A Streptomyces albulus genetic engineering bacterium and its application

Abstract

The present invention relates to biotechnology, and particularly to a Streptomyces albidoflavus genetic engineering bacterium and its application in the production of serotonin and N-acetylserotonin. The engineering bacterium uses Streptomyces albidoflavus as the starting strain and integrates one or several genes of the endogenous tryptophan decarboxylase (TDC) gene, the heterologous tryptophan transporter (Mtr) gene, and the heterologous tryptophan hydroxylase (Luz15) gene. The Streptomyces albidoflavus constructed in the present invention does not depend on inducers and antibiotics, and at the same time, this strain does not belong to conditional pathogenic bacteria, has a low conversion cost, a high product yield, and can be safely used for large-scale production.

Description

[0001] This application is a divisional application of a Chinese invention patent application. The original application date was February 21, 2024, the application number was 202410190543.8, and the invention title was: A Streptomyces albidoflavus genetic engineering bacterium and its application. The publication number was: CN117736960A; due to the unity problem pointed out by the examiner in the original application, the applicant filed a divisional application. Technical Field

[0002] The present invention relates to the field of biotechnology, and specifically relates to a Streptomyces albidoflavus genetic engineering bacterium and its application in the production of serotonin and N-acetylserotonin. Background Art

[0003] The intermediate metabolites in the biosynthetic pathway of melatonin synthesis from tryptophan are serotonin and N-acetylserotonin. Among them, serotonin, also known as 5-hydroxytryptamine, was first discovered in serum and is widely present in mammalian tissues, especially at a relatively high concentration in the brain tissue. It is an important substance for regulating nerve activities. Serotonin has functions such as vasoconstriction, mood regulation, and prevention of brain aging, and is a type of antidepressant. And N-acetylserotonin is a small molecule compound existing in nature and is an intermediate in the endogenous synthesis reaction from serotonin to melatonin. Similar to melatonin, N-acetylserotonin is also an agonist of melatonin receptors MT1, MT2, and MT3, and is considered a neurotransmitter, which has direct significance for studying the receptor affinity and antagonistic effects of MT. N-acetylserotonin also has antioxidant, anti-inflammatory, and neuroprotective effects and has been used to treat neuronal cells and is a new type of clinical drug.

[0004] Currently, the production process of serotonin is mainly chemical synthesis. The synthetic process flow is long, the types of raw materials used are numerous, and there are disadvantages such as harsh reaction conditions and a large amount of waste. The production method of N-acetylserotonin is mainly chemical method. Starting from serotonin as the reaction starting material and using acetic anhydride as the acetylation reagent, it is synthesized through two-step reactions, and impurities N,O-diacetylserotonin will be generated simultaneously, resulting in complex post-treatment, low yield, and poor product quality. The biosynthesis of serotonin and N-acetylserotonin is environmentally friendly and has broad application prospects.

[0005] Chinese Patent Application CN202111391114.X discloses an engineered strain for the microbial synthesis of serotonin using 5-hydroxytryptophan as a substrate, its construction and application. This method uses Escherichia coli as the chassis microorganism and heterologously expresses five 5-hydroxytryptophan decarboxylases from different sources using a plasmid expression system. After IPTG induction, the substrate 5-hydroxytryptophan, coenzyme pyridoxal phosphate, and cell permeabilizer are added for biotransformation, and the final yield of serotonin is 31.9 g / L. Chinese Patent Application CN202110800209.6 discloses a synthesis process for melatonin intermediate N-acetylserotonin. This method uses serotonin as a substrate and uses chemical reagents such as dichloromethane, triethylamine, and acetyl chloride for synthesis, which is not environmentally friendly.

[0006] Existing chemical production methods for serotonin and N-acetylserotonin use a large amount of organic reagents and are not environmentally friendly. Existing biosynthesis technologies for serotonin and N-acetylserotonin both use the conditional pathogen Escherichia coli for production, posing safety hazards; both use plasmid systems to heterologously express related genes, and their stability is difficult to guarantee; inducer and antibiotics need to be added during biotransformation, resulting in increased production costs, and the final yield of N-acetylserotonin is low.

[0007] The purpose of the present invention is to provide a Streptomyces albulus gene engineering bacterium and its application in the production of serotonin and N-acetylserotonin.

[0008] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0009] A Streptomyces albulus gene engineering bacterium integrates one or several genes of endogenous N-acetyltransferase (SNAT) gene, endogenous tryptophan decarboxylase (TDC) gene, heterologous tryptophan transporter (Mtr) gene, and heterologous tryptophan hydroxylase (Luz15) gene using Streptomyces albulus as the starting strain.

[0010] The starting strain is Streptomyces albulus CICC 11022; the N-acetyltransferase (SNAT) gene and tryptophan decarboxylase (TDC) gene are derived from the starting strain; the heterologous tryptophan transporter (Mtr) gene comes from Escherichia coli MG1655; the tryptophan hydroxylase (Luz15) gene comes from Actinomadura luzonensis DSM43766.

[0011] The Streptomyces albulus gene engineering bacterium inserts the endogenous tryptophan decarboxylase (TDC) gene into the chromosome of the starting strain;

[0012] The genetically engineered Streptomyces albidoflavus bacterium is obtained by inserting the endogenous tryptophan decarboxylase (TDC) gene and N-acetyltransferase (SNAT) gene into the chromosome of the starting strain;

[0013] The genetically engineered Streptomyces albidoflavus bacterium is obtained by inserting the endogenous tryptophan decarboxylase (TDC) gene, the heterologous tryptophan transporter (Mtr) gene, and the heterologous tryptophan hydroxylase (Luz15) gene into the chromosome of the starting strain;

[0014] Or, the genetically engineered Streptomyces albidoflavus bacterium is obtained by inserting the endogenous tryptophan decarboxylase (TDC) gene and N-acetyltransferase (SNAT) gene, the heterologous tryptophan transporter (Mtr) gene, and the heterologous tryptophan hydroxylase (Luz15) gene into the chromosome of the starting strain.

[0015] A method for constructing the above-mentioned genetically engineered Streptomyces albidoflavus bacterium, using PCR technology and restriction enzyme digestion methods to linearize a vector containing the constitutive strong promoter Sp43 and the ribosome binding site sequence SR40, and the recovered product is a linearized vector fragment; using seamless cloning method to ligate and transform one or several gene fragments of the endogenous N-acetyltransferase (SNAT) gene, endogenous tryptophan decarboxylase (TDC) gene, heterologous tryptophan transporter (Mtr) gene, and heterologous tryptophan hydroxylase (Luz15) gene with the above linearized vector fragment to obtain a recombinant expression vector; transferring the recombinant expression vector into Escherichia coli ET12567 / pUZ8002 first, and then using the conjugation transfer method to transfer it onto the chromosome of the wild-type Streptomyces albidoflavus bacterium CICC 11022 to obtain the engineered strain.

[0016] The engineered strain is obtained by digesting the vector pSET152-Sp43-SR40-pls containing the constitutive strong promoter Sp43 and the ribosome binding site sequence SR40 with EcoR I and Nde I to obtain a linearized vector fragment, ligating it with the endogenous tryptophan decarboxylase (TDC) gene through Infusion seamless cloning technology to obtain the recombinant expression plasmid pSET152-TDC; transferring the obtained recombinant expression plasmid pSET152-TDC into Escherichia coli ET12567 / pUZ8002, and then using the conjugation transfer method to transfer it into the wild-type Streptomyces albidoflavus bacterium CICC 11022 to integrate pSET152-TDC into the chromosome of this strain to obtain the TDC-expressing engineered strain (Streptomyces albidoflavus Q-TDC).

[0017] The engineered strain was obtained by digesting the vector pSET152-TDC with EcoR I to obtain a linearized fragment, which was ligated to the endogenous N-acetyltransferase (SNAT) gene through Infusion seamless cloning technology to obtain the recombinant expression plasmid pSET152-TDC-SNAT. The expression plasmid pSET152-TDC-SNAT was transferred into Escherichia coli ET12567 / pUZ8002, and then transferred into the wild strain of Streptomyces albus CICC 11022 by conjugation transfer method, so that pSET152-TDC-SNAT was integrated into the chromosome of this strain to obtain an engineered strain co-expressing TDC and SNAT (Streptomyces albus Q-TDC-SNAT).

[0018] The engineered strain was obtained by ligating the heterologous tryptophan transporter (Mtr) gene and the heterologous tryptophan hydroxylase (Luz15) gene to the linearized plasmid p3SV-ths to obtain the recombinant expression plasmid p3SV-ths-Mtr-Luz15. p3SV-ths-Mtr-Luz15 was transferred into the above-mentioned Streptomyces albus Q-TDC by conjugation transfer, so that p3SV-ths-Mtr-Luz15 was integrated into the chromosome of this strain to obtain a genetically engineered bacterium with co-high expression of TDC, Mtr and Luz15 (Streptomyces albus Q-TDC-Mtr-Luz15).

[0019] The engineered strain was obtained by transferring p3SV-ths-Mtr-Luz15 into the above-mentioned Streptomyces albus Q-TDC-SNAT by conjugation transfer, so that p3SV-ths-Mtr-Luz15 was integrated into the chromosome of this strain to obtain a genetically engineered bacterium with co-high expression of TDC, SNAT, Mtr and Luz15 (Streptomyces albus Q-TDC-SNAT-Mtr-Luz15).

[0020] An application of the above-mentioned genetically engineered bacterium of Streptomyces albus, the application of the engineered bacterium in the production of serotonin or N-acetylserotonin.

[0021] The application of the engineered bacterium in the production of serotonin using 5-hydroxytryptophan or tryptophan as a substrate; or, the application of the engineered bacterium in the production of N-acetylserotonin using 5-hydroxytryptophan, tryptophan or serotonin as a substrate.

[0022] Furthermore, each engineered strain was first cultured on an MS solid plate for 6-8 days, the spores were collected and transferred to an M3G medium for culturing for 24 hours, and then transferred to a fresh M3G medium at an inoculation amount of 10% and continued to be cultured for 36 hours. When the OD600 of the strain was 8-12, the supernatant was removed and the cells were collected.

[0023] Subsequently, the obtained bacterial solutions were cultured in M9Y transformation medium until the OD value of the bacterial solution was adjusted to 20 - 100, and then different substrates were added for transformation to obtain the corresponding products.

[0024] Advantages of the present invention:

[0025] The present invention first constructed strains capable of efficiently synthesizing serotonin or N - acetylserotonin using Streptomyces as a chassis. Among them, the strain for synthesizing N - acetylserotonin integrated the endogenous N - acetyltransferase (SNAT) gene and tryptophan decarboxylase (TDC) gene of the strain, as well as the heterologous tryptophan transporter (Mtr) gene and tryptophan hydroxylase (Luz15) gene on the genome of Streptomyces albidoflavus, and achieved constitutive high - expression of the four genes. The constructed Streptomyces albidoflavus genetic engineering strain Q - TDC - SNAT - Mtr - Luz15 can efficiently synthesize N - acetylserotonin using serotonin, 5 - hydroxytryptophan or tryptophan as substrates.

[0026] The strain for synthesizing serotonin integrated the endogenous tryptophan decarboxylase (TDC) gene of the strain, as well as the heterologous tryptophan transporter (Mtr) gene and tryptophan hydroxylase (Luz15) gene on the genome of Streptomyces albidoflavus, and achieved constitutive high - expression of the three genes. The constructed Streptomyces albidoflavus genetic engineering strain Q - TDC - Mtr - Luz15 can synthesize serotonin using 5 - hydroxytryptophan or tryptophan as substrates.

[0027] The Streptomyces albidoflavus genetic engineering bacteria constructed in the present invention do not rely on inducers and antibiotics. At the same time, the strains are not conditional pathogenic bacteria, with low transformation costs, high product yields, and can be safely used for large - scale production, and there is also an obvious advantage in the yield of N - acetylserotonin. Description of the Drawings

[0028] Figure 1 Schematic diagram of the pSET152 - Sp43 - SR40 - pls plasmid constructed in the embodiment of the present invention.

[0029] Figure 2 Effect diagram of the expression level of the TDC gene in the genetic engineering strain Streptomyces albidoflavus Q - TDC and the starting strain CICC11022 provided in the embodiment of the present invention.

[0030] Figure 3 Schematic diagram of the genome - integrated plasmid constructed in the embodiment of the present invention, where A, pSET152 - TDC; B, pSET152 - SNAT; C, pSET152 - TDC - SNAT; D, p3SV - ths - Mtr - Luz15.

[0031] Figure 4The expression level effect diagram of the SNAT gene in the genetically engineered strain Streptomyces albidoflavus Q-TDC-SNAT provided by the embodiments of the present invention and the starting strain CICC11022.

[0032] Figure 5 Schematic diagram of the expression plasmid p3SV-ths provided by the embodiments of the present invention.

[0033] Figure 6 The expression effect diagram of the Mtr gene and the Luz15 gene in the genetically engineered strain Streptomyces albidoflavus Q-TDC-Mtr-Luz15 provided by the embodiments of the present invention and the control strain.

[0034] Figure 7 The genetically engineered strain Streptomyces albidoflavus provided by the embodiments of the present invention

[0035] The expression effect diagram of the Mtr gene and the Luz15 gene in Q-TDC-SNAT-Mtr-Luz15 and the control strain.

[0036] Figure 8 The corresponding diagram of the substrate and product of the Streptomyces albidoflavus genetically engineered bacteria constructed in the present invention.

[0037] Figure 9 The effect diagram of using Streptomyces albidoflavus Q-TDC to produce serotonin with 5-hydroxytryptophan as the substrate in the embodiments of the present invention.

[0038] Figure 10 The effect diagram of using Streptomyces albidoflavus Q-TDC-SNAT to produce N-acetylserotonin with serotonin as the substrate in the embodiments of the present invention.

[0039] Figure 11 The effect diagram of using Streptomyces albidoflavus Q-TDC-SNAT to produce N-acetylserotonin with 5-hydroxytryptophan as the substrate in the embodiments of the present invention.

[0040] Figure 12 The effect diagram of using Streptomyces albidoflavus Q-TDC-Mtr-Luz15 to produce serotonin with tryptophan as the substrate in the embodiments of the present invention.

[0041] Figure 13 The effect diagram of using Streptomyces albidoflavus Q-TDC-SNAT-Mtr-Luz15 to produce N-acetylserotonin with tryptophan as the substrate in the embodiments of the present invention. Detailed implementation manners

[0042] The following further illustrates the detailed implementation manners of the present invention in conjunction with examples. It should be noted that the detailed implementation manners described here are only for explaining and interpreting the present invention and are not limited to the present invention.

[0043] The Streptomyces albulus Q-TDC-SNAT-Mtr-Luz15 constructed in the present invention can synthesize N-acetylserotonin using tryptophan or 5-hydroxytryptophan as a substrate, with a yield of up to 9.2 g / L and a conversion rate of over 90%. The constructed Streptomyces albulus

[0044] Q-TDC-Mtr-Luz15 can synthesize serotonin using tryptophan or 5-hydroxytryptophan as a substrate, with a yield of up to 9.6 g / L and a conversion rate of over 95%.

[0045] The experimental raw materials not specifically indicated in the following examples are all commercially available. The starting strain in the examples is the wild Streptomyces albulus CICC 11022, which is purchased from the China Center for Industrial Culture Collection of Microorganisms.

[0046] Example 1 Construction of a genetically engineered strain of Streptomyces albulus with high TDC expression

[0047] Using the genome of Streptomyces albulus CICC11022 as a template, the TDC gene fragment was amplified using primers TDC-F and TDC-R.

[0048] The primer sequences are as follows:

[0049] TDC-F: TCAAAGGAGTGTCCATATGAAGCCCGCTGACGCGAAACCGCC

[0050] TDC-R: TATGACATGATTACGAATTCCTACTCGGGCAGCGCATCAGCCG

[0051] The PCR conditions are as follows: 95°C for 15 s, 55°C for 15 s, and 72°C for 2 min, repeated for 30 cycles. The size of the TDC gene is 1470 bp (see the sequence listing).

[0052] The vector pSET152-Sp43-SR40-pls containing the constitutive strong promoter Sp43 and the ribosome binding site sequence SR40 was digested with EcoR I and Nde I (this vector was obtained by double-digesting the known commercially available vector pSET152 with XbaI and EcoRI and then ligating it with the chemically synthesized Sp43-SR40 sequence and the polylysine synthase gene pls amplified by PCR (see Figure 1), the obtained vector framework is about 5.8 kb. It is ligated with the PCR product (TDC) by Infusion seamless cloning technology and transformed into Escherichia coli DH5α. The correctly ligated transformants are screened and verified by sequencing. The recombinant expression plasmid is named pSET152-TDC, and the plasmid map is as Figure 3 shown in A.

[0053] Subsequently, the obtained plasmid pSET152-TDC was transferred into Escherichia coli ET12567 / pUZ8002, and then transferred into the wild-type Streptomyces albulus CICC 11022 by conjugation, so that pSET152-TDC was integrated into the attB site of the chromosome of this strain. The obtained TDC-expressing strain was named Streptomyces albulus Q-TDC.

[0054] The specific steps of conjugation are as follows: Pick a single colony of the donor bacterium Escherichia coli ET12567 / pUZ8002 containing pSET152-TDC into an LB medium containing 50 μg / mL kanamycin, 50 μg / mL chloramphenicol, and 50 μg / mL apramycin, and culture at 37 °C until the OD600 reaches 0.6. Collect the bacteria, wash the bacteria 3 times with fresh LB medium, and finally resuspend with 200 μL of LB for later use. Suspend the spores of Streptomyces albulus CICC11022 in 400 μL of 2×YT medium (16 g / L tryptone, 10 g / L yeast extract, 5 g / L sodium chloride), heat shock at 50 °C for 10 minutes, cool to room temperature, mix with the prepared donor bacteria, and culture with shaking (100 rpm) at 30 °C for 1 hour. Centrifuge, discard part of the supernatant, and spread on an MS solid medium (20 g / L mannitol, 20 g / L soybean powder, 20 g / L agar powder). After 14 hours, cover with 1 mL of sterile water containing 80 μg / mL apramycin and 25 μg / mL nalidixic acid, and place at 30 °C. After 2 days of culture, resistant conjugation spores can be seen. Culture the spores to obtain the genetically engineered strain Streptomyces albulus Q-TDC.

[0055] The expression levels of the TDC gene in Streptomyces albulus Q-TDC and the parental strain CICC11022 were compared using real-time fluorescence quantitative PCR (qRT-PCR). The above two strains were respectively fermented in M3G medium (50 g / L glucose, 5 g / L yeast powder, 10 g / L ammonium sulfate, 0.8 g / L dipotassium hydrogen phosphate, 1.36 g / L potassium dihydrogen phosphate, 0.04 g / L zinc sulfate heptahydrate, 0.5 g / L magnesium sulfate heptahydrate, 0.03 g / L ferrous sulfate heptahydrate, pH 6.5) for 48 hours, and then samples were collected. Total RNA was extracted, reverse transcribed to obtain cDNA, and qRT-PCR was performed. The PCR experimental conditions were as follows: 95°C for 10 s, 60°C for 30 s, with 40 repeated cycles. The RNA polymerase sigma factor (hrdB) was selected as the reference gene. The primers used for qRT-PCR were as follows:

[0056] RT-TDC-F: AGCAGATGCTGGACTGGTTC

[0057] RT-TDC-R: TGAGCAATGCCACCAGGAG

[0058] RT-hrdB-F: CTGACCAGATTCCGCCAACCC

[0059] RT-hrdB-R: GCCTCTGCGGCACTGACCAT

[0060] All qRT-PCR runs were performed with three biological and three technical replicates, and the expression data of the relevant genes were analyzed by the 2 -ΔΔCt method. The results showed that the expression level of the TDC gene in the genetically engineered strain Streptomyces albulus Q-TDC was about 9000 times that in the parental strain CICC11022 (see Figure 2 ). This result indicated that the genetically engineered strain Streptomyces albulus Q-TDC with high expression of TDC was successfully constructed.

[0061] Example 2 Construction of the genetically engineered strain Streptomyces albulus Q-TDC-SNAT with co-high expression of TDC and SNAT

[0062] Using the plasmid pSET152-Sp43-SR40-pls as a template, the constitutive strong promoter Sp43 and the ribosome binding site sequence SR40 were amplified using the primers Sp43-SR40-F and Sp43-SR40-R. Using the genome of Streptomyces albulus CICC11022 as a template, the SNAT gene fragment was amplified using the primers SNAT-F and SNAT-R.

[0063] The primer sequences were as follows:

[0064] Sp43-SR40-F: gcgctgcccgagtaggaattcTGTTCACATTCGAACCGTCTCTG

[0065] Sp43-SR40-R: ggtgttcatATGGACACTCCTTTGACAAGTCTAGT

[0066] SNAT-F: ggagtgtccatATGAACACCTTCCGGACCG

[0067] SNAT-R: ctatgacatgattacgaattcTCAGTCGCAGTGGTCATGGA

[0068] The PCR conditions were as follows: 95°C for 15 s, 55°C for 15 s, and 72°C for 1 min, with 30 cycles repeated. The size of the Sp43-SR40 sequence was 96 bp, and the size of the SNAT gene was 549 bp (see Sequence Listing). The vector pSET152-TDC was digested with EcoR I enzyme, and the resulting vector framework size was approximately 7.2 kb. The vector framework was ligated to the PCR product (SNAT) by Infusion seamless cloning technology and transformed into Escherichia coli DH5α. The correctly ligated transformants were screened and verified by sequencing. The recombinant expression plasmid was named pSET152-TDC-SNAT, and the map was as shown in Figure 3 shown in C. First, the expression plasmid pSET152-TDC-SNAT was transferred into Escherichia coli ET12567 / pUZ8002, and then it was transferred into the wild-type Streptomyces albus CICC 11022 by conjugation transfer method, so that pSET152-TDC-SNAT was integrated into the attB site of the chromosome of this strain. The obtained strain co-expressing TDC and SNAT was named Streptomyces albus Q-TDC-SNAT.

[0069] The real-time fluorescence quantitative PCR (qRT-PCR) method was used to compare the expression levels of the SNAT gene in Streptomyces albus Q-TDC-SNAT and the control strain CICC11022. Samples were collected after fermentation for 48 hours according to the fermentation conditions described in Example 1, total RNA was extracted, and cDNA was obtained by reverse transcription for qRT-PCR. The PCR experimental conditions were as follows: 95°C for 10 s, 60°C for 30 s, with 40 repeated cycles. The RNA polymerase sigma factor (hrdB) was selected as the reference gene. The primers used for qRT-PCR were as follows:

[0070] RT-SNAT-F: GCACTCCGCACTACTACCTC

[0071] RT-SNAT-R: GATGAGGTCGGAGAGCATCC

[0072] RT-hrdB-F: CTGACCAGATTCCGCCAACCC

[0073] RT-hrdB-R: GCCTCTGCGGCACTGACCAT

[0074] All qRT-PCR runs were performed with three biological and three technical replicates. The expression data of related genes were analyzed by the 2 -ΔΔCt method, and the expression level of the SNAT gene in the genetically engineered strain Streptomyces albidoflavus Q-TDC-SNAT was more than 50,000 times that in the control strain CICC11022 (see Figure 4 ). This result indicates that the genetically engineered strain Streptomyces albidoflavus Q-TDC-SNAT with co-high expression of TDC and SNAT was successfully constructed.

[0075] Example 3 Construction of the genetically engineered strain Streptomyces albidoflavus Q-TDC-Mtr-Luz15 with co-high expression of TDC, Mtr and Luz15

[0076] Chemically synthesize the constitutive strong promoter SP43, ribosome binding site sequence SR40 and the codon-optimized tryptophan transporter (Mtr) gene from Escherichia coli MG1655, and at the same time chemically synthesize the constitutive strong promoter SP43, ribosome binding site sequence SR40 and the codon-optimized tryptophan hydroxylase (Luz15) gene from Actinomadura luzonensis DSM43766.

[0077] Connect the above two synthesized expression cassettes to the expression plasmid p3SV-ths (this plasmid vector was donated by Lou Chunbo of the Institute of Microbiology, Chinese Academy of Sciences (see Figure 5 )) to obtain the expression plasmid p3SV-ths-Mtr-Luz15 (see D in Figure 3 ). Use conjugation to transfer p3SV-ths-Mtr-Luz15 into the previously constructed genetically engineered strain Streptomyces albidoflavus Q-TDC to obtain the genetically engineered strain Streptomyces albidoflavus Q-TDC-Mtr-Luz15 with co-high expression of the three genes TDC, Mtr and Luz15 on the Streptomyces albidoflavus genome.

[0078] The expression levels of Mtr and Luz15 genes in Streptomyces albidoflavus Q-TDC-SNAT and the control strain Q-TDC were compared using real-time fluorescence quantitative PCR (qRT-PCR). Samples were collected after 48 hours of fermentation, total RNA was extracted, cDNA was obtained by reverse transcription, and qRT-PCR was performed. The PCR experimental conditions were as follows: 95°C for 10 s, 60°C for 30 s, with 40 repeated cycles. The RNA polymerase sigma factor (hrdB) was selected as the reference gene. The genes and primers used for qRT-PCR were as follows:

[0079] RT-Mtr-F: TGGTTCTTCTGGAGCATGGC

[0080] RT-Mtr-R: CCGATGCGGTAGTTCAGGTT

[0081] RT-Luz15-F: CGTCTCTGCTTTGACACGGA

[0082] RT-Luz15-R: GCGCATGACACTCCTTTGAC

[0083] All qRT-PCR runs were performed with three biological and three technical replicates. The expression data of related genes were analyzed by the 2 -ΔΔCt method, and the results showed that the expression level of the Mtr gene in the genetically engineered strain Streptomyces albidoflavus Q-TDC-Mtr-Luz15 was more than 5000 times that of the control strain, and the expression level of the Luz15 gene was more than 10000 times that of the control strain (see Figure 6 ). This result indicates that the genetically engineered strain Streptomyces albidoflavus Q-TDC-Mtr-Luz15 with co-high expression of TDC, Mtr, and Luz15 was successfully constructed.

[0084] Example 4 Construction of the genetically engineered strain Streptomyces albidoflavus Q-TDC-SNAT-Mtr-Luz15 with co-high expression of TDC, SNAT, Mtr, and Luz15

[0085] The plasmid p3SV-ths-Mtr-Luz15 obtained in the above example was transferred into the genetically engineered strain Streptomyces albidoflavus Q-TDC-SNAT by conjugation transfer to obtain the genetically engineered strain Streptomyces albidoflavus Q-TDC-SNAT-Mtr-Luz15 with co-high expression of the four genes TDC, SNAT, Mtr, and Luz15 on the Streptomyces albidoflavus genome.

[0086] Using real-time fluorescence quantitative PCR (qRT-PCR) method to compare Streptomyces albidoflavus

[0087] The expression levels of the Mtr and Luz15 genes in the Q-TDC-SNAT-Mtr-Luz15 and the control strain Q-TDC-SNAT were determined by the same method and using the same primer sequences as described in Example 3. The results showed that the expression level of the Mtr gene in the genetically engineered strain Streptomyces albidoflavus Q-TDC-SNAT-Mtr-Luz15 was more than 6,000 times that of the control strain, and the expression level of the Luz15 gene was more than 12,000 times that of the control strain (see Figure 7 ). These results indicate that the genetically engineered strain Streptomyces albidoflavus Q-TDC-SNAT-Mtr-Luz15 with co-overexpression of TDC, SNAT, Mtr, and Luz15 was successfully constructed.

[0088] Example 5: Production of serotonin using Streptomyces albidoflavus Q-TDC with 5-hydroxytryptophan as the substrate

[0089] The Streptomyces albidoflavus Q-TDC preserved in an ultra-low temperature refrigerator at -80°C was streaked onto an MS solid medium (mannitol 20 g / L, soybean powder 20 g / L, agar powder 20 g / L), and cultured at 30°C for 5 - 6 days. After the surface of the medium was covered with black spores, the spores were collected from the plate and inoculated into conical flasks containing 50 mL of M3G medium (glucose 50 g / L, yeast powder 5 g / L, ammonium sulfate 10 g / L, dipotassium hydrogen phosphate 0.8 g / L, potassium dihydrogen phosphate 1.36 g / L, zinc sulfate heptahydrate 0.04 g / L, magnesium sulfate heptahydrate 0.5 g / L, ferrous sulfate heptahydrate 0.03 g / L, pH 6.5) respectively, and cultured on a shaker at 30°C and 220 rpm for 24 hours to obtain seed solutions; the cultured seed culture solutions were respectively inoculated into conical flasks containing fresh M3G medium at an inoculation amount of 10% (volume ratio), and cultured on a shaker at 30°C and 220 rpm for 36 hours, and then the thalli were collected respectively. The M9Y transformation medium (glucose 10 g / L, yeast powder 2 g / L, disodium hydrogen phosphate 6 g / L, sodium chloride 0.5 g / L, ammonium chloride 1 g / L, potassium dihydrogen phosphate 3.5 g / L, magnesium sulfate 0.2465 g / L, calcium chloride 14.7 mg / L, ferrous sulfate 27.8 mg / L, sodium citrate 2 g / L) was used to adjust the OD values of the bacterial solutions to 20, 30, 50, and 100 respectively, and 2, 3, 5, and 10 g / L of 5-hydroxytryptophan were added for transformation respectively (that is, when the OD value of the bacterial solution was adjusted to 20, 2 g / L of serotonin was added, when the OD value was adjusted to 30, 3 g / L of serotonin was added, and so on), among which 10 g / L of 5-hydroxytryptophan needed to be added in two portions, and at the same time 10 - 50 mg / L of lysozyme and 0.1 - 1.5 mmol of pyridoxal phosphate were added, and the transformation time was 24 - 120 hours (when different amounts of substrates were used, when 2 g / L of 5-hydroxytryptophan was transformed, 10 mg / L of lysozyme and 0.1 mmol of pyridoxal phosphate were added, and the transformation time was 24 hours; when 3 g / L of 5-hydroxytryptophan was transformed, 15 mg / L of lysozyme and 0.2 mmol of pyridoxal phosphate were added, and the transformation time was 36 hours; when 5 g / L of 5-hydroxytryptophan was transformed, 25 mg / L of lysozyme and 0.5 mmol of pyridoxal phosphate were added, and the transformation time was 72 hours; when 10 g / L of 5-hydroxytryptophan was transformed, 50 mg / L of lysozyme and 1.5 mmol of pyridoxal phosphate were added, and the transformation time was 120 hours). High performance liquid chromatography was used for detection and analysis, a diode array detector was used, the detection wavelength was 276 nm, a reverse phase Kromasil 100 - 5 - C18 column (4.6×250 mm, 5 μm) was used for quantification, and methanol / 10 mM potassium phosphate buffer was used as the mobile phase with a flow rate of 1 mL / min. As Figure 9 shown, the yield of serotonin was 1.9 - 9.6 g / L, and the conversion rates were all above 95%.

[0090] The above conversion rate = product concentration ÷ substrate consumption concentration × 100%

[0091] Example 6 Production of N-acetylserotonin using Streptomyces albidoflavus Q-TDC-SNAT with serotonin as the substrate

[0092] Streak Streptomyces albidoflavus Q-TDC-SNAT preserved in an ultra-low temperature freezer onto an MS solid medium and culture at 30 °C for 5 - 6 days. After the surface of the medium is covered with black spores, collect the spores from the plate and inoculate them into conical flasks containing 50 mL of M3G medium respectively. Culture on a shaker at 30 °C and 220 rpm for 24 hours to obtain seed solutions; respectively inoculate the cultured seed culture solutions into conical flasks containing fresh M3G medium at an inoculation amount of 10% (volume ratio), and culture on a shaker at 30 °C and 220 rpm for 36 hours, then collect the bacterial cells respectively. Use M9Y transformation medium to adjust the OD values of the bacterial suspensions of each strain to 20, 30, 50, and 100 respectively, and add 2, 3, 5, and 10 g / L of serotonin for transformation accordingly (that is, add 2 g / L of serotonin when the OD value of the bacterial suspension is adjusted to 20, add 3 g / L of serotonin when the OD value is adjusted to 30, and so on). At the same time, add 10 - 50 g / L of glycerol, and the transformation time is 24 - 120 hours (when using different amounts of substrate, add 10 g / L of glycerol for the transformation with 2 g / L of serotonin, and the transformation time is 24 hours; add 15 g / L of glycerol for the transformation with 3 g / L of serotonin, and the transformation time is 48 hours; add 25 g / L of glycerol for the transformation with 5 g / L of serotonin, and the transformation time is 72 hours; add 50 g / L of glycerol for the transformation with 10 g / L of serotonin, and the transformation time is 120 hours). Use the high-performance liquid chromatography method described in Example 5 for detection and analysis. As Figure 10 shown, the yield of N-acetylserotonin is 1.8 - 9.2 g / L, and the conversion rates are all above 90%.

[0093] Example 7 Production of N-acetylserotonin using Streptomyces albidoflavus Q-TDC-SNAT with 5-hydroxytryptophan as the substrate

[0094] Streptomyces albidoflavus Q-TDC-SNAT preserved in an ultra-low temperature refrigerator was streaked onto an MS solid medium and cultured at 30 °C for 5 - 6 days. After the surface of the medium was covered with black spores, the spores were collected from the plate and inoculated into conical flasks containing 50 mL of M3G medium respectively, and cultured on a shaker at 30 °C and 220 rpm for 24 hours to obtain seed solutions. The cultured seed culture solutions were respectively inoculated into conical flasks containing fresh M3G medium at an inoculation amount of 10% (volume ratio), and cultured on a shaker at 30 °C and 220 rpm for 36 hours, and then the thalli were collected respectively. The OD values of the bacterial solutions of each strain were adjusted to 20, 30, 50, and 100 with M9Y transformation medium respectively, and 2, 3, 5, and 10 g / L of 5-hydroxytryptophan were added for transformation respectively (that is, 2 g / L of serotonin was added when the OD value of the bacterial solution was adjusted to 20, 3 g / L of serotonin was added when the OD value was adjusted to 30, and so on). Among them, 10 g / L of 5-hydroxytryptophan needed to be added in two portions, and at the same time, 10 - 50 mg / L of lysozyme, 0.1 - 1.5 mmol of pyridoxal phosphate, and 10 - 50 g / L of glycerol were added. The transformation time was 24 - 120 hours (when using different amounts of substrates, 10 mg / L of lysozyme, 0.1 mmol of pyridoxal phosphate, and 10 g / L of glycerol were added during the transformation with 2 g / L of 5-hydroxytryptophan, and the transformation time was 24 hours; 15 mg / L of lysozyme, 0.2 mmol of pyridoxal phosphate, and 15 g / L of glycerol were added during the transformation with 3 g / L of 5-hydroxytryptophan, and the transformation time was 36 hours; 25 mg / L of lysozyme, 0.5 mmol of pyridoxal phosphate, and 25 g / L of glycerol were added during the transformation with 5 g / L of 5-hydroxytryptophan, and the transformation time was 72 hours; 50 mg / L of lysozyme and 1.5 mmol of pyridoxal phosphate were added during the transformation with 10 g / L of 5-hydroxytryptophan, and the transformation time was 120 hours). The detection and analysis were carried out by the high performance liquid chromatography method described in Example 5. As Figure 11 shown, the yield of N-acetylserotonin was 1.6 - 8.1 g / L, and the conversion rates were all above 80%.

[0095] Example 8 Production of serotonin using Streptomyces albidoflavus Q-TDC-Mtr-Luz15 with tryptophan as the substrate

[0096] Streptomyces albidoflavus Q-TDC-Mtr-Luz15 preserved in an ultra-low temperature refrigerator was streaked onto an MS solid medium and cultured at 30 °C for 5 - 6 days. After the surface of the medium was covered with black spores, the spores were collected from the plate and inoculated into conical flasks containing 50 ml of M3G medium respectively, and cultured on a shaker at 30 °C and 220 rpm for 24 hours to obtain seed solutions; the cultured seed culture solutions were respectively inoculated into conical flasks containing fresh M3G medium at an inoculation amount of 10% (volume ratio), and the cells were collected respectively after culturing on a shaker at 30 °C and 220 rpm for 36 hours. The OD values of the cell suspensions were adjusted to 20, 30, 50 and 100 respectively with M9Y conversion medium, and 2, 3, 5 and 10 g / L of tryptophan were added respectively for conversion (that is, 2 g / L of serotonin was added when the OD value of the cell suspension was adjusted to 20, 3 g / L of serotonin was added when the OD value was adjusted to 30, and so on). Among them, 10 g / L of tryptophan was added in two portions, and at the same time, 10 - 50 mg / L of lysozyme and 0.1 - 1.5 mmol of pyridoxal phosphate were added. The conversion time was 24 - 120 hours (when different amounts of substrates were used, 10 mg / L of lysozyme and 0.1 mmol of pyridoxal phosphate were added for the conversion with 2 g / L of tryptophan, and the conversion time was 24 hours; 15 mg / L of lysozyme and 0.2 mmol of pyridoxal phosphate were added for the conversion with 3 g / L of tryptophan, and the conversion time was 36 hours; 25 mg / L of lysozyme and 0.5 mmol of pyridoxal phosphate were added for the conversion with 5 g / L of tryptophan, and the conversion time was 72 hours; 50 mg / L of lysozyme and 1.5 mmol of pyridoxal phosphate were added for the conversion with 10 g / L of tryptophan, and the conversion time was 120 hours). The detection and analysis were carried out by the high performance liquid chromatography method described in Example 5, as Figure 12 shown, the yield of serotonin was 1.3 - 6.4 g / L and the conversion rate was over 60%.

[0097] Example 9 Production of N-acetylserotonin using Streptomyces albidoflavus Q-TDC-SNAT-Mtr-Luz15 with tryptophan as the substrate

[0098] Streptomyces albidoflavus Q-TDC-SNAT-Mtr-Luz15 preserved in an ultra-low temperature refrigerator was streaked onto an MS solid medium and cultured at 30 °C for 5 - 6 days. After the surface of the medium was covered with black spores, the spores were collected from the plate and inoculated into conical flasks containing 50 mL of M3G medium, and cultured on a shaker at 30 °C and 220 rpm for 24 hours to obtain seed solutions. The cultured seed culture solutions were respectively inoculated into conical flasks containing fresh M3G medium at an inoculation amount of 10% (volume ratio), and cultured on a shaker at 30 °C and 220 rpm for 36 hours, and then the bacterial cells were collected respectively. The OD values of the bacterial solutions were adjusted to 20, 30, 50, and 100 with M9Y conversion medium, and 2, 3, 5, and 10 g / L of tryptophan were added for conversion respectively (that is, when the OD value of the bacterial solution was adjusted to 20, 2 g / L of serotonin was added, when the OD value was adjusted to 30, 3 g / L of serotonin was added, and so on). Among them, 10 g / L of tryptophan needed to be added in two portions, and at the same time, 10 - 50 mg / L of lysozyme, 0.1 - 1.5 mmol of pyridoxal phosphate, and 10 - 50 g / L of glycerol were added. The conversion time was 24 - 120 hours (when different amounts of substrates were used, when 2 g / L of tryptophan was used for conversion, 10 mg / L of lysozyme and 0.1 mmol of pyridoxal phosphate were added, 10 g / L of glycerol, and the conversion time was 24 hours; when 3 g / L of tryptophan was used for conversion, 15 mg / L of lysozyme and 0.2 mmol of pyridoxal phosphate were added, 15 g / L of glycerol, and the conversion time was 36 hours; when 5 g / L of tryptophan was used for conversion, 25 mg / L of lysozyme and 0.5 mmol of pyridoxal phosphate were added, 25 g / L of glycerol, and the conversion time was 72 hours; when 10 g / L of tryptophan was used for conversion, 50 mg / L of lysozyme and 1.5 mmol of pyridoxal phosphate were added, and the conversion time was 120 hours). Detection and analysis were carried out using the high-performance liquid chromatography method described in Example 5, as Figure 13 shown, the yield of N-acetylserotonin was 1.1 - 5.2 g / L, and the conversion rate was more than 50%.

[0099] TDC gene sequence

[0100] ATGAAGCCCGCTGACGCGAAACCGCCCCACATGGACCACGACACCTTCCGCTCCCTGGGCCATCAGGCC

[0101] ATCGACTGGATCGCCGACTACTGGCAGCGTTTGGCGGAGCGACCCGTCGCTCCCCCCGTCGAACCCGGC

[0102] AGCATCCGCGCCCAGTTACCGACGGCCCCACCCGAGTGCGGCGAGGACTTTCCCGTGCTGCTGTCCGAC

[0103] CTCGAACGGATCGTGCTGCCGGGCCTGCTGCACTGGCAGCACCCCCGTTTCTTCGGTTACTTCCCCGCG

[0104] AACGCTTCCGGCCCCGCCGTCCTGGCCGAGCTGTTGTCCGCGGGCCTGGGCATCCAGGGGATGAACTGG

[0105] AACACCAGCCCGGCCTGCACCGAGATCGAACAGCAGATGCTGGACTGGTTCGTGCACCTGCTCGGCCTA

[0106] CCCGAGCACCTCCGCGGTGGGGGAGTCATCCAGGACACCGCCTCCAGCGCCCTCCTGGTGGCATTGCTC

[0107] ACCGCCCTGCACCAGGCCAGCGCGGGCCGCACCCGCGACCACGGCACCGGCGAGTGCGACTACCGGGTG

[0108] TACCTGACCGCCGAGACGCACTCGGCGGCCCGAAAGGCCGCCGTCATCACCGGACTGGGCCTGCGGGCC

[0109] ATGTGCGAGGTGGCCACCGACGCCGACGGCGCCATGGACGCAGTCGATCTGGAAAGACACCTCCGGGCC

[0110] GACCGGGCCGCAGGTCTGACCCCGCTGATGGTCGTGGCCACCCGAGGCACCACCTCCCATCTCTCCTTC

[0111] GACCCCCTGGAGGACATCGGCCCCGTGTGTCGTCGGCACGGCGTGTGGCTCCACGTCGACGCCGCATAC

[0112] GCCGGAGTGGCCGCGGTCTGCGACGAACTGCGCTGGGTCAACGACGGCGTGCGCTACGCGGACTCCTAC

[0113] TGCACCAACCCGCACAAGTGGCTGCTGACCAACTTCGACTGCGACCTGCTGTGGGTGGCCCACCCCGAA

[0114] GTCCTCGTCAGCGCCCTGAGCGTGCTCCCCGAATACCTGCGCAACTCGGCCTCCGAATCGGGCCGGGTG

[0115] ACCGACTACCGGCACTGGCAGGTCCCACTGGGCCGGCGCTTCCGAGCACTGAAACTGTGGTCCGTCCTC

[0116] CACTGGTACGGCGCCGAGGGGCTGCGCGCCCACATCCGCAACGGCGTTCGGCATGCCCAGCTCTTCGCG

[0117] GACCTGGTCGGCGCCGACGACCGCTTCACCCTGGTCACCCCTCCAGCCCTCGGCCTGGTGACGTTCCGT

[0118] CAGACCGGAACGGACGAGGAGAACCGGAACCTCCTGCAAGCCATCAACACCGAGGGAACCACCTTCCTC

[0119] ACCCACTCCGAGAAGAACGGCACCTTCTTCCTGCGCTTCGCCGCTGGCGGCACCCTCACCGAGGACCAC

[0120] CACGTACGCGAAGCATGGCGCGCTGTCCAGAACGCGATCCCTCGCGCACAACACCTCGCCGGCGGCTCG

[0121] GCTGATGCGCTGCCCGAGTAG

[0122] SNAT gene sequence

[0123] ATGAACACCTTCCGGACCGCGACGGCACGCGATCTCCCCGATGTCGCCGCCACCTTGACCGAGGCGTTC

[0124] GCCGCCGACCCGCCGACCCAATGGGTCTTCCCGGACGGTGCCGCTGCGGTCTCCCGTTTCTTCTTCGGT

[0125] GTCGCCGACCGTGCCCGCGAGGCCGGCGGGATCGTCGAACTACTCCCCGGCACCGCCGCGATGATCGCC

[0126] CTACCCCCGCACGTACGACTACCCGACGCCCCAGCCTGCGGCCGACAGGCCGAGATGCAGCGCAGGCTG

[0127] GGCGAACGCCGCCCCCGCACTCCGCACTACTACCTCCTCTTCTACGGCGTGCGCACCGCCCATCAGAGC

[0128] TCCGGCCTGGGGGGACGGATGCTCTCCGACCTCATCTCCCTGGCCGACCGCGACCGCGTGGGCACCTAC

[0129] ACCGAGGCCAGCACCTGGCGCGGCGCCCGCCTGATGTTGCGTCACGGCTTCCACACCGCACAGCCGCTG

[0130] CGGCTTCCCCACGGGCCACCCATGTTCCCCCTCTGGAGAGACCCGATCCATGACCACTGCGACTGAMtr gene sequence

[0131] ATGGCCACCCTGACCACCACCCAGACCAGCCCGAGCCTGCTGGGCGGCGTCGTCATCATCGGCGGCACC

[0132] ATCATCGGCGCCGGCATGTTCAGCCTGCCGGTCGTCATGTCCGGCGCCTGGTTCTTCTGGAGCATGGCC

[0133] GCCCTGATCTTCACCTGGTTCTGCATGCTGCACTCCGGCCTGATGATCCTGGAGGCCAACCTGAACTAC

[0134] CGCATCGGCAGCTCCTTCGACACCATCACCAAGGACCTGCTGGGCAAGGGCTGGAACGTCGTCAACGGC

[0135] ATCAGCATCGCCTTCGTGCTGTACATCCTCACCTACGCCTACATCAGCGCCAGCGGCAGCATCCTGCAC

[0136] CACACCTTCGCCGAGATGAGCCTGAACGTCCCGGCCCGCGCCGCCGGCTTCGGCTTCGCCCTGCTGGTC

[0137] GCCTTCGTCGTCTGGCTGAGCACCAAGGCCGTCAGCCGCATGACCGCCATCGTCCTGGGCGCCAAGGTC

[0138] ATCACCTTCTTCCTCACCTTCGGCTCGCTGCTGGGCCACGTCCAGCCGGCCACCCTGTTCAACGTCGCC

[0139] GAGAGCAACGCCTCCTACGCCCCGTACCTGCTGATGACCCTGCCGTTCTGCCTGGCCAGCTTCGGCTAC

[0140] CACGGCAACGTCCCGAGCCTGATGAAGTACTACGGCAAGGACCCGAAGACCATCGTCAAGTGCCTGGTC

[0141] TACGGCACCCTGATGGCCCTGGCCCTGTACACCATCTGGCTGCTGGCCACCATGGGCAACATCCCGCGC

[0142] CCGGAGTTCATCGGCATCGCCGAGAAGGGCGGCAACATCGACGTCCTGGTCCAGGCCCTGAGCGGCGTC

[0143] CTGAACAGCCGCAGCCTGGACCTGCTGCTGGTCGTCTTCAGCAACTTCGCCGTGGCGAGCAGCTTCCTG

[0144] GGCGTCACCCTGGGCCTGTTCGACTACCTGGCCGACCTGTTCGGCTTCGACGACAGCGCCGTCGGCCGC

[0145] CTGAAGACCGCCCTGCTGACCTTCGCCCCGCCGGTCGTCGGCGGCCTGCTGTTCCCGAACGGCTTCCTG

[0146] TACGCCATCGGCTACGCCGGCCTGGCCGCCACCATCTGGGCCGCCATCGTCCCGGCCCTGCTGGCCCGC

[0147] GCCAGCCGCAAGCGCTTCGGCAGCCCGAAGTTCCGCGTCTGGGGCGGCAAGCCGATGATCGCCCTGATC

[0148] CTGGTCTTCGGCGTCGGCAACGCCCTGGTCCACATCCTGAGCAGCTTCAACCTGCTCCCGGTCTACCAG

[0149] TGATAA

[0150] Luz15 gene sequence

[0151] ATGCGCGCCACCACCAACGTCGGCGTCGGCGGCCTGAGCCCGCGCGCCCTGGACGAGACCGCCCGCTGC

[0152] CCGAGCAGCGCCCTGAACAGCCTCGCCGAGTGGCAGGAGACCGCCGGCCCGGCCGCCTTCCCGTTCCGC

[0153] CCGATCGTCCGCCACTACCAGGCCGTGGGCCGCGGCCGCGCCGACGCCGAGCTGGTCAAGGCCCTGCGC

[0154] GTCCTGGCCGAGCAGGGCTGCCGCCGCCACGGCGGGGGCGGCCGCCCGGCCCACGGCACCATCCTCAGC

[0155] AGCTGGCTCCCCTGCACCTTCGACCAGGAGGACGGCGACTACGACAGCTACGGCGCCATGCCGCTGCTG

[0156] CACCAGGTGGCCGGCACCGCCGCCGGCGGCCCGGACACCGGCCTGGACCTGCAGCAGGTGGCGCTGCTG

[0157] GGCGACCTGCTGGCCTTCGAGGCCGCCGCCGGCCGCGTCTGCGGCAGCGCCCCGCAGCAGGTCCGCGTC

[0158] CGCGCCTGCCTGCGCGCCCTGGCCCGCGCCGGCGAGCTGGCCCCGGGCGCCGCCGGCGTCACCGCCCGC

[0159] TTCCCGGGCGCCCCGGCCGCCGACCGCGCGGGCGAGCTGGCCCTGCTGGCCCTGGAGGCCGTCCCGCCG

[0160] GCCGTCCGCCTGGCCGCCGAGATCACCCTGCTGCCGATGACCCCGCTGCACGACGAGGTCATGTTCATC

[0161] CGCAGCATCCAGGTCTTCGAGCTGGTCTACCGCCAGGTCGCCCGCTGCCTGGAGCGCGCCGTCACCGCC

[0162] CTGGCGGGCGGCGACCCGGCCGCGGCCGCCGCCGAGGTCCGCGGCGCCACCGCCCGGGTCGCCGCCACC

[0163] GGCAGCCTGTACCGCGTCCTGACCACCATGCCGAAGGAGAGCTTCGCCGTCATCCGCAGCAGCACCGAC

[0164] GGCCGCAGCGCCATCCAGAGCCGCGCCTACCGCGAGGTCGAGCGCCTGAGCGCCCCGCTGCCGACCGAG

[0165] CGCCTGCCGATGGAGCTGCTGCGCCTGGACGAGCGCCCGCGCCCGGGCCGCAGCCTGCAGGAGGAGTAC

[0166] CTGGCCGCCGGCGGCGGCCCGCGCCTGGACGACCTGGCCGCCGCCATGACCGGCCTGGACCAGGCCTGG

[0167] CACGCCATGAAGCGCACCCACTGGGGCATCACCCTGAAGATCATCGGCCGCGTCCCGGGCACCGGCGGC

[0168] AGCAGCGGCGCCGACTACCTGCGCGAGGCCGCCGAGCGCCCGCTGTTCCCGGCCCTGAGCCCGGGCGGC

[0169] CCGCACGCCTGA。

Claims

1. A genetically engineered Streptomyces parvum strain, characterized in that: The genetically engineered Streptomyces parvum strain is a strain in which an endogenous tryptophan decarboxylase TDC gene, a heterologous tryptophan transporter Mtr gene and a heterologous tryptophan hydroxylase Luz15 gene are inserted into the chromosome of the starting strain; The starting strain is Streptomyces albulus CICC 11022; The tryptophan decarboxylase TDC gene sequence is shown in SEQ ID NO:1; The tryptophan transporter Mtr gene sequence is shown in SEQ ID NO: 3; The tryptophan hydroxylase Luz15 gene sequence is shown in SEQ ID NO:

4.

2. A method for constructing the genetically engineered Streptomyces parvum according to claim 1, characterized in that: use Eco RI and N I digested the vector pSET152-Sp43-SR40-pls containing the constitutive strong promoter Sp43 and the ribosome binding site sequence SR40 to obtain a linearized fragment, which was connected with the endogenous tryptophan decarboxylase TDC gene by Infusion seamless cloning technology to obtain a recombinant expression plasmid pSET152-TDC; the obtained recombinant expression plasmid pSET152-TDC was transferred into Escherichia coli ET12567 / pUZ8002, and then transferred into the wild strain of Streptomyces parvum CICC 11022 by conjugation transfer method, so that pSET152-TDC was integrated into the chromosome of the strain, and a TDC expression engineering strain - Streptomyces parvum Q-TDC was obtained; The heterologous tryptophan transporter Mtr gene and the heterologous tryptophan hydroxylase Luz15 gene were connected to the linearized plasmid p3SV-ths to obtain the recombinant expression plasmid p3SV-ths-Mtr-Luz15, and the p3SV-ths-Mtr-Luz15 was transferred into the Streptomyces parthenolides Q-TDC by conjugation transfer, so that p3SV-ths-Mtr-Luz15 was integrated into the chromosome of the strain, and the genetically engineered bacteria Streptomyces parthenolides Q-TDC-Mtr-Luz15 with high expression of TDC, Mtr and Luz15 was obtained.

3. An application of the genetically engineered Streptomyces parvum according to claim 1, characterized in that: Application of the engineered bacteria in the production of serotonin.

4. The use of the genetically engineered Streptomyces parvum according to claim 3, characterized in that: The engineering bacteria is used in producing serotonin using tryptophan as a substrate.

Images