Schizochytrium limacinum genetic engineering strain capable of reducing DPA proportion in grease and correspondingly increasing DHA content, method and application of schizochytrium limacinum genetic engineering strain

Abstract

The invention belongs to the technical field of genetic engineering, and discloses a schizochytrium limacinum genetic engineering strain capable of reducing the proportion of DPA in grease and correspondingly increasing the content of DHA, a method and application of the schizochytrium limacinum genetic engineering strain. The strain is characterized in that an omega-3 desaturase gene derived from Platyneria dumeriii and / or Lepeophtheria salmonis is subjected to heterologous expression, so that the proportion of DPA (docosahexaenoic acid) in grease is reduced, and the content of DHA (docosahexaenoic acid) is correspondingly increased. According to the invention, by heterologous expression of Pd delta 19Des and Ls delta 19Des genes in schizochytrium limacinum, desaturation activity of two desaturases to a delta 19 position is verified, and conversion from omega-6 type DPA to omega-3 type DHA is effectively promoted.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and in particular relates to a Schizochytrium genetic engineering strain, method and application for reducing the DPA ratio in oil and fat and correspondingly increasing the DHA content. Background Art

[0002] Docosahexaenoic acid (DHA) is an ω-3 polyunsaturated fatty acid (PUFA) that plays a key role in human health, particularly in the development and proper function of the brain, eyes, and cardiovascular system. DHA is traditionally derived from deep-sea fish oil, but this method is unsustainable and its production cannot meet market demand. DHA in fish comes from their food, algae, which are the direct DHA producers. In recent years, increasing research has focused on using algae fermentation to produce polyunsaturated fatty acids such as DHA and EPA.

[0003] Schizochytrium sp. belongs to the Thraustochytriaceae family. It is a marine fungus that can naturally produce polyunsaturated fatty acids including DHA and DPA. It can accumulate rich fatty acids in the body, with PUFA accounting for about 60%, and its main components are DPA and DHA. Compared with DHA, DPA in Schizochytrium mainly exists in the form of ω-6 polyunsaturated fatty acids. ω-6 PUFA is widely present in the human diet, and excessive ω-6 PUFA will inhibit the metabolism of ω-3 PUFA, and excessive intake of ω-6 often leads to the risk of chronic disease, obesity, and cardiovascular disease. Therefore, it is necessary to further reduce the proportion of DPA in the oil produced by Schizochytrium to obtain oil with a high DHA content.

[0004] The conversion of ω-6 DPA to ω-3 DHA requires the catalysis of Δ19-specific desaturase. However, there is currently little research on Δ19Des, and there is still a lack of efficient ω-3 desaturases that can efficiently convert ω-6 DPA to ω-3 DHA. Screening for potential Δ19-specific ω-3 desaturases will help reduce the proportion of DPA in Schizochytrium fermentation production and obtain oil products with high DHA content. Summary of the Invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a genetically engineered Schizochytrium strain, method and application that reduces the DPA ratio in oils and fats and correspondingly increases the DHA content.

[0006] The technical solution adopted by the present invention to solve its technical problem is:

[0007] A genetically engineered Schizochytrium strain that reduces the DPA ratio and correspondingly increases the DHA content in oils and fats. The strain is constructed using Schizochytrium sp. HX-308 as a starting strain and heterologously expresses ω-3 desaturase genes from Platynereis dumerilii and / or Lepeophtheirus salmonis to reduce the DPA ratio and correspondingly increase the DHA content in oils and fats.

[0008] The ω-3 desaturase gene is PdΔ19Des from Platynereis dumerilii or LsΔ19Des from Lepeophtheirus salmonis; the nucleotide sequences of the PdΔ19Des gene and the LsΔ19Des gene are shown in SEQ ID No. 1 and SEQ ID No. 2.

[0009] The application of the genetically engineered strain of Chytridium as described above in fermentation production to reduce the DPA ratio in oils and fats and correspondingly increase the DHA content.

[0010] The method for constructing the genetically engineered strain of Chytridium as described above comprises the following steps:

[0011] When the strain heterologously expresses the ω-3 desaturase gene from Platynereis dumerilii or Lepeophtheirus salmonis to reduce the DPA ratio in oil and fat and correspondingly increase the DHA content, the construction method of the strain comprises the following steps:

[0012] 1) Clone the Δ19Des gene from Platynereis dumerilii or Lepeophtheirus salmonis and insert the gene into the pBS-Zeo plasmid using a one-step cloning technique to construct the recombinant vector pBS-Zeo-PdΔ19Des or pBS-Zeo-LsΔ19Des;

[0013] 2) The recombinant vector pBS-Zeo-PdΔ19Des or pBS-Zeo-LsΔ19Des was linearized and then electroporated into Schizochytrium sp. HX-308 to obtain the Schizochytrium sp. HX-308-Pd and HX-308-Ls genetically engineered strains overexpressing the PdΔ19Des or LsΔ19Des genes;

[0014] When the strain heterologously expresses ω-3 desaturase genes from Platynereis dumerilii and Lepeophtheirus salmonis to reduce the DPA ratio in oil and fat and correspondingly increase the DHA content, the construction method of the strain comprises the following steps:

[0015] 1) The cloned Δ19Des gene from Platynereis dumerilii or Lepeophtheirus salmonis was inserted into the pBS-Zeo plasmid via a 2A peptide linkage to construct the recombinant vector pBS-Zeo-Pd-Ls;

[0016] 2) The recombinant vector pBS-Zeo-Pd-Ls was linearized and then electroporated into Schizochytrium sp. HX-308 to obtain the Schizochytrium sp. HX-308-Pd-Ls genetically engineered strain overexpressing the PdΔ19Des or LsΔ19Des gene.

[0017] A method for producing oil with a low DPA ratio and correspondingly increased DHA content using the genetically engineered strain of Chytridium as described above comprises the following steps:

[0018] The genetically engineered strain is inoculated into a seed culture medium for activation culture to obtain a fermentation seed strain, which is then inoculated into a fermentation culture medium for fermentation culture. After the culture is completed, the fermentation liquid is collected to detect the oil content and fatty acid composition.

[0019] Furthermore, the genetically engineered strain is inoculated from the plate culture medium to the seed culture medium and transferred twice in succession to obtain a first-level seed solution and second-level and third-level seed solutions, respectively. The third-level seed solution obtained last is used as the fermentation seed strain;

[0020] The seed solution is cultured at 25-28° C. and shaken at 160-200 r / min in an incubator for 20-28 hours.

[0021] Furthermore, after the genetically engineered strain is inoculated on a plate culture medium, a single colony is picked and activated on a seed culture medium;

[0022] The plate culture medium has a pH value of 6.4 and contains 100 mg / L bleomycin Zeocin resistance for screening. Other ingredients include: 20 g / L agar, 40 g / L glucose, 15 g / L yeast extract, 10 g / L sodium sulfate, 3 g / L magnesium sulfate, 8 g / L ammonium sulfate, 2 g / L potassium chloride, 0.1 g / L calcium chloride, 0.8 g / L potassium sulfate, 0.8 g / L potassium dihydrogen phosphate, 8 g / L sodium glutamate, 5 mg / L zinc sulfate heptahydrate, 0.05 mg / L cobalt dichloride hexahydrate, 4 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 8 mg / L ferrous sulfate heptahydrate, 3 mg / L calcium pantothenate, 5 mg / L manganese chloride tetrahydrate, 0.04 mg / L sodium molybdate dihydrate, 7 mg / L vitamin B6, and 1 mg / L vitamin B6. 12 1mg / L.

[0023] Furthermore, the seed culture medium has a pH value of 6.4 and comprises: 60 g / L glucose, 5 g / L yeast extract, 5 g / L sodium sulfate, 2 g / L magnesium sulfate, 4 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.5 g / L potassium sulfate, 0.5 g / L potassium dihydrogen phosphate, 8 g / L sodium glutamate, 3 mg / L zinc sulfate heptahydrate, 0.03 mg / L cobalt dichloride hexahydrate, 4 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 8 mg / L ferrous sulfate heptahydrate, 2 mg / L calcium pantothenate, 4 mg / L manganese chloride tetrahydrate, and 0.04 mg / L sodium molybdate dihydrate.

[0024] Alternatively, the fermentation medium has a pH of 6.0 and comprises: 90 g / L glucose, 15 g / L yeast extract, 10 g / L sodium sulfate, 3 g / L magnesium sulfate, 8 g / L ammonium sulfate, 2 g / L potassium chloride, 0.1 g / L calcium chloride, 0.8 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 15 g / L sodium glutamate, 3 mg / L zinc sulfate heptahydrate, 0.08 mg / L cobalt dichloride hexahydrate, 5 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 10 mg / L ferrous sulfate heptahydrate, 2 mg / L calcium pantothenate, 4 mg / L manganese chloride tetrahydrate, 0.04 mg / L sodium molybdate dihydrate, 8 mg / L vitamin B6, and 1 mg / L vitamin B6. 12 2mg / L.

[0025] Furthermore, the method for detecting oil content and fatty acid composition includes:

[0026] 1) After the fermentation is completed, NaOH solution is added to the fermentation broth to adjust the pH to 10-12, and then a cell wall-breaking enzyme is added at a final concentration of 0.1-0.5%, and the mixture is reacted at 50-60°C and 100-200 rpm for 6-12 hours;

[0027] 2) Add an equal volume of anhydrous ethanol to the fermentation broth and continue shaking for 1 hour to inactivate the cell wall-breaking enzyme;

[0028] 3) Add an equal volume of anhydrous ethanol and n-hexane and continue shaking for 1 hour to extract lipids from the fermentation broth. After shaking, let it stand at room temperature until the layers separate, and collect the upper organic phase;

[0029] 4) Repeat step 3) several times and combine the collected organic phases, and evaporate the n-hexane by rotary evaporation to obtain oil.

[0030] The advantages and positive effects achieved by the present invention are:

[0031] 1. The present invention relates to a Schizochytrium strain heterologously expressing an ω-3 desaturase gene from Platynereis dumerilii or Lepeophtheirus salmonis. The strain is constructed using Schizochytrium sp. HX-308 as a starting strain. The strain heterologously expresses PdΔ19Des (from Platynereis dumerilii) or LsΔ19Des (from Lepeophtheirus salmonis) to reduce the DPA ratio and correspondingly increase the DHA content in oils and fats. This is to verify the changes in the DPA ratio in oils and fats produced by the Schizochytrium strain and to identify the functions of the PdΔ19Des and LsΔ19Des genes. By heterologously expressing the PdΔ19Des and LsΔ19Des genes in Schizochytrium, the present invention verified the desaturation activity of the two desaturases at the Δ19 position, effectively promoting the conversion of ω-6 DPA to ω-3 DHA.

[0032] 2. The present invention uses the electroporation method to integrate the heterologous PdΔ19Des and LsΔ19Des genes into the starting strain through homologous recombination. The resulting genetically engineered strain maintains genetic stability after multiple subcultures and has the ability to efficiently synthesize oils with a low DPA ratio, effectively increasing the production of high-DHA oils and laying the foundation for large-scale industrial production.

[0033] 3. In the genetically engineered strain HX-308-Pd-Ls finally obtained in the present invention, the biomass and oil content did not change significantly, but the DHA / DPA ratio was further increased to 4.19, an increase of 67% compared with the control strain, and the final DHA content was increased by 20%. The DHA production efficiency was significantly improved, and it has great industrial application value.

[0034] 4. Based on the verified functions of the PdΔ19Des gene and the LsΔ19Des gene, the present invention further connects the two genes using 2A peptide and integrates them into the same recombinant vector to transform Schizochytrium HX-308. Through the combined action of the two genes, the conversion of ω-6DPA to ω-3DHA is promoted, the DPA ratio is further reduced, and Schizochytrium oil with a high DHA content is obtained.

[0035] 5. This invention aims to characterize the desaturase activity of ω-3 desaturases from Platynereis dumerilii and Lepeophtheirus salmonis at the Δ19 position of PUFAs and verify their effectiveness in converting ω-6 DPA in Schizochytrium. This invention constructs a replacement vector in Escherichia coli through genetic engineering, selects zeocin as a selection resistance gene, and electroporates the linearized gene replacement fragment into Schizochytrium. This results in a genetically engineered strain that effectively reduces the DPA ratio, providing high-quality, high-content DHA oils and providing a theoretical foundation for product industrialization.

[0036] 6. The construction method of the present invention is simple, rapid, effective, and precise. The constructed strain effectively promotes the conversion of ω-6DPA to ω-3DHA by heterologously expressing ω-3 desaturases from Platynereis dumerilii and Lepeophtheirus salmonis, thereby reducing the proportion of DPA in oils produced by the genetically engineered strain, thereby obtaining oils with high DHA content, thereby achieving the goal of reducing the DPA ratio and obtaining oils with high DHA content. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 Schematic diagram of the recombinant vector pBS-Zeo-PdΔ19Des constructed in the present invention;

[0038] Figure 2 Schematic diagram of the recombinant vector pBS-Zeo-LsΔ19Des constructed in the present invention;

[0039] Figure 3 Schematic diagram of the recombinant vector pBS-Zeo-Pd-Ls constructed in the present invention;

[0040] Figure 4 This is a gas phase fermentation result diagram of the HX-308-Pd-Ls strain in the present invention;

[0041] Figure 5The results of colony PCR verification of the construction of pBS-Zeo-PdΔ19Des plasmid and pBS-Zeo-LsΔ19Des plasmid in the present invention are shown; the left figure is the result of colony PCR verification of the construction of pBS-Zeo-PdΔ19Des plasmid; the right figure is the result of colony PCR verification of the construction of pBS-Zeo-LsΔ19Des plasmid;

[0042] Figure 6 This is the colony PCR verification result of the pBS-Zeo-Pd-Ls plasmid constructed in the present invention. DETAILED DESCRIPTION

[0043] The present invention will be further described below with reference to the following examples. The following examples are descriptive rather than restrictive, and the scope of protection of the present invention cannot be limited by the following examples.

[0044] The various experimental operations involved in the specific embodiments are all routine techniques in the field. For parts not specifically annotated in this document, ordinary technicians in this field can refer to various commonly used reference books, scientific literature or related instructions, manuals, etc. before the filing date of this invention to implement them.

[0045] A genetically engineered Schizochytrium strain that reduces the DPA ratio and correspondingly increases the DHA content in oils and fats. The strain is constructed using Schizochytrium sp. HX-308 as a starting strain and heterologously expresses ω-3 desaturase genes from Platynereis dumerilii and / or Lepeophtheirus salmonis to reduce the DPA ratio and correspondingly increase the DHA content in oils and fats.

[0046] The ω-3 desaturase gene is PdΔ19Des from Platynereis dumerilii or LsΔ19Des from Lepeophtheirus salmonis; the nucleotide sequences of the PdΔ19Des gene and the LsΔ19Des gene are shown in SEQ ID No. 1 and SEQ ID No. 2.

[0047] The application of the genetically engineered strain of Chytridium as described above in fermentation production to reduce the DPA ratio in oils and fats and correspondingly increase the DHA content.

[0048] The method for constructing the genetically engineered strain of Chytridium as described above comprises the following steps:

[0049] When the strain heterologously expresses the ω-3 desaturase gene from Platynereis dumerilii or Lepeophtheirus salmonis to reduce the DPA ratio in oil and fat and correspondingly increase the DHA content, the construction method of the strain comprises the following steps:

[0050] 1) Clone the Δ19Des gene from Platynereis dumerilii or Lepeophtheirus salmonis and insert the gene into the pBS-Zeo plasmid using a one-step cloning technique to construct the recombinant vector pBS-Zeo-PdΔ19Des or pBS-Zeo-LsΔ19Des;

[0051] 2) The recombinant vector pBS-Zeo-PdΔ19Des or pBS-Zeo-LsΔ19Des was linearized and then electroporated into Schizochytrium sp. HX-308 to obtain the Schizochytrium sp. HX-308-Pd and HX-308-Ls genetically engineered strains overexpressing the PdΔ19Des or LsΔ19Des genes;

[0052] When the strain heterologously expresses ω-3 desaturase genes from Platynereis dumerilii and Lepeophtheirus salmonis to reduce the DPA ratio in oil and fat and correspondingly increase the DHA content, the construction method of the strain comprises the following steps:

[0053] 1) The cloned Δ19Des gene from Platynereis dumerilii or Lepeophtheirus salmonis was inserted into the pBS-Zeo plasmid via a 2A peptide linkage to construct the recombinant vector pBS-Zeo-Pd-Ls;

[0054] 2) The recombinant vector pBS-Zeo-Pd-Ls was linearized and then electroporated into Schizochytrium sp. HX-308 to obtain the Schizochytrium sp. HX-308-Pd-Ls genetically engineered strain overexpressing the PdΔ19Des or LsΔ19Des gene.

[0055] A method for producing oil with a low DPA ratio and correspondingly increased DHA content using the genetically engineered strain of Chytridium as described above comprises the following steps:

[0056] The genetically engineered strain is inoculated into a seed culture medium for activation culture to obtain a fermentation seed strain, which is then inoculated into a fermentation culture medium for fermentation culture. After the culture is completed, the fermentation liquid is collected to detect the oil content and fatty acid composition.

[0057] Preferably, the genetically engineered strain is inoculated from a plate culture medium to a seed culture medium and cultured twice continuously to obtain a first-level seed solution and second-level and third-level seed solutions, respectively. The third-level seed solution obtained last is used as the fermentation seed strain;

[0058] The seed solution is cultured at 25-28° C. and shaken at 160-200 r / min in an incubator for 20-28 hours.

[0059] Preferably, after the genetically engineered strain is inoculated on a plate culture medium, a single colony is picked and activated on a seed culture medium;

[0060] The plate culture medium has a pH value of 6.4 and contains 100 mg / L bleomycin Zeocin resistance for screening. Other ingredients include: 20 g / L agar, 40 g / L glucose, 15 g / L yeast extract, 10 g / L sodium sulfate, 3 g / L magnesium sulfate, 8 g / L ammonium sulfate, 2 g / L potassium chloride, 0.1 g / L calcium chloride, 0.8 g / L potassium sulfate, 0.8 g / L potassium dihydrogen phosphate, 8 g / L sodium glutamate, 5 mg / L zinc sulfate heptahydrate, 0.05 mg / L cobalt dichloride hexahydrate, 4 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 8 mg / L ferrous sulfate heptahydrate, 3 mg / L calcium pantothenate, 5 mg / L manganese chloride tetrahydrate, 0.04 mg / L sodium molybdate dihydrate, 7 mg / L vitamin B6, and 1 mg / L vitamin B6. 12 1mg / L.

[0061] Preferably, the seed culture medium has a pH value of 6.4 and comprises: 60 g / L glucose, 5 g / L yeast extract, 5 g / L sodium sulfate, 2 g / L magnesium sulfate, 4 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.5 g / L potassium sulfate, 0.5 g / L potassium dihydrogen phosphate, 8 g / L sodium glutamate, 3 mg / L zinc sulfate heptahydrate, 0.03 mg / L cobalt dichloride hexahydrate, 4 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 8 mg / L ferrous sulfate heptahydrate, 2 mg / L calcium pantothenate, 4 mg / L manganese chloride tetrahydrate, and 0.04 mg / L sodium molybdate dihydrate.

[0062] Alternatively, the fermentation medium has a pH of 6.0 and comprises: 90 g / L glucose, 15 g / L yeast extract, 10 g / L sodium sulfate, 3 g / L magnesium sulfate, 8 g / L ammonium sulfate, 2 g / L potassium chloride, 0.1 g / L calcium chloride, 0.8 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 15 g / L sodium glutamate, 3 mg / L zinc sulfate heptahydrate, 0.08 mg / L cobalt dichloride hexahydrate, 5 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 10 mg / L ferrous sulfate heptahydrate, 2 mg / L calcium pantothenate, 4 mg / L manganese chloride tetrahydrate, 0.04 mg / L sodium molybdate dihydrate, 8 mg / L vitamin B6, and 1 mg / L vitamin B6. 12 2mg / L.

[0063] Preferably, the method for detecting oil content and fatty acid composition includes:

[0064] 1) After the fermentation is completed, NaOH solution is added to the fermentation broth to adjust the pH to 10-12, and then a cell wall-breaking enzyme is added at a final concentration of 0.1-0.5%, and the mixture is reacted at 50-60°C and 100-200 rpm for 6-12 hours;

[0065] 2) Add an equal volume of anhydrous ethanol to the fermentation broth and continue shaking for 1 hour to inactivate the cell wall-breaking enzyme;

[0066] 3) Add an equal volume of anhydrous ethanol and n-hexane and continue shaking for 1 hour to extract lipids from the fermentation broth. After shaking, let it stand at room temperature until the layers separate, and collect the upper organic phase;

[0067] 4) Repeat step 3) several times and combine the collected organic phases, and evaporate the n-hexane by rotary evaporation to obtain oil.

[0068] Specifically, the relevant preparation and detection are as follows:

[0069] Unless otherwise specified, the equipment, reagents, processes, parameters, etc. involved in the present invention are all conventional equipment, reagents, processes, parameters, etc., and no longer serve as examples. All ranges listed in the present invention include all point values ​​within the range. In the present invention, unless otherwise specified in the field, % is mass percentage and ratio is mass ratio. The unit of mass is, for example, gram, kilogram or ton. In the present invention, the "room temperature" is the conventional ambient temperature, which can be 10 to 30°C.

[0070] The genetically engineered original strain is Schizochytrium sp. HX-308 strain, which is a well-known strain in the prior art, as disclosed in Chinese patent publication CN101575584A. The strain has been deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC No. M209059.

[0071] The culture medium used in the following examples is as follows:

[0072] The pH value of the plate culture medium is 6.4, and the ingredients include: agar 20g / L, glucose 40g / L, yeast extract 15g / L, sodium sulfate 10g / L, magnesium sulfate 3g / L, ammonium sulfate 8g / L, potassium chloride 2g / L, calcium chloride 0.1g / L, potassium sulfate 0.8g / L, potassium dihydrogen phosphate 0.8g / L, sodium glutamate 8g / L, zinc sulfate heptahydrate 5mg / L, cobalt dichloride hexahydrate 0.05mg / L, copper sulfate pentahydrate 4mg / L, nickel sulfate hexahydrate 1mg / L, ferrous sulfate heptahydrate 8mg / L, calcium pantothenate 3mg / L, manganese chloride tetrahydrate 5mg / L, sodium molybdate dihydrate 0.04mg / L, vitamin B6 7mg / L, vitamin B 12 1mg / L.

[0073] The seed culture medium had a pH of 6.4 and included: 60 g / L glucose, 5 g / L yeast extract, 5 g / L sodium sulfate, 2 g / L magnesium sulfate, 4 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.5 g / L potassium sulfate, 0.5 g / L potassium dihydrogen phosphate, 8 g / L sodium glutamate, 3 mg / L zinc sulfate heptahydrate, 0.03 mg / L cobalt dichloride hexahydrate, 4 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 8 mg / L ferrous sulfate heptahydrate, 2 mg / L calcium pantothenate, 4 mg / L manganese chloride tetrahydrate, and 0.04 mg / L sodium molybdate dihydrate.

[0074] The fermentation medium had a pH of 6.0 and included: glucose 90 g / L, yeast extract 15 g / L, sodium sulfate 10 g / L, magnesium sulfate 3 g / L, ammonium sulfate 8 g / L, potassium chloride 2 g / L, calcium chloride 0.1 g / L, potassium sulfate 0.8 g / L, potassium dihydrogen phosphate 1 g / L, sodium glutamate 15 g / L, zinc sulfate heptahydrate 3 mg / L, cobalt dichloride hexahydrate 0.08 mg / L, copper sulfate pentahydrate 5 mg / L, nickel sulfate hexahydrate 1 mg / L, ferrous sulfate heptahydrate 10 mg / L, calcium pantothenate 2 mg / L, manganese chloride tetrahydrate 4 mg / L, sodium molybdate dihydrate 0.04 mg / L, vitamin B6 8 mg / L, and vitamin B6. 12 2mg / L.

[0075] Example 1. Construction of recombinant vectors pBS-Zeo-PdΔ19Des and pBS-Zeo-LsΔ19Des

[0076] 1. Based on the sequence information of the PdΔ19Des or pBS-Zeo-LsΔ19Des genes from Platynereis dumerilii or Lepeophtheirus salmonis, the nucleotide sequences of the PdΔ19Des and LsΔ19Des genes are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively. Primers Pd-F, Pd-R, Ls-F, and Ls-R, shown in SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, and SEQ ID No. 6, were synthesized and designed by Bioengineering. PCR reactions were performed using PrimeStar high-fidelity DNA polymerase using the synthesized DNA as a template and primers Pd-F, Pd-R, and Ls-F, Ls-R, respectively. These primers contain sequences homologous to the pBS-Zeo vector, as indicated by the underlined portion. The PCR reaction program was as follows: 95°C for 5 min, 95°C for 30 s, 58°C for 30 s, and 72°C for 40 s. 33 cycles were set starting from the second step. After the PCR product was obtained and verified by agarose gel electrophoresis, it was recovered and purified.

[0077] SEQ ID No.1PdΔ19Des:

[0078]

[0079] SEQ ID No.2LsΔ19Des:

[0080]

[0081] SEQ ID No.3Pd-F:

[0082] AGCCGAGCGCGGGAGGGAAG ATGGCCCCCACGCAGGCCAT

[0083] SEQ ID No.4Pd-R:

[0084] TGACATAACTAATTACATGACTAGTCGTCCTTCGACTGCGTCTGCT

[0085] SEQ ID No.5Ls-F:

[0086] AGCCGAGCGCGGGAGGGAAG ATGGAAAAACATAAGAAGATGCCT

[0087] SEQ ID No.6Ls-R:

[0088] TGACATAACTAATTACATGATTAATTTGACTTTTTGGTAGTAACAT

[0089] 2. Digest the vector plasmid pBS-Zeo with the restriction endonuclease KpnI, verify by agarose gel electrophoresis, and recover the fragment. Enzyme digestion system (50 μL): 4000 μg of vector plasmid, 2 μL of KpnI, 5 μL of 10× QCut Buffer, and up to 50 μL of ddH2O.

[0090] 3. The pBS-Zeo fragment after enzyme digestion and the PdΔ19Des obtained by amplification using SEQ ID No. 3 and 4 or the LsΔ19Des obtained by amplification using SEQ ID No. 5 and 6 were ligated by one-step cloning to obtain the recombinant vector pBS-Zeo-PdΔ19Des or pBS-Zeo-LsΔ19Des. Figure 1 and Figure 2 One-step cloning system (10 μL): 4 μL target gene fragment, 1 μL vector enzyme-digested fragment, 5 μL 2× Clon Express Mix, ligation at 50°C for 50 min.

[0091] 4. The ligation product was transformed into E. coli DH5α competent cells. The transformation method is as follows:

[0092] (1) Aseptically take 100 μL of competent cells, add the ligation product, mix well, and place on ice for 30 minutes.

[0093] (2) Heat shock at 42°C for 90 seconds and immediately place on ice for 3 minutes.

[0094] (3) Add 1000 μL LB medium and incubate at 37°C, 220 rpm for 40 min.

[0095] (4) Spread 200 μL of the solution onto an LB plate containing 50 μg / mL Kan. Incubate the plate upside down at 37°C overnight.

[0096] Positive transformants were selected, plasmids were extracted, and sequencing verification results showed that the connection was successful, and the recombinant vector pBS-Zeo-PdΔ19Des or pBS-Zeo-LsΔ19Des was obtained. Figure 5 The left figure shows the colony PCR verification results of the pBS-Zeo-PdΔ19Des plasmid construction, where the correct band size should be approximately 1400 bp, while the PCR band size of the unsuccessfully connected plasmid should be approximately 300 bp. As shown in the figure, the bright bands in channels 3 to 9 indicate that the plasmid was successfully constructed. The right figure shows the colony PCR verification results of the pBS-Zeo-LsΔ19Des plasmid construction, where the correct band size should be approximately 1600 bp, while the PCR band size of the unsuccessfully connected plasmid should be approximately 500 bp. As shown in the figure, the bright bands in channels 2 to 8 indicate that the plasmid was successfully constructed.

[0097] Example 2. Construction of genetically engineered Schizochytrium strains HX-308-Pd and HX-308-Ls

[0098] 1. Preparation of Schizochytrium competent cells

[0099] (1) Pick a single colony of Schizochytrium sp. HX-308 that has been activated on the plate and add it to 50 mL of seed culture medium. Incubate the culture in a shaking incubator at 28°C and 170 rpm for 24 h.

[0100] (2) Transfer 5% of the inoculum to 50 mL of seed culture medium and culture in a shaking incubator at 28°C and 170 rpm for 24 h.

[0101] (3) Repeat step (2).

[0102] (4) Take 25 mL of bacterial solution, centrifuge at 4000 rpm at room temperature for 2 min, and discard the supernatant.

[0103] (5) Resuspend the cells in 25 mL of pretreatment reagent (20 mM DTT and 0.1 M CaCl2 dissolved in pH 6.5 Tris-HCl buffer) and shake gently to loosen the cell walls.

[0104] (6) After centrifugation, wash the cells twice with 25 mL of pre-cooled sterile water (pre-cooled in a 4°C refrigerator). The centrifugation conditions were: 4000 rpm, 4°C, 2 min.

[0105] (7) Wash the cells twice with 1 M sterile, pre-cooled (pre-refrigerated at 4°C) sorbitol aqueous solution (containing 0.1 M CaCl2). The centrifugation conditions were: 4000 rpm, 4°C, 2 min.

[0106] (8) Resuspend the cells in 200 μL of 1 M sterile, pre-cooled (pre-chilled at 4°C) sorbitol aqueous solution (containing 0.1 M CaCl2), and dispense into 1.5 mL sterile centrifuge tubes, 100 μL per tube, and keep on ice until ready to use.

[0107] 2. Electrotransformation of Schizochytrium

[0108] (1) Add 10 μL of linearized pBS-Zeo-PdΔ19Des or pBS-Zeo-LsΔ19Des vector to 100 μL of Schizochytrium competent cells, mix well, and transfer to a pre-cooled (pre-cooled at 4°C) electroporation cuvette and place on ice for 30 min.

[0109] (2) Electric shock, 2KV, one pulse.

[0110] (3) Immediately add 1 mL of pre-cooled (pre-chilled at 4°C) seed culture medium containing 1 M sorbitol to the electroporation cup, mix well, and transfer to the seed culture medium containing 1 M sorbitol.

[0111] (4) Incubate at 28°C, 180 rpm for 2 to 3 hours.

[0112] (5) Take an appropriate amount of bacterial solution and spread it on a solid plate (plate culture medium) containing 100 mg / L bleomycin resistance and culture at 28°C for 2 to 4 days.

[0113] 3. Screening and identification of genetically engineered Schizochytrium strains HX-308-Pd or HX-308-Ls that overexpress the PdΔ19Des gene from Platynereis dumerilii or the LsΔ19Des gene from Lepeophtheirus salmonis

[0114] (1) Select colonies from the plate and inoculate them into a seed culture medium containing 100 mg / L bleomycin. Incubate at 28°C and 180 rpm for 24 h.

[0115] (2) The overexpression vector was subcultured 5 times to ensure stable inheritance. The experiment described in step (1) was repeated in each generation.

[0116] (3) The stable genetic strains were the genetically engineered Schizochytrium strains HX-308-Pd or HX-308-Ls phenotypes and were stored in a -80°C freezer.

[0117] Experimental Example 3. Construction of recombinant vector pBS-Zeo-Pd-Ls

[0118] Based on the sequence information of the PdΔ19Des or LsΔ19Des genes from Platynereis dumerilii or Lepeophtheirus salmonis, primers Pd2-F, Pd2-R, Ls2-F, and Ls2-R (shown in SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, and SEQ ID No. 10) were designed. The TAG stop codon at the end of the PdΔ19Des gene was deleted and a 2A peptide sequence encoding the gene was inserted. PCR reactions were performed using PrimeStar High-Fidelity DNA Polymerase using the synthesized DNA as a template, using primers Pd2-F, Pd2-R, and Ls2-F, Ls2-R, respectively. These primers contain sequences homologous to the pBS-Zeo vector, as indicated by the underlined portion. The PCR reaction program was as follows: 95°C for 5 min, 95°C for 30 s, 58°C for 30 s, and 72°C for 40 s. 33 cycles were set starting from the second step. After the PCR product was obtained and verified by agarose gel electrophoresis, it was recovered and purified.

[0119] SEQ ID No.7Pd2-F:

[0120] AGCCGAGCGCGGGAGGGAAG ATGGCCCCCACGCAGGCCAT

[0121] SEQ ID No.8Pd2-R:

[0122] ATCTTCTTATGTTTTTCCATAGGTCCAGGATTCTCCTCGACGTCAC

[0123] SEQ ID No.9Ls2-F:

[0124] TCGAGGAGAATCCTGGACCT ATGGAAAAACATAAGAAGATGCC

[0125] SEQ ID No.10Ls2-R:

[0126] TGACATAACTAATTACATGATTAATTTGACTTTTTGGTAGTAACAT

[0127] 2. Digest the vector plasmid pBS-Zeo with the restriction endonuclease KpnI, verify by agarose gel electrophoresis, and recover the fragment. Enzyme digestion system (50 μL): 4000 μg of vector plasmid, 2 μL of KpnI, 5 μL of 10× QCut Buffer, and up to 50 μL of ddH2O.

[0128] 3. The pBS-Zeo fragment after enzyme digestion and the PdΔ19Des and LsΔ19Des fragments amplified using primers Pd2-F, Pd2-R, Ls2-F, and Ls2-R were ligated by one-step cloning to obtain the recombinant vector pBS-Zeo-Pd-Ls. Figure 3 One-step cloning system (10 μL): 4 μL target gene fragment (2 μL each of PdΔ19Des and LsΔ19Des), 1 μL vector enzyme-digested fragment, 5 μL 2× ClonExpressMix, ligation at 50°C for 50 min.

[0129] 4. The ligation product was transformed into E. coli DH5α competent cells. The transformation method is as follows:

[0130] (1) Aseptically take 100 μL of competent cells, add the ligation product, mix well, and place on ice for 30 minutes.

[0131] (2) Heat shock at 42°C for 90 seconds and immediately place on ice for 3 minutes.

[0132] (3) Add 1000 μL LB medium and incubate at 37°C, 220 rpm for 40 min.

[0133] (4) Spread 200 μL of the solution onto an LB plate containing 50 μg / mL Kan. Incubate the plate upside down at 37°C overnight.

[0134] Positive transformants were selected, plasmids were extracted, and sequencing verification results showed that the connection was successful, and the recombinant vector pBS-Zeo-Pd-Ls was obtained. Figure 6 This figure shows the colony PCR verification results of the pBS-Zeo-Pd-Ls plasmid construction. The correct band size should be approximately 2600 bp, while false positive colonies that did not successfully connect should have no visible bands. As shown in the figure, the bright bands in channels 4, 5, 6, 8, and 9 indicate that the plasmid was successfully constructed.

[0135] Example 4. Construction of the genetically engineered Schizochytrium strain HX-308-Pd-Ls

[0136] 1. Preparation of Schizochytrium competent cells

[0137] (1) Pick a single activated Schizochytrium sp. HX-308 strain from the plate and add it to 50 mL of seed culture medium. Incubate the culture in a shaking incubator at 28°C and 170 rpm for 24 h.

[0138] (2) Transfer 5% of the inoculum to 50 mL of seed culture medium and culture in a shaking incubator at 28°C and 170 rpm for 24 h.

[0139] (3) Repeat step (2).

[0140] (4) Take 25 mL of bacterial solution, centrifuge at 4000 rpm at room temperature for 2 min, and discard the supernatant.

[0141] (5) Resuspend the cells in 25 mL of pretreatment reagent (20 mM DTT and 0.1 M CaCl2 dissolved in pH 6.5 Tris-HCl buffer) and shake gently to loosen the cell walls.

[0142] (6) After centrifugation, wash the cells twice with 25 mL of pre-cooled sterile water (pre-cooled in a 4°C refrigerator). The centrifugation conditions were: 4000 rpm, 4°C, 2 min.

[0143] (7) Wash the cells twice with 1 M sterile, pre-cooled (pre-refrigerated at 4°C) sorbitol aqueous solution (containing 0.1 M CaCl2). The centrifugation conditions were: 4000 rpm, 4°C, 2 min.

[0144] (8) Resuspend the cells in 200 μL of 1 M sterile, pre-cooled (pre-chilled at 4°C) sorbitol aqueous solution (containing 0.1 M CaCl2), and dispense into 1.5 mL sterile centrifuge tubes, 100 μL per tube, and keep on ice until ready to use.

[0145] 2. Electrotransformation of Schizochytrium

[0146] (1) Add 10 μL of the linearized pBS-Zeo-Pd-Ls vector to 100 μL of Schizochytrium competent cells, mix well, and transfer to a pre-cooled (pre-cooled in a 4°C refrigerator) electroporation cup and let it stand on ice for 30 min.

[0147] (2) Electric shock, 2KV, one pulse.

[0148] (3) Immediately add 1 mL of pre-cooled (pre-chilled at 4°C) seed culture medium containing 1 M sorbitol to the electroporation cup, mix well, and transfer to the seed culture medium containing 1 M sorbitol.

[0149] (4) Incubate at 28°C, 180 rpm for 2 to 3 hours.

[0150] (5) Take an appropriate amount of bacterial solution and spread it on a solid plate (plate culture medium) containing 100 mg / L bleomycin resistance and culture at 28°C for 2 to 4 days.

[0151] 3. Screening and identification of the Schizochytrium genetically engineered strain HX-308-Pd-Ls overexpressing the PdΔ19Des gene from Platynereis dumerilii and the LsΔ19Des gene from Lepeophtheirus salmonis

[0152] (1) Select colonies from the plate and inoculate them into a seed culture medium containing 100 mg / L bleomycin. Incubate at 28°C and 180 rpm for 24 h.

[0153] (2) The overexpression vector was subcultured 5 times to ensure stable inheritance. The experiment described in step (1) was repeated in each generation.

[0154] (3) The stable genetic strain is the Schizochytrium genetically engineered strain HX-308-Pd-Ls phenotype, which was stored in a -80℃ refrigerator.

[0155] Example 5. Determination of oil content and composition in genetically engineered Schizochytrium strains HX-308-Pd, HX-308-Ls, and HX-308-Pd-Ls

[0156] 1. Fermentation Seed Culture: After culturing the above-mentioned genetically engineered strain on a 100 mg / L bleomycin-resistant plate (plate culture medium), and simultaneously culturing the original type of Schizochytrium strain on a plate (plate culture medium), pick a single colony and inoculate it into a 250 mL Erlenmeyer flask (containing 50 mL of seed culture medium). Incubate it at 28°C, 180 rpm, and shake for 24 hours to obtain the first-level seed. Take 1 mL of the first-level seed culture and inoculate it into a 250 mL Erlenmeyer flask (containing 50 mL of seed culture medium). Incubate it at 28°C, 180 rpm, and shake for 24 hours to obtain the second-level seed. Take 1 mL of the second-level seed culture and inoculate it into a 250 mL Erlenmeyer flask (containing 50 mL of seed culture medium). Incubate it at 28°C, 180 rpm, and shake for 24 hours to obtain the third-level seed, which will be used as the fermentation strain.

[0157] 2. Shake flask fermentation: Take 10 mL of the third-grade seed culture solution and inoculate it into a 500 mL conical flask (containing 90 mL of fermentation medium). Incubate it in a shaker at 28°C and 180 rpm for 120 h, and take samples to determine the oil content.

[0158] 3. Collecting the cells to extract lipids, including the following steps:

[0159] (1) After the fermentation culture is completed, NaOH solution is added to the fermentation broth to adjust the pH to 10-12, and then a cell wall-breaking enzyme is added at a final mass concentration of 0.1-0.5% (w / v). The mixture is shaken at 50-60° C. and 100-200 rpm for 6-12 hours.

[0160] (2) Cool to room temperature, add an equal volume of anhydrous ethanol to the fermentation broth and shake for 1 h to inactivate the cell wall-breaking enzyme;

[0161] (3) Add n-hexane with the same volume as anhydrous ethanol for extraction and collect the upper organic phase;

[0162] (4) Gas phase detection and analysis of fatty acids.

[0163] The results of the determination of oil content and fatty acid ratio are shown in Table 1.

[0164] Table 1 Comparison of fermentation oil content and fatty acid composition of different strains

[0165]

[0166] The results are shown in Table 1 and Figure 4 As shown, the results show that the genetically engineered strain of Schizochytrium expressing a heterologous Δ19-specific ω-3 desaturase obtained by the method of the present invention has genetic stability over multiple generations. At the same time, both PdΔ19Des and LsΔ19Des promoted the conversion of ω-6DPA to ω-3DHA in Schizochytrium, increasing the DHA content by 14.2% and 9.9%, respectively, compared to the starting strain, indicating that the ω-3 desaturase activity of PdΔ19Des was slightly higher than that of LsΔ19Des. In the final genetically engineered strain HX-308-Pd-Ls, the DHA / DPA ratio was further increased to 4.19, a 67% increase compared to the control strain, and the final DHA content increased by 20%, but there was no significant change in biomass and oil content. This shows that the method of heterologous expression of ω-3 desaturase can effectively reduce the DPA ratio and help obtain high-quality oils with high DHA content.

[0167] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A genetically engineered strain of Schizochytrium that reduces the DPA ratio in oils and fats and correspondingly increases the DHA content, characterized by: The strain is constructed using Schizochytrium sp. HX-308 as a starting strain, and the strain heterologously expresses an ω-3 desaturase gene from Platynereis dumerilii and / or Lepeophtheirus salmonis to reduce the DPA ratio in oil and fat and correspondingly increase the DHA content; The ω-3 desaturase gene is PdΔ19Des from Platynereis dumerilii or LsΔ19Des from Lepeophtheirus salmonis; the nucleotide sequences of the PdΔ19Des gene and the LsΔ19Des gene are shown in SEQ ID No. 1 and SEQ ID No.

2.

2. Use of the genetically engineered strain of Chytridium as claimed in claim 1 in fermentation production for reducing the DPA ratio in oils and fats and correspondingly increasing the DHA content.

3. The method for constructing a genetically engineered strain of Chytridium according to claim 1, wherein: The steps include: When the strain heterologously expresses the ω-3 desaturase gene from Platynereis dumerilii or Lepeophtheirus salmonis to reduce the DPA ratio in oil and fat and correspondingly increase the DHA content, the construction method of the strain comprises the following steps: 1) Clone the Δ19Des gene from Platynereis dumerilii or Lepeophtheirus salmonis and insert the gene into the pBS-Zeo plasmid using a one-step cloning technique to construct the recombinant vector pBS-Zeo-PdΔ19Des or pBS-Zeo-LsΔ19Des; 2) The recombinant vector pBS-Zeo-PdΔ19Des or pBS-Zeo-LsΔ19Des was linearized and then electroporated into Schizochytrium sp. HX-308 to obtain the Schizochytrium sp. HX-308-Pd and HX-308-Ls genetically engineered strains overexpressing the PdΔ19Des or LsΔ19Des genes; When the strain heterologously expresses ω-3 desaturase genes from Platynereis dumerilii and Lepeophtheirus salmonis to reduce the DPA ratio in oil and fat and correspondingly increase the DHA content, the construction method of the strain comprises the following steps: 1) The cloned Δ19Des gene from Platynereis dumerilii or Lepeophtheirus salmonis was inserted into the pBS-Zeo plasmid via a 2A peptide linkage to construct the recombinant vector pBS-Zeo-Pd-Ls; 2) The recombinant vector pBS-Zeo-Pd-Ls was linearized and then electroporated into Schizochytrium sp. HX-308 to obtain the Schizochytrium sp. HX-308-Pd-Ls genetically engineered strain overexpressing the PdΔ19Des or LsΔ19Des gene.

4. A method for producing oil with a low DPA ratio and correspondingly increased DHA content using the genetically engineered strain of Chytridium according to claim 1, characterized in that: The steps include: The genetically engineered strain is inoculated into a seed culture medium for activation culture to obtain a fermentation seed strain, which is then inoculated into a fermentation culture medium for fermentation culture, and the fermentation liquid is collected after the culture is completed.

5. The method according to claim 4, characterized in that: The genetically engineered strain is inoculated from the plate culture medium to the seed culture medium and cultured twice continuously to obtain a first-level seed solution and a second-level and a third-level seed solution, respectively. The third-level seed solution obtained at last is used as the fermentation seed strain; The seed solution is cultured at 25-28° C. and shaken at 160-200 r / min in an incubator for 20-28 hours.

6. The method according to claim 5, characterized in that: After the genetically engineered strain is inoculated on a plate culture medium, a single colony is picked and activated on a seed culture medium; The plate culture medium has a pH value of 6.4 and contains 100 mg / L bleomycin Zeocin resistance for screening. Other ingredients include: 20 g / L agar, 40 g / L glucose, 15 g / L yeast extract, 10 g / L sodium sulfate, 3 g / L magnesium sulfate, 8 g / L ammonium sulfate, 2 g / L potassium chloride, 0.1 g / L calcium chloride, 0.8 g / L potassium sulfate, 0.8 g / L potassium dihydrogen phosphate, 8 g / L sodium glutamate, 5 mg / L zinc sulfate heptahydrate, 0.05 mg / L cobalt dichloride hexahydrate, 4 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 8 mg / L ferrous sulfate heptahydrate, 3 mg / L calcium pantothenate, 5 mg / L manganese chloride tetrahydrate, 0.04 mg / L sodium molybdate dihydrate, 7 mg / L vitamin B6, and 1 mg / L vitamin B6. 12 1 mg / L.

7. The method according to claim 4, characterized in that: The seed culture medium has a pH value of 6.4 and comprises: 60 g / L glucose, 5 g / L yeast extract, 5 g / L sodium sulfate, 2 g / L magnesium sulfate, 4 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.5 g / L potassium sulfate, 0.5 g / L potassium dihydrogen phosphate, 8 g / L sodium glutamate, 3 mg / L zinc sulfate heptahydrate, 0.03 mg / L cobalt dichloride hexahydrate, 4 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 8 mg / L ferrous sulfate heptahydrate, 2 mg / L calcium pantothenate, 4 mg / L manganese chloride tetrahydrate, and 0.04 mg / L sodium molybdate dihydrate. Alternatively, the fermentation medium has a pH of 6.0 and comprises: 90 g / L glucose, 15 g / L yeast extract, 10 g / L sodium sulfate, 3 g / L magnesium sulfate, 8 g / L ammonium sulfate, 2 g / L potassium chloride, 0.1 g / L calcium chloride, 0.8 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 15 g / L sodium glutamate, 3 mg / L zinc sulfate heptahydrate, 0.08 mg / L cobalt dichloride hexahydrate, 5 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 10 mg / L ferrous sulfate heptahydrate, 2 mg / L calcium pantothenate, 4 mg / L manganese chloride tetrahydrate, 0.04 mg / L sodium molybdate dihydrate, 8 mg / L vitamin B6, and 1 mg / L vitamin B6. 12 2 mg / L.

8. The method according to any one of claims 4 to 7, characterized in that: Methods for detecting oil content and fatty acid composition in fermentation broth include: 1) After the fermentation is completed, NaOH solution is added to the fermentation broth to adjust the pH to 10-12, and then a cell wall-breaking enzyme is added at a final concentration of 0.1-0.5%, and the mixture is reacted at 50-60°C and 100-200 rpm for 6-12 hours; 2) Add an equal volume of anhydrous ethanol to the fermentation broth and continue shaking for 1 hour to inactivate the cell wall-breaking enzyme; 3) Add an equal volume of anhydrous ethanol and n-hexane and continue shaking for 1 hour to extract lipids from the fermentation broth. After shaking, let it stand at room temperature until the layers separate, and collect the upper organic phase; 4) Repeat step 3) several times and combine the collected organic phases, and evaporate the n-hexane by rotary evaporation to obtain oil.

Images