterium glutamicum.

[0029] In a fourth aspect, the present invention provides use of the recombinant plasmid described in the first aspect or the recombinant genetically engineered bacteria described in the third aspect in catalyzing the preparation of 5-HTP from tryptophan.

[0030] In a fifth aspect, the present invention provides an enzyme catalyst for catalyzing the preparation of 5-HTP from tryptophan, wherein the enzyme catalyst comprises the recombinant plasmid described in the first aspect or the recombinant genetically engineered bacteria described in the third aspect.

[0031] In a sixth aspect, the present invention provides a method for catalyzing tryptophan to prepare 5-HTP, the method comprising:

[0032] (1) fermenting the recombinant genetically engineered bacteria described in the third aspect, centrifuging the fermentation liquid and then freeze-drying it to obtain freeze-dried bacteria;

[0033] (2) using tryptophan as a substrate and glucose as a co-substrate, adding the freeze-dried bacteria described in step (1), and catalyzing the reaction in a reaction system at a pH of 9-9.5;

[0034] (3) After the reaction is complete, the reaction solution is separated and purified to obtain 5-HTP.

[0035] Preferably, a preservative is also added in step (2).

[0036] Preferably, the preservative is sodium benzoate and / or potassium trichlorate.

[0037] Preferably, the concentration ratio of the freeze-dried bacteria to tryptophan added in step (2) is 100:35-50.

[0038] In a seventh aspect, the present invention provides a method for preparing an enzyme catalyst, the method comprising: fermenting the recombinant genetically engineered bacteria described in the third aspect, and centrifuging or freeze-drying the fermentation liquid to obtain the enzyme catalyst.

[0039] The beneficial effects of the present invention are as follows: the present invention simultaneously inserts the expression gene of glucose dehydrogenase (GDH) and the expression genes of tryptophan hydroxylase (TPH), pterin-4α-carbinolamine dehydratase (PCD1), and dihydromonopterin reductase (DHPR) into a host bacterium through gene recombination engineering, thereby obtaining a recombinant host bacterium; the host bacterium is fermented and freeze-dried, and tryptophan and glucose are used as substrates, and the freeze-dried bacterial agent is used for enzyme catalysis to obtain a large amount of 5-HTP, so that the synthesis amount of 5-HTP reaches as high as 30g / l; compared with the live bacteria catalysis technology, the conversion rate of 5-HTP is significantly improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 The result diagram of the construction of the recombinant plasmid of the human TPH catalytic system;

[0041] Figure 2 Diagram of the construction results of the Saccoglossus kowalevskii TPH catalytic system. DETAILED DESCRIPTION

[0042] The present invention is described in detail below through specific embodiments. Any technical solutions that can be conceived by any technician in the field based on the present invention and combined with the common knowledge in the field belong to the protection scope of the present invention.

[0043] Example 1 Construction of recombinant genetically engineered bacteria

[0044] 1. Construction of recombinant plasmid

[0045] (1) Construction of human TPH catalytic system:

[0046] Primers were used to amplify the TPH145 gene (shown in SQE ID NO.1), PCD1 gene (shown in SQE ID NO.3), DHPR gene (shown in SQE ID NO.4), and GDH gene (shown in SQE ID NO.5), respectively. The specific primers are as follows:

[0047] TPH145 P1: AACTTTAAGAAGGAGATATACCATGGGCatggaagaactggaagatgtgcc (shown in SQE IDNO.6);

[0048] TPH145 P2: caggcgatgtgctttaccggccatatgtatatctccttcttaaagttaaacaaattacacgttttcaatgctgcgggtatc tttca (shown in SQE ID NO.7);

[0049] PCD1 P1: tgaaagatacccgcagcattgaaaacgtgtaatttgtttaactttaagaaggagatatacatatggccggtaaagcacat cgcctg (shown in SQE ID NO. 8);

[0050] PCD1 P2: ctgctgccgctgccatagttaatttctcctctttaatttaggtcatactaactgccacctgttcaataa (shown in SQE ID NO.9);

[0051] DHPR P1: ttattgaacaggtggcagttagtatgacctaaattaaagaggagaaattaactatggcagcggcagcag (shown in SQE ID NO. 10);

[0052] DHPR2 P2: TTTCCTTTTAAGTCCGGGTACATatgtatatctccttctta (shown in SQE ID NO.11);

[0053] GDH P1: ggccgcaccgaactgaccccggcgtatttttaatttgtttaactttaagaaggagatatacatATGTACCCGGAC TTAAAAGGAAA (shown in SQE ID NO. 12);

[0054] GDH P2: TGGTGGTGCTCGAGTgcggccgcttaGCCACGACCTGCCTGG (shown in SQE ID NO. 13).

[0055] The TPH145 gene, PCD1 gene, DHPR gene and GDH gene were fused in sequence using the fusion PCR method to form a 3kbp fusion gene fragment.

[0056] pET28 was digested with NcoI+NotI, and the constructed fusion gene fragment was inserted between the restriction sites NcoI and NotI of pET28 to obtain the human TPH catalytic recombinant plasmid. The specific construction results are shown in Figure 1 shown.

[0057] (2) Construction of Saccoglossus kowalevskii TPH catalytic system:

[0058] The specific construction refers to the human TPH catalytic system in (1), wherein the TPH145 gene is replaced by the TPHsk gene (shown in SQE ID NO.2), and the primers involved are:

[0059] TPHsk P1: TTTTGTTTAACTTTAAGAAGGAGATATACCATGGGCatgctgaccgcgaagaaag (shown in SQEID NO.14);

[0060] TPHsk P2: cgctcaggcgatgtgctttaccggccatatgtatatctccttcttaaagttaaacaaattaagactgtaacttctccaacgc gctactt (shown in SQE ID NO. 15).

[0061] The specific construction results are as follows Figure 2 shown.

[0062] 2. Construction of recombinant genetically engineered bacteria

[0063] The constructed plasmids were directly transformed into Escherichia coli BL21 (DE3) to obtain recombinant engineering strains.

[0064] 3. Fermentation Protocol of Recombinant Engineering Strains

[0065] Basic culture medium: yeast powder 24g / L; peptone 12g / L; potassium hydrogen phosphate (trihydrate) 12.54g / L; potassium dihydrogen phosphate 2.31g / L; glycerol 5g / L; magnesium sulfate (heptahydrate) 0.5g / L

[0066] Feed: Yeast powder 160g / L; Peptone 80g / L; Glycerol 300g / L; Magnesium sulfate 20g / L

[0067] Primary seed LB, cultured overnight at 37°C;

[0068] Secondary seed 2×YT, inoculated with 2%, incubated at 37°C for 5 h;

[0069] The fermenter inoculation rate is 3.3%;

[0070] The initial temperature was 37°C, and feeding was performed after the carbon source was exhausted. The fermentation volume was 20 mL / h / L, and the OD during feeding was about 15. When the OD grew to 25-30, the temperature was lowered by 22°C, the feeding rate was reduced to 10 mL / h / L, and 0.2 mM iptg was added for induction. The induction was continued for about 18 hours and the tank was released.

[0071] Example 2 Biosynthesis of 5-HTP

[0072] 1. Catalytic solution:

[0073] 50mM HEPES / NaOH, pH 7.2, 200mM (NH4)2SO4, 7mM dithiothreitol (DTT), 50μM (NH4)2Fe(SO4)2, and 0.025g / L catalase were added to a final concentration of 40g / L tryptophan and 5g / L of fermented wet bacteria at 37°C for 24h before catalysis was completed.

[0074] 2. Results

[0075] The recombinant engineering strain constructed with the human tryptophan hydroxylase gene (TPH145) biocatalytically synthesized 5-HTP at a high level of 9.4 g / L; while the recombinant engineering strain constructed with the Saccoglossus kowalevskii tryptophan hydroxylase gene (TPHsk) biocatalytically synthesized 5-HTP at a level 3.2 times that of the human tryptophan hydroxylase gene (TPH145), with a 5-HTP synthesis rate of 30 g / L.

Claims

1. A recombinant plasmid, characterized in that: The recombinant plasmid uses pET-28a (+) plasmid as a vector, and inserts a fusion gene of TPHsk gene, PCD1 gene, DHPR gene and GDH gene between the restriction enzyme cutting sites NcoI and NotI of pET-28a (+); the gene sequence of TPHsk is shown in SEQ ID NO.2; the gene sequence of PCD1 is shown in SEQ ID NO.3; the gene sequence of DHPR is shown in SEQ ID NO.4; and the gene sequence of GDH is shown in SEQ ID NO.

5.

2. The method for preparing a recombinant plasmid according to claim 1, characterized in that: The method comprises the following steps: (1) Amplify the TPHsk gene, PCD1 gene, DHPR gene, and GDH gene, and use the fusion PCR method to fuse the above genes in sequence to form a fusion gene; (2) Insert the fusion gene described in step (1) between the restriction enzyme cutting sites NcoI and NotI of pET-28a (+) to construct a recombinant plasmid.

3. A recombinant genetically engineered bacterium containing the recombinant plasmid according to claim 1.

4. Use of the recombinant plasmid according to claim 1 or the recombinant genetically engineered bacteria according to claim 3 in catalyzing the production of 5-HTP from tryptophan.

5. An enzyme catalyst for catalyzing the preparation of 5-HTP from tryptophan, characterized in that: The enzyme catalyst comprises the enzyme produced by the recombinant plasmid according to claim 1 or the enzyme produced by the recombinant genetically engineered bacteria according to claim 3.

Images