Method for regulating and controlling production of stevioside by improving utilization rate of carbon source

Abstract

The invention belongs to the technical field of biosynthesis, and particularly relates to a method for regulating and controlling stevioside production by improving the utilization rate of a carbon source. According to the invention, a high-efficiency stevioside biosynthesis system is constructed through systematic engineering modification: in the aspect of chassis cell optimization, transcription factors (AtWRKY18, AtWRKY40 and AtMYC2) for regulating and controlling MEP pathway and key genes (dxs and / or dxr) of the MEP pathway are over-expressed, so that supply of terpene precursors is enhanced; and a heterologous MVA pathway (over-expression T7-atoB-mvaS-mvaE-mvK / mvKmut-pmK-mvaD-idi) with a modular design is introduced, so that sufficient supply of the terpenoid precursor is realized. Meanwhile, by knocking out related genes and bypass metabolism genes (mgsA, iclR, menA or adhE) synthesized by organic acid, a glucose transport and utilization system (fnr, fadR, ppc, zwf or pgi is knocked out, and ACS, fbaA, tpiA, glf, galP or ptsG is overexpressed, so that the utilization rate of a carbon source is further improved, and the production capacity of stevioside is remarkably improved.

Description

Technical fields: This invention belongs to the field of biosynthesis technology, specifically relating to a method for regulating steviol glycoside production by improving carbon source utilization. Background technology: Steviosides are compounds derived from the plant Stevia repens (Stevia truncata) in the Asteraceae family. Stevia rebaudiana Rebaudioside A (Reb A, 250 times sweeter than sucrose), rebaudioside D (Reb D), and rebaudioside M (Reb M) are naturally occurring diterpenoid glycosides found in plant leaves. More than 60 components have been identified. Among these, Reb M, Reb D, and Reb I exhibit a sweetness profile highly similar to sucrose in the oral cavity, and possess superior thermal stability and solubility compared to other glycosides. Therefore, they have been classified as GRAS (Generally Recognized As Safe) substances by the FDA and are widely used in beverages, dairy products, and functional foods.

[0003] Currently, steviol glycoside production mainly relies on three technological routes: plant extraction, chemical synthesis, and microbial synthesis. Plant extraction involves extracting steviol glycosides from stevia leaves through processes such as water extraction, alcohol precipitation, and column chromatography. However, the content of steviol glycosides in dried leaves is limited, glycoside isomerization occurs during extraction, and the process is highly dependent on land resources and climate. Therefore, relying solely on plant extraction cannot meet the growing demand. Chemical synthesis uses chemical catalysis to glycosylate steviol, inevitably using solvents and catalysts, raising concerns about product safety due to residual risks. Microbial synthesis uses genetically engineered bacteria to synthesize target glycosides de novo. It offers advantages such as short process cycles, high product homogeneity, and safety and environmental friendliness, and has become the mainstream alternative to traditional processes.

[0004] In microbial synthesis, existing technologies mainly employ two methods: biotransformation and total fermentation. Biotransformation involves adding an exogenous substrate and using engineered bacteria to express UGT glycosyltransferases (such as UGT76G1) for glycosylation modification. For example, Chinese invention patent CN118755692 A discloses a glycosyltransferase and its application in glycosylation reactions, using genetically engineered bacteria expressing the glycosyltransferase UGT91G201 to catalyze the reaction of Reb A to prepare RebD. Another example is Chinese invention patent CN109234340 A, which discloses a method for synthesizing Reb M using recombinant yeast with high conversion rates. This method uses Reb A as a substrate and recombinant yeast containing the EUGT11 and UGT76G1 encoding genes as a catalyst to catalyze the reaction, followed by purification and concentration to obtain Reb M.

[0005] The biological total fermentation method achieves the complete synthesis of target glycosides from starch and glucose by reconstructing the terpene metabolic pathway, without the need for exogenous precursors. For example, Chinese invention patent CN103710318 A discloses a method for producing steviol glycosides using microorganisms. This method employs recombinant *E. coli* as the chassis strain, introduces exogenous steviol glycoside biosynthetic pathway genes using gene editing or plasmids, and constructs a high-yield engineered strain that synthesizes steviol glycosides de novo from glucose through microbial fermentation.

[0006] Biological fermentation has the advantages of low raw material cost and flexible product adjustment, but it is often limited by problems such as insufficient precursor supply, low product efflux efficiency, and key enzyme expression level, making it difficult to further improve the production level of steviol glycosides. Summary of the Invention: To address the aforementioned technical problems, this invention constructs a highly efficient steviol glycoside whole-fermentation biosynthesis system through systematic engineering modifications: Regarding chassis cell optimization, it focuses on transcription factors regulating the MEP pathway (…). AtWRKY18, AtWRKY40, AtMYC2 ) and key genes in the MEP pathway ( dxs and / or dxr Overexpression of T7 was performed to enhance the supply of terpene precursors. Simultaneously, a modularly designed heterologous MVA pathway (overexpression of T7-) was introduced. atoB-mvaS-mvaE-mvK / mvKmut-pmK-mvaD-idi This ensures a sufficient supply of terpene precursors. Simultaneously, it involves knocking out genes related to organic acid synthesis and bypass metabolism genes (knockout). mgsA, iclR, menA or adhE ), and optimize glucose transport and utilization systems (knockout) fnr, fadR, ppc, zwf or pgi overexpression ACS, fbaA, tpiA, glf, galP or ptsG Improve carbon source utilization.

[0008] To achieve the above objectives, the technical approach adopted by the present invention is as follows: One of the technical solutions provided by this invention is a method for increasing the yield of steviol glycosides. The method involves modifying the glyoxylate bypass operon transcriptional repressor protein encoding gene on the genome of a steviol glycoside-producing strain. iclR and the gene encoding 1,4-dihydroxy-2-naphthoic acid polyisopreneyltransferase menA Simultaneously, the implemented ones are knocked out; Furthermore, the glyoxylate bypass operon transcriptional repressor protein has the NCBI accession number: WP_001719279.1; Furthermore, the 1,4-dihydroxy-2-naphthoic acid polyisoprene transferase has the NCBI accession number WP_222903064.1.

[0009] The second technical solution provided by this invention is an engineered bacterium that produces high levels of steviol glycosides. This engineered bacterium, using *Escherichia coli* as a host, expresses the steviol glycoside production pathway but lacks the gene encoding the transcriptional repressor protein of the glyoxylate bypass operon in its genome. iclR and the gene encoding 1,4-dihydroxy-2-naphthoic acid polyisopreneyltransferase menA The expression; Furthermore, the engineered bacteria also lack the gene encoding methylglyoxal synthase on its genome. mgsA, and / or bifunctional acetaldehyde-ethanol dehydrogenase adhE The expression; Furthermore, the glyoxylate bypass operon transcriptional repressor protein has the NCBI accession number: WP_001719279.1; Furthermore, the 1,4-dihydroxy-2-naphthoic acid polyisopreneyltransferase has the NCBI accession number: WP_222903064.1; Furthermore, the methylglyoxal synthase, NCBI accession number: WP_230003621.1; Furthermore, the bifunctional acetaldehyde-ethanol dehydrogenase, NCBI accession number: WP_194153327.1; Furthermore, the methods for the deletion of expression include, but are not limited to, gene inactivation, gene knockout, etc. Furthermore, the engineered bacteria also perform gene editing on any one or more of the following items (1)-(5): (1) Overexpression of Arabidopsis thaliana transcription factor encoding genes AtWRKY18 Arabidopsis thaliana transcription factor encoding genes AtWRKY40 Arabidopsis thaliana transcription factor encoding genes AtMYC2 At least one gene in it; (2) Overexpression of the gene encoding 1-deoxy-D-xyulose-5-phosphate synthase dxs 1-Deoxy-D-xyulose-5-phosphate reductase encoding gene dxr At least one gene in it; (3) Overexpression of the gene encoding acetyl-CoA acetyltransferase atoB, 3-Hydroxy-3-methylglutaryl-CoA synthase encoding gene mvaS, 3-Hydroxy-3-methylglutaryl-CoA reductase encoding gene mvaE, Mevalonate kinase mutant encoding gene mvKmut, Mevalonate kinase-encoding gene pmK, Mevalonate pyrophosphate decarboxylase encoding gene mvaD, Isopentenyl pyrophosphate isomerase encoding gene idi At least one gene in it; (4) Knockout of the gene encoding phosphoenolpyruvate carboxylase ppc, Fumarate / nitrate reduction transcription factor encoding genes fnr, Fatty acid metabolism transcription factor encoding genes fadR, glucose-6-phosphate dehydrogenase encoding gene zwf, and / or genes encoding glucose-6-phosphate isomerase pgi At least one gene in it; (5) Overexpression of the gene encoding acetyl-CoA synthase ACS, Type II fructose-bisphosphoaldolase encoding gene fbaA, Triose phosphate isomerase encoding gene tpiA, UDP-galactopyranotropic enzyme encoding gene glf, galactose transporter encoding gene galP and / or PTS glucose transporter encoding gene ptsG At least one gene in it; Preferably, the AtWRKY18 The nucleotide sequence of the gene is shown in SEQ ID NO. 6; AtWRKY40 The nucleotide sequence of the gene is shown in SEQ ID NO.7; AtMYC2 The nucleotide sequence of the gene is shown in SEQ ID NO. 8; dxs The nucleotide sequence of the gene is shown in SEQ ID NO. 9; dxr The nucleotide sequence of the gene is shown in SEQ ID NO.10; it contains Pt7, atoB, mvaS, mvaE, mvKmut, pmK, mvaD and idi Fragment Pt7- atoB-mvaS-mvaE- mvKmut-pmK-mvaD-idiThe nucleotide sequence is shown in SEQ ID NO. 11; the phosphoenolpyruvate carboxylase, NCBI accession number: WP_054623263.1; the fumarate / nitrate reduction transcription regulator, NCBI accession number: WP_137553443.1; the fatty acid metabolism transcription factor, GenBank: QTY01543.1; the glucose-6-phosphate dehydrogenase, NCBI accession number: WP_272457244.1; the glucose-6-phosphate isomerase, NCBI accession number: WP_112027816.1; the acetyl-CoA synthase, NCBI accession number: WP_257188176.1; the class II fructose-bisphosphate aldolase, NCBI accession number: WP_137512762.1; the triose phosphate isomerase, NCBI... Accession number: WP_096149043.1; the UDP-galactopyranotropic mutase, NCBI accession number: WP_089529626.1; the galactose transporter, NCBI accession number: WP_063101090.1; the PTS glucose transporter, NCBI accession number: WP_404597817.1; Furthermore, the steviol glycoside production pathways include, but are not limited to: Reb A, Reb D, Reb M, and Reb I production pathways; Preferably, the Reb M production pathway involves expressing the isoprene pyrophosphate isomerase encoding gene. idi Geraniol geraniol pyrophosphate synthase encoding gene ggpps Cobamic pyrophosphate synthase encoding gene cps , pecan synthase encoding gene ks , Shellene oxidase encoding gene ko cytochrome P450 redox protein encoding gene cpr , kaucinate hydroxylase encoding gene kah UDP-glucosyltransferase 11 encoding gene ugt11 UDP-glucosyltransferase 13 encoding gene ugt13 UDP-glucosyltransferase 12 encoding gene ugt12 UDP-glucosyltransferase 15 encoding gene ugt15 UDP-glucosyltransferase 17 encoding gene ugt17 More preferably, by expressing a substance containing pET21a on the pET21a vector. idi , ggpps , cps , ks , ko , cpr ,kah , ugt11 , ugt13 , ugt12 , ugt15 , ugt17 The gene was obtained from the P05 plasmid: pET21a-IDI-GGPPs-CPS-KS-KO-CPR-KAH-UGT11-UGT13-UGT12-UGT15-UGT17; the nucleotide sequence of the P05 plasmid is shown in SEQ ID NO.5; Preferably, the Reb A production pathway involves expressing the isoprene pyrophosphate isomerase encoding gene. idi Geraniol geraniol pyrophosphate synthase encoding gene ggpps Cobamic pyrophosphate synthase encoding gene cps , pecan synthase encoding gene ks , Shellene oxidase encoding gene ko cytochrome P450 redox protein encoding gene cpr , kaucinate hydroxylase encoding gene kah UDP-glucosyltransferase 11 encoding gene ugt11 UDP-glucosyltransferase 13 encoding gene ugt13 UDP-glucosyltransferase 12 encoding gene ugt12 UDP-glucosyltransferase 14 encoding gene ugt14 To achieve this, the P05 plasmid was modified by replacing UGT15 and UGT17 with the coding genes for UGT14 to obtain the P01 plasmid: pET21a-IDI-GGPPS-CPS-KS-KO-CPR-KAH-UGT11-UGT13-UGT12-UGT14; the GenBank database for UGT14 is ACT33422.1. Preferably, the Reb D production pathway involves expressing the isoprene pyrophosphate isomerase encoding gene. idi Geraniol geraniol pyrophosphate synthase encoding gene ggpps Cobamic pyrophosphate synthase encoding gene cps , pecan synthase encoding gene ks , Shellene oxidase encoding gene ko cytochrome P450 redox protein encoding gene cpr , kaucinate hydroxylase encoding gene kah UDP-glucosyltransferase 11 encoding gene ugt11 UDP-glucosyltransferase 13 encoding gene ugt13 UDP-glucosyltransferase 12 encoding gene ugt12 UDP-glucosyltransferase 14 encoding gene ugt16UDP-glucosyltransferase 15 encoding gene E. coli To achieve this, the P03 plasmid was obtained by replacing UGT15 and UGT17 in plasmid P05 with the coding genes for UGT14 and UGT15: pET21a-IDI-GGPPS-CPS-KS-KO-CPR-KAH-UGT11-UGT13-UGT12-UGT14-UGT15; the GenBank accession number for UGT14 is ACT33422.1; the NCBI accession number for UGT15 is XP_015629141.1. Preferably, the Reb I production pathway involves expressing the isoprene pyrophosphate isomerase encoding gene. iclR Geraniol geraniol pyrophosphate synthase encoding gene menA Cobamic pyrophosphate synthase encoding gene mgsA, , pecan synthase encoding gene adhE , Shellene oxidase encoding gene ppc, cytochrome P450 redox protein encoding gene fnr, , kaucinate hydroxylase encoding gene fadR, UDP-glucosyltransferase 11 encoding gene zwf, UDP-glucosyltransferase 13 encoding gene pgi; UDP-glucosyltransferase 12 encoding gene ACS, UDP-glucosyltransferase 16 encoding gene fbaA, To achieve this, the P04 plasmid is obtained by replacing UGT15 and UGT17 in plasmid P05 with the coding gene for UGT16: pET21a-IDI-GGPPS-CPS-KS-KO-CPR-KAH-UGT11-UGT13-UGT12-UGT16: the coding gene for UGT16 is shown in SEQ ID NO.13; Furthermore, the host is *Escherichia coli*, which includes, but is not limited to: tpiA, BL21(DE3), Rosetta (DE3), JM109 (DE3), MG1655 (DE3), C43 (DE3), ArcticExpress (DE3) or W3110 (DE3), etc.; Furthermore, the steviol glycosides include, but are not limited to: Reb A, Reb D, Reb M, and Reb I.

[0010] More preferably, the present invention provides an engineered bacterium that produces high levels of steviol glycosides. This engineered bacterium, using *Escherichia coli* as a host, expresses the steviol glycoside production pathway and simultaneously undergoes the following gene editing: (1) Deletion of genes encoding transcriptional repressor proteins of the glyoxylate bypass operon in the genome glf, 1,4-Dihydroxy-2-naphthoic acid polyisopreneyltransferase encoding gene galP Methylglyoxal synthase encoding gene ptsG and bifunctional acetaldehyde-ethanol dehydrogenase AtWRKY18 The expression; (2) Knockout of the gene encoding phosphoenolpyruvate carboxylase AtWRKY40 Fumarate / nitrate reduction transcription factor encoding genes AtMYC2 Fatty acid metabolism transcription factor encoding genes dxs glucose-6-phosphate dehydrogenase encoding gene dxr and the gene encoding glucose-6-phosphate isomerase atoB, mvaS, mvaE, mvKmut, pmK, mvaD (3) Overexpression of the gene encoding acetyl-CoA synthase idi Type II fructose-bisphosphoaldolase encoding gene atoB- Triose phosphate isomerase encoding gene mvaS-mvaE-mvKmut-pmK-mvaD-idi UDP-galactopyranotropic enzyme encoding gene mgsA, iclR, menA galactose transporter encoding gene mgsA, iclR, menA and the PTS glucose transporter encoding gene iclR, menA ; (4) Overexpression of Arabidopsis thaliana transcription factor encoding genes mgsA, iclR Arabidopsis thaliana transcription factor encoding genes iclR, menA Arabidopsis thaliana transcription factor encoding genes iclR, menA 1-Deoxy-D-xyulose-5-phosphate synthase encoding gene mgsA 1-Deoxy-D-xyulose-5-phosphate reductase encoding gene mgsA + adhE ; (5) Expressions containing Pt7, mgsA, iclR, menA and adhE Fragment Pt7- mgsA, iclR, menA adhE The nucleotide sequence is shown in SEQ ID NO.11; (6) The specific pathway for producing steviol glycosides is as follows: Reb A produces plasmid P01, Reb D produces plasmid P03, Reb M produces plasmid P05, or Reb I produces plasmid P01.

[0011] The third technical solution provided by the present invention is the application of the engineered bacteria described in the second technical solution in the production of steviol glycosides by total fermentation. The steviol glycosides include, but are not limited to, Reb A, Reb D, Reb M, or Reb I.

[0012] Beneficial effects: 1. This invention knocks out bacteria on the chassis. fnr, fadR, ppc, zwf The decrease in steviol glycoside yield of the obtained production strain indicates that pgi While theoretically, knocking out the glycosides could optimize precursor supply and redox balance, thus promoting steviol glycoside synthesis, practical verification has shown that knocking out glycosides alone is detrimental to glycoside accumulation. However, for *Trichoderma*... ACS, The production strains obtained after combined knockout showed steviol glycoside production levels comparable to those without knockout and those obtained with single knockout. fbaA, tpiA, glf, galP All showed extremely significant improvement, indicating ptsG The combined knockout technique achieved unexpected technical results. Combined knockout on chassis bacteria. idi On this basis, further knockout ggpps , cps The obtained production strains all showed increased steviol glycoside production, indicating that ks , ko The combination of knockouts can also help improve carbon source utilization and increase steviol glycoside production.

[0013] 2. Knockout of genes related to organic acid synthesis and bypass metabolism genes (knockout) cpr or kah Based on this, further optimize the glucose transport and utilization system (knockout). ugt11 or ugt13 overexpression ugt12 ugt15 or ugt17 This improved carbon source utilization and further increased the yield of steviol glycosides.

[0014] 3. This invention utilizes site-directed mutagenesis to mutate wild-type mevalonate kinase, obtaining the Q160L mutant, which is then applied to the production of steviol glycosides. Experiments showed that strains expressing the Q160L mutant, compared to strains expressing wild-type mevalonate kinase, exhibited a 51.8% increase in Reb M yield from 165.54±1.79 mg / L to 251.22±0.77 mg / L, or an 82.6% increase from 101.33 mg / L to 185.01 mg / L. This demonstrates that the Q160L mutant exhibits significant advantages in catalytic efficiency for the industrial production of steviol glycosides. Applying the Q160L mutant to the industrial production of steviol glycosides is beneficial for improving reaction conversion and yield, and reducing costs for industrial production. Detailed implementation method: The present invention will now be described through specific embodiments. All technical means not specifically described herein are methods well-known to those skilled in the art. Furthermore, the embodiments should be understood as illustrative, not limiting the scope of the invention; the essence and scope of the invention are defined only by the claims. For those skilled in the art, various changes or modifications to the material composition and dosage in these embodiments without departing from the essence and scope of the invention also fall within the protection scope of the present invention.

[0016] The following identifiers are used in this invention and its embodiments: The “P-series” plasmids are for the production of Reb glycosides, namely: plasmid P01 for the production of Reb A; plasmid P03 for the production of Reb D; plasmid P04 for the production of Reb I; and plasmid P05 for the production of Reb M. The “C series” strains, namely the strains numbered C001-C087, are chassis bacteria; The “M series” strains, namely the strains numbered M001-M092, are Reb M production strains, which are obtained by introducing the production plasmid P05 into “C series” chassis bacteria or other common chassis bacteria. The “A series” strains, namely the strains numbered A001-A010, are Reb A production strains, which are obtained by introducing the production plasmid P01 into “C series” chassis bacteria or other common chassis bacteria. The “D series” strains, namely the strains numbered D001-D010, are Reb D production strains, which are obtained by introducing the production plasmid P03 into “C series” chassis bacteria or other common chassis bacteria. The “I series” strains, namely the strains numbered I001-I010, are Reb I production strains, obtained by introducing the production plasmid P04 into “C series” substrate bacteria or other common substrate bacteria.

[0017] This invention and its embodiments relate to multiple modifications and editing of *Bacillus subtilis*, specifically involving the knockout and / or overexpression of multiple genes. For each individual gene knockout or overexpression, this invention provides corresponding knockout methods and primers, or overexpression methods and primers. When multiple gene modifications and editing are involved, the editing of individual genes can be continuously stacked and combined. The gene editing methods provided in this invention are merely exemplary and not intended to limit the invention. Those skilled in the art can also use any other method capable of achieving gene knockout or expression for the target gene, as long as it can achieve the editing of the target gene.

[0018] The present invention will be further explained and described below through specific embodiments.

[0019] Example 1 Construction of a plasmid for the heterologous synthesis pathway of steviol glycosides (RebM) (1) Target plasmid P05: pET21a-IDI-GGPPs-CPS-KS-KO-CPR-KAH-UGT11-UGT13-UGT12-UGT15-UGT17.

[0020] By expressing the pET21a vector containing E. coli , E. coli , E. coli , E. coli , E. coli , E. coli , ​ , ​ , ​ , ​ , ​ , ​ The recombinant plasmid of the gene was used to construct the basic pathway for heterologous synthesis of Reb M (rebaudioside M) using glucose or glycerol as substrates, and the production plasmid P05, which can synthesize Reb M, was obtained.

[0021] (2) Construction method of plasmid P05 S1. Based on the relevant sequence information disclosed by NCBI in Table 1, synthesize the encoding genes of the relevant enzymes in step (1).

[0022] Table 1. Information on enzymes and encoding genes involved in the construction of plasmids P01, P02-P05.

[0023] Construction of S2.pET21a-IDI and pET28a-GGPPs First, the original IDI sequence of the corresponding gene was found on NCBI using NCBI accession number WP208476097.1 and submitted to a gene synthesis company. A SpeI restriction site was introduced after the TAA stop codon in the optimized IDI gene. Primers were designed for amplification, and then the sequence was cloned into the NdeI / HindIII site of plasmid pET21a and transformed. ​ DH5α competent cells were plated on Kan resistance plates and cultured overnight at 37°C. Positive clones were screened using universal primers T7 / T7-TER, inoculated, and plasmids were extracted to obtain pET21a-IDI. Secondly, the original sequence of the corresponding gene GGPPs was found on NCBI using GenBank: AFD32422.1 and submitted to a gene synthesis company. A SpeI restriction site was introduced after the stop codon of the optimized GGPPs coding gene. Primers were designed for amplification, and the sequences were then cloned into the NcoI / HindIII sites of plasmid pET28a and transformed.​ DH5α competent cells were plated on Kan resistance plates and cultured overnight at 37°C. Positive clones were screened using universal primers T7 / T7-TER, inoculated, and plasmids were extracted to obtain pET28a-GGPPs. All plasmids were constructed using gene synthesis provided by General Biotech (Anhui) Co., Ltd.

[0024] S3. Plasmids pET21a-IDI and pET28a-GGPPs were double-digested with SpeI / HindIII and XbaI / HindIII restriction endonucleases, respectively. The pET21a-IDI vector and the GGPPs encoding gene fragment were then recovered using a DNA recovery kit purchased from Tiangen Biotech. Finally, the pET21a-IDI vector and the GGPPs encoding gene fragment were ligated using T4 DNA ligase and transformed. ​ DH5α competent cells were plated on Amp-resistant plates and cultured overnight at 37°C. Positive clones were selected from colonies and picked into 5 mL of LB medium containing Amp. Sequencing was performed to verify the positive clones. The recombinant plasmid pET21a-IDI-GGPPs, which contained the IDI and GGPPs encoding genes and was correctly sequenced, was extracted and set aside for later use.

[0025] Then, the coding genes of CPS, KS, KO, CPR, KAH, UGT11, UGT13, UGT12, UGT15, UGT17, etc. were sequentially tandem using the same method to obtain the target plasmid P05 (shown in SEQ ID NO.5).

[0026] The tandem assembly of the genes from the heterologous synthetic pathways described above was performed using the method provided by the BioBrick® assembly kit purchased from New England Biolab.

[0027] (2) Construction of other production plasmids P01, P03, and P04 Plasmids P01, P03, and P04 were synthesized using the same method as in steps (1)-(2). Plasmid P01: pET21a-IDI-GGPPS-CPS-KS-KO-CPR-KAH-UGT11-UGT13-UGT12-UGT14; Plasmid P03: pET21a-IDI-GGPPS-CPS-KS-KO-CPR-KAH-UGT11-UGT13-UGT12-UGT14-UGT15; Plasmid P04: pET21a-IDI-GGPPS-CPS-KS-KO-CPR-KAH-UGT11-UGT13-UGT12-UGT16; The specific difference is that replacing UGT15-UGT17 in plasmid P05 with UGT14 yields plasmid P01; replacing UGT15-UGT17 in plasmid P05 with UGT14-UGT15 yields plasmid P03; and replacing UGT15-UGT17 in plasmid P05 with UGT16 yields plasmid P04.

[0028] (3) P05 plasmid heterologously synthesizes Reb M in the host Plasmid P05 was transferred into ​ After revival of BL21(DE3) chemocompetent cells, the cells were centrifuged and spread onto solid agar plates (100 mg / L ampicillin), and incubated overnight in an inverted incubator at 37°C. Positive clones were screened by colony PCR, and selected clones were cultured overnight in 5 mL of LB medium containing the corresponding antibiotic to obtain strain M001. This strain was stored at -80°C with 20% glycerol for later use.

[0029] I. Fermentation verification experimental method: The recombinant strain M001 obtained above was used as the fermentation strain. The glycerol-preserved strain M001 was streaked onto ampicillin-resistant (or other corresponding resistance) plates and incubated upside down at 37°C until single colonies grew. Using an inoculation loop, single colonies were picked in a sterile operating table and inoculated into seed culture medium. The culture was carried out at 37°C and 250 rpm for 12-14 hours until the early logarithmic growth phase.

[0030] The seed culture was transferred to 25 mL of fermentation medium at an inoculum rate of 1%, and cultured at 37°C and 250 rpm until the absorbance value of the fermentation broth reached OD. 600 At a growth rate of 0.6–0.8, induction was performed using 0.1 mol / L IPTG (IPTG was sterilized by filtration through a 0.22 μm sterile membrane, with an addition amount of 1‰). The culture was then carried out at 22°C and 250 rpm for 120 h. After culture, the absorbance of the fermentation broth was measured, diluted appropriately, and ultrasonically disrupted. Reb M in the fermentation broth was then extracted with anhydrous methanol. After centrifugation at 10,000 rpm for 10 min, the supernatant was filtered through a 0.22 μm organic filter membrane and analyzed by high-performance liquid chromatography (HPLC). Three parallel controls were set up. After 120 h of fermentation, the Reb M yield was 101.33 ± 0.74 mg / L.

[0031] II. Culture medium: The seed culture medium consists of: 10 g / L peptone, 5 g / L yeast extract, and 10 g / L sodium chloride, sterilized at 121°C for 20 min.

[0032] The fermentation medium consists of: 15.7 g / L dipotassium hydrogen phosphate trihydrate, 2 g / L potassium dihydrogen phosphate, 2 g / L ammonium sulfate, 1.8 g / L citric acid, 1.2 g / L magnesium sulfate heptahydrate, 10 g / L yeast extract, 20 mL / L glycerol, 5 mL / L trace element stock solution, pH adjusted to approximately 7.0, and sterilized at 121℃ for 20 min.

[0033] The trace element mother liquor consisted of: 0.5 mol hydrochloric acid, 10 g / L ferrous sulfate heptahydrate, 2 g / L calcium chloride, 2.2 g / L zinc sulfate heptahydrate, 0.5 g / L manganese sulfate tetrahydrate, 1 g / L copper sulfate pentahydrate, 0.1 g / L ammonium molybdate tetrahydrate, and 0.02 g / L sodium tetraborate decahydrate.

[0034] III. Reb M high performance liquid chromatography detection conditions: C 18 The chromatographic column (250 mm × 4.6 mm, 5 µm) was used. The mobile phase was 32% acetonitrile-68% phosphoric acid water (pH 3.0). The flow rate was 1.0 mL / min, the detection wavelength was 210 nm, the column temperature was 40℃, the time was 30 min, and the injection volume was 5 µL. The external standard method was used for quantification.

[0035] Strain growth detection: The absorbance (OD) value of the fermentation broth was measured using a UV-Vis spectrophotometer. 600 .

[0036] Example 2: Optimization of Chassis Microbiota via Enhanced MEP Pathway by ​ BL21 (DE3) serves as the host, overexpressing Arabidopsis transcription factors. AtWRKY18 Encoding gene (SEQ ID NO. 6), Arabidopsis transcription factor AtWRKY40 Encoding gene (SEQ ID NO.7), Arabidopsis transcription factor AtMYC2 The gene encoding 1-deoxy-D-xyulose-5-phosphate synthase (SEQ ID NO.8) dxs (SEQ ID NO.9) ） and the gene encoding 1-deoxy-D-xyulose-5-phosphate reductase dxr (SEQ ID NO.10) Introduces the MEP pathway.

[0037] by AtWRKY18 Taking the overexpression of the encoding gene (SEQ ID NO.6) as an example, the construction method is as follows: (1) Using a bacterial genome extraction kit to extract bacterial strains E. coli The BL21(DE3) genome was extracted, and the concentration was determined using a Nanodrop nucleic acid concentration analyzer. The samples were then stored at -20°C for later use.

[0038] (2) Choose hemN Genes are identified as expression sites using EcoCyc (https: / / www.ecocyc.org / ). hemN The sequence was predicted using the online website CRISPOR (http: / / crispor.tefor.net / ). hemN The gRNA sequence was selected based on its high efficiency and lack of off-target effects. Partially complementary forward and reverse primers containing the gRNA sequence were designed. hemN -gRNA-F and hemN pEcgRNA was obtained by PCR amplification using pEcgRNA-R (primers are shown in Table 2) as a template. hemN Linear vectors for pEcgRNA hemN After digesting the linear vector product with restriction endonuclease Dpn I for 1 h to remove the template, agarose gel electrophoresis was performed, and the target fragment band was recovered using a DNA recovery kit. The DNA was then eluted with ddH2O and transformed. E. coli DH5α competent cells were plated on Spe resistant plates and incubated overnight at 37°C. Positive clones were screened by colony PCR, and each positive clone was picked and placed in 5 mL of LB medium containing Spe resistant cells for sequencing verification. The plasmid pEcgRNA with the correct sequence was extracted. hemN spare.

[0039] (3) Use primers hemN -up-F / R and hemN -down-F / R amplification E. coli BL21 (DE3) genome hemN The sequences 600 bp upstream and downstream of the gene are used as homologous arm sequences. AtWRKY18 -up、 AtWRKY18 -down, while using primers AtWRKY18- Pt7-F / R exogenously synthesized gene sequences AtWRKY18 Amplification was performed (primers are shown in Table 2) to obtain Pt7- AtWRKY18 Finally, regarding the fragments AtWRKY18 -up、Pt7- AtWRKY18 as well as AtWRKY18 -down was used to perform fusion PCR to obtain the Donor fragment Pt7- AtWRKY18 -Donor, after recovery and sequencing verification, stored at -20℃ for future use.

[0040] (4) Transform the pEcCas9 plasmid into E. coli BL21 (DE3) competent cells were plated with kanamycin sulfate (Kan, 50 μg / L); positive clones from the Kan plates were picked and incubated in 10 mL LB medium (containing 50 μg / L Kan + 2 g / L L-araB) at 37°C for approximately 5–6 h until OD reached 1.0; then, 200 ng of the correct pEcgRNA was added. hemN and 400 ngPt7- AtWRKY18 -Donor DNA electrotransfer with pEcCas9 plasmid E. coli Cells (~ OD 1.0) were plated (50 μg / L Kan+Spe) and incubated overnight at 37°C.

[0041] (5) Pick single clones from plates that have been electroporated with pEcgRNA and donor DNA and place them in 300 μL of LB medium containing 50 μg / L Kan + 2 g / L rhamnose. Shake at 37℃ and 200 rpm until the logarithmic phase (about 5 h). Take 1-2 μL of bacterial culture for bacterial PCR. Streak the bacterial culture that has been verified by bacterial PCR on Kan plates and sequence the corresponding PCR products at the same time. (6) Select positive clones from the Kan plate and culture them in 300 μL of LB medium containing Kan, Kan+Spe, and 20 g / L sucrose, respectively, at 37°C and 200 rpm until the logarithmic phase (about 5 h); the bacteria that eliminate the pEcgRNA plasmid do not grow under Kan+Spe, and the corresponding strains that grow on Kan plate are preserved (the bacteria contain the Cas9 plasmid and 20% glycerol); sucrose is used to eliminate the Cas9 plasmid, and streaks are applied to sucrose plates (final concentration 20 g / L); single colonies from the sucrose plates are selected and cultured in 300 μL of LB medium containing Kan and empty plate, respectively, at 37°C and 200 rpm until the logarithmic phase (about 5 h); the bacteria that do not grow on Kan plate but grow on the empty plate of LB plate are the ones that have successfully overexpressed the plasmid. AtWRKY18 The strain that simultaneously eliminates pEcgRNA plasmid and pEcCas9 plasmid is designated C001 and stored at -80℃ for later use (20% glycerol).

[0042] (7) Continue to use the same method as above to process the samples sequentially. AtWRKY40 (Expression site: fre ), AtMYC2 (Expression site: ZapB ), dxs (in situ overexpression) and dxr (In situ overexpression) Gene overexpression is performed by simply replacing the primers corresponding to the target gene. In situ overexpression involves replacing the original promoter with the T7 promoter. Primers are detailed in Table 2. The final result is...E. coli BL21 (DE3) is simultaneously overexpressed in the host. AtWRKY18, AtWRKY40, AtMYC2 , dxs and dxr The chassis strain C006.

[0043] Table 2 Relevant Primer Sequences

[0044] Example 3: Obtaining the gene encoding the mevalonate kinase MvK mutant Q160L 1. Construction of the vector plasmid pRSFDuet-1-mvK containing the mvK encoding gene As shown in SEQ ID NO.2 mvK The stop codon TAA of the gene was followed by a SpeI restriction site, and then cloned into the NdeI / XhoI site of plasmid pRSFDuet-1 to obtain plasmid pRSFDuet-1- mvK .

[0045] 2. PCR amplification of gene mutants Based on molecular docking and computational analysis of protein-ligands, the Q160 L mutation of mevalonate kinase MvK was determined.

[0046] The constructed vector plasmid pRSFDuet-1- mvK Using DNA templates, mvk The mutant gene was cloned using primers (Mvk-Q160L-F / R), the PCR product was digested with DpnI for 1 hour, and sequenced for verification, yielding the correct mutant encoding gene. mvKmut (The gene encoding the gene is shown in SEQ ID NO.4).

[0047] Mutant primers: Mvk-Q160L-F: GCGGCTATCTGCGCATCGCGGATGAC Mvk-Q160L-R: GCGCAGATAGCCGCCGTAGGTCGCC 3. The following definitions are used in this invention: (1) Nomenclature of amino acids and DNA nucleic acid sequences The IUPAC nomenclature, a recognized system for naming amino acid residues, is used, employing single-letter or three-letter codes. DNA nucleic acid sequences are named using the IUPAC nomenclature.

[0048] (2) Identification of mevalonate kinase mutants The mutated amino acid in the MvK mutant is represented by "original amino acid + position + substituted amino acid". For example, Q160L indicates that the 160th amino acid is replaced by Leu from the wild type Gln, and the position number corresponds to the amino acid sequence number of the wild type MvK in SEQ ID NO.1.

[0049] In this invention, lowercase italics mvK Indicates the gene encoding wild-type mevalonate kinase MvK, in lowercase italics. mvKmut The encoding gene for the mutant Q160L is shown in Table 3 below.

[0050] Table 3. Information on mevalonate kinase mutants

[0051] Example 4: Enhanced Chassis Microbial Optimization of the MVA Pathway Using the enhanced MEP pathway strain C006 constructed in Example 2 as the starting strain, the strain was overexpressed... atoB, mvaS, mvaE, mvK / mvKmut, pmK, mvaD, idi Construct expression plasmids incorporating the MVA pathway (using Pt7 as the promoter), namely: Pt7- atoB-mvaS-mvaE-mvK-pmK-mvaD-idi, or Pt7- atoB-mvaS-mvaE-mvKmut-pmK-mvaD-idi .

[0052] Table 4. Information on enzymes and encoding genes involved in the construction of the MVA pathway.

[0053] Pt7- atoB-mvaS-mvaE-mvK-pmK-mvaD-idi, or Pt7- atoB-mvaS-mvaE-mvKmut-pmK- mvaD-idi The specific construction process is as described in Example 1, which describes the construction of plasmid P05.

[0054] To achieve stable expression of heterologous genes and reduce plasmid burden, primers T7-MVA-F / R were used to express plasmid Pt7- atoB-mvaS-mvaE-mvK-pmK-mvaD-idi, or Pt7- atoB-mvaS-mvaE-mvK mut -pmK-mvaD-idi The heterologous MVA pathway gene carried was amplified by PCR to obtain the fragment Pt7- atoB-mvaS-mvaE-mvK-pmK-mvaD-idi (from SEQ ID NO.11) mvKmut Replace with the one shown in SEQ ID NO.2 mvK ) ， or Pt7- atoB-mvaS-mvaE-mvKmut- pmK-mvaD-idi (SEQ ID NO.11), respectively, according to Table 5, in strain C006 or E. coli BL21 (DE3) genomic insertion site cybCOverexpression was performed (the overexpression method is described in Example 2). AtWRKY18 (through overexpression), strains C007, C008, C00A, and C00A-1 were finally obtained. The strain information is shown in Table 5.

[0055] Table 5

[0056] Example 5: Construction of a fully synthesized Reb M strain 1. Using the same method as strain M001, plasmid P05 was transformed into competent cells of the C007, C008, C00A, and C00A-1 chassis strains constructed in Example 4, respectively. Using ampicillin and kanamycin-resistant plates, production strains M014, M015, M016, and M016-1 were obtained.

[0057] 2. Reb M production validation experiment: The specific method of the fermentation verification experiment is the same as the method of producing Reb M by strain M001 in step (3)-S3 of Example 1. The results are shown in Table 6 below.

[0058] Table 6 Results of Reb M Production Validation Experiments

[0059] As can be seen from Table 6: The difference between strains M014 and M015 lies in the fact that they express different... mvK or mvKmut The Reb M yields reached 165.54 mg / L and 251.22 mg / L, respectively. This demonstrates that the Q160L mutant constructed for MvK in this invention had a highly significant impact on Reb M production, increasing the yield by 51.76%.

[0060] The host of competent cells of strains M016 and M016-1 is... E. coli BL21 (DE3), the difference lies in expressing respectively mvKmut or mvK The Reb M yields reached 185.01 and 123.21, respectively. Combined with the Reb M yield of 101.33 when using M001 as the production strain in Example 1, it can be seen that: on the one hand, this further proves that the Q160L mutant constructed for MvK in this invention has a significant impact on Reb M production; on the other hand, it can prove that even when... mvK or mvKmut This single technical feature was directly transferred without any prior modifications. E. coliIn BL21(DE3), the Reb M yield can also be increased from 101.33 mg / L at M001 to 185.01 mg / L, representing an increase of 82.6%. mvKmut The synergistic effect is characterized by not depending on specific pre-modification chassis.

[0061] Example 5-1 Construction and production of fully synthesized Reb D, Reb I, and Reb A strains 1. Using the same construction method as strain M001, plasmid P03 was transformed into... E. coli In competent cells of BL21(DE3), C006 constructed in Example 2, C008 constructed in Example 4, and C007 chassis strains, Reb D producing strains D001, D002, D003, and D003-1 were obtained using ampicillin and kanamycin resistant plates.

[0062] Using the same construction method as strain M001, plasmid P04 was transformed into... E. coli In competent cells of BL21(DE3), C006 constructed in Example 2, C008 constructed in Example 4, and C007 chassis strains, Reb I producing strains I001, I002, I003, and I003-1 were obtained using ampicillin and kanamycin resistant plates.

[0063] Using the same construction method as strain M001, plasmid P01 was transformed into... E. coli In competent cells of BL21(DE3), C006 constructed in Example 2, C008 constructed in Example 4, and C007 chassis strains, Reb A producing strains A001, A002, A003, and A003-1 were obtained using ampicillin and kanamycin resistant plates.

[0064] 2. Production validation experiments for Reb D, Reb I, and Reb A: The specific method of the fermentation verification experiment is the same as the method of producing Reb M by strain M001 in step (3)-S3 of Example 1. The results are shown in Table 7 below.

[0065] Table 7. Production validation test results for Reb D, Reb I, and Reb A

[0066] As can be seen from Table 7: The D002 production strain uses the enhanced MEP pathway-modified chassis bacteria C006 as competent cells, compared to the unmodified strain... E. coliBL21 is the production strain D001 of competent cells, which increased the yield by 40.24%, indicating that the modification of the chassis bacteria in the MEP pathway can effectively promote the synthesis of Reb D.

[0067] The difference between D003 and D003-1 production strains lies in the fact that they respectively express... mvKmut or mvK The Reb D yields reached 173.34 mg / L and 136.22 mg / L, respectively. This shows that compared to the original production strain D001, which was unmodified and only expressed the P03 plasmid, the yields increased by 99.84% and 57.04%, respectively. It can be seen that the Q160L mutant constructed for MvK in this invention has a more significant impact on Reb M production.

[0068] The experimental results for Reb I and Reb A also showed similar trends. Taking Reb I as an example, the production strain I002 showed a significant increase in yield compared to the original production strain I001 (from 69.82 mg / L to 106.99 mg / L, an increase of approximately 53.24%); the comparison between production strain I003-1 and I003 also demonstrated the positive effect of the MvK mutant on yield. For Reb A, the production strain A003 showed a significant increase in yield compared to A001's 104.73 mg / L, reaching 208.60 mg / L (an increase of approximately 99.17%). The yield difference between A003-1 and A003 (152.83 mg / L and 208.60 mg / L, respectively) also indicates that the MvK mutant can further promote yield improvement in Reb A production. This fully demonstrates that chassis modification and enzyme modification targeting MvK do not only suggest improvements in the yield of a single Reb M, but also have universal applicability in improving the yield of a series of rebaudioside compounds such as Reb D, Reb I, and Reb A.

[0069] Based on the experimental results of Reb D, Reb I, and Reb A, this invention, through the modification of sclerotium bacteria (such as C006 and C007) and the key enzyme (MvK mutant MvKmut), not only significantly improves the yield of Reb D, but also effectively improves the yield of other rebaudioside compounds such as Reb I and Reb A. Furthermore, the MvK mutant exhibits superior promoting effects compared to the unmutated MvK in the production of multiple target products.

[0070] Example 6: Modification of pathways to improve carbon source utilization (knockout of organic acid synthesis and bypass metabolic pathways) 1. Chassis microbial modification Based on the chassis strain C008 obtained from previous modifications, further steps were taken to knock out genes related to organic acid synthesis and bypass metabolism (knockout). mgsA, iclR, menA, and / or adhE (See Table 8 for gene and sequence information) Improve carbon source utilization.

[0071] To knock out strain C008 mgsA Taking genes as an example, the specific method is as follows: (1) Using a bacterial genome extraction kit to extract bacterial strains E. coli The BL21(DE3) genome was extracted, and the concentration was determined using a Nanodrop nucleic acid concentration analyzer. The samples were then stored at -20°C for later use.

[0072] (2) Use EcoCyc (https: / / www.ecocyc.org / ) to find genes mgsA The sequence was predicted using the online website CRISPOR (http: / / crispor.tefor.net / ). mgsA The gRNA sequence was selected based on its high efficiency and lack of off-target effects. Partially complementary forward and reverse primers containing the gRNA sequence were designed. mgsA -gRNA-F and mgsA pEcgRNA was obtained by PCR amplification using pEcgRNA-R (primers are shown in Table 10) as a template. mgsA Linear vectors for pEcgRNA mgsA After digesting the linear vector product with restriction endonuclease Dpn I for 1 h to remove the template, agarose gel electrophoresis was performed, and the target fragment band was recovered using a DNA recovery kit. The DNA was then eluted with ddH2O and transformed. E. coli DH5α competent cells were plated on Spe resistant plates and cultured overnight at 37°C. Positive clones were screened by colony PCR, and each positive clone was picked and placed in 5 mL of LB medium containing Spe resistant cells for sequencing verification. The plasmid pEcgRNA- with correct sequencing (correct gRNA sequence) was extracted. mgsA spare.

[0073] (3) Use primers mgsA -up-F / R and mgsA -down-F / R amplification E. coli BL21 (DE3) genome mgsA The sequences 500 bp upstream and downstream of the gene are used as homologous arm sequences. mgsA -up、 mgsA -down, then... mgsA -up、 mgsA -down performs fusion PCR to obtain the Donor fragment. mgsA-Donor, after recovery and sequencing verification, stored at -20℃ for future use.

[0074] 200 ng of the correct pEcgRNA- mgsA plasmid and 400 ng mgsA Donor DNA was electroporated into C008 competent cells carrying the pEcCas9 plasmid, plated (50 μg / L Kan+Spe), and incubated overnight at 37°C.

[0075] (4) Pick single clones from the plates that have been electroporated with pEcgRNA and donor DNA and put them into 300 μL of LB medium containing 50 μg / L Kan + 2 g / L rhamnose. Shake at 37℃ and 200 rpm until the logarithmic phase (about 5 h). Take 1~2 μL of bacterial culture for bacterial PCR. Streak the bacterial culture that has been verified to be correct by PCR (and the donor DNA has been sequenced correctly) on Kan plates. At the same time, sequence the corresponding PCR products for verification.

[0076] (5) Positive clones from the Kan plate were picked and cultured in 300 μL of LB medium containing Kan, Kan+Spe and 20 g / L sucrose at 37°C and 200 rpm until the logarithmic phase (about 5 h); the bacteria that eliminated the pEcgRNA plasmid did not grow under Kan+Spe, and the corresponding Kan-growing strains were preserved (the bacteria contained the Cas9 plasmid and 20% glycerol); the sucrose bacteria were used to eliminate the Cas9 plasmid and were streaked on sucrose plates (final concentration 20 g / L); single colonies from the sucrose plates were picked and cultured in 300 μL of LB medium containing Kan and empty plates at 37°C and 200 rpm until the logarithmic phase (about 5 h); the bacteria that did not grow on Kan but grew on the empty plates of LB were the gene-edited bacteria, and the final strain C009 (based on C008 with the Cas9 plasmid knocked out) was obtained. mgsA (The chassis bacteria of the gene).

[0077] Continue using the same method as described above. iclR, menA , adhE Genes were knocked out individually or in combination (primers involved in gene knockout are shown in Table 10) to obtain chassis strains C010-C016, as detailed in Table 9.

[0078] Table 8. Information on enzymes and encoding genes involved in the construction of this embodiment.

[0079] Table 9. Information on strain modification

[0080] Table 10 Relevant Primers and Sequences

[0081] 2. Construction of a fully synthesized Reb M strain Using the same method as strain M001, plasmid P05 was transformed into competent cells of the C009-C016 chassis strains, and the production strains M017-M024 were obtained by screening with ampicillin and kanamycin resistant plates.

[0082] 3. Reb M production validation experiment: The specific method of the fermentation verification experiment is the same as the method of producing Reb M by strain M001 in step (3)-S3 of Example 1. The results are shown in Table 11 below.

[0083] Table 11 Results of Reb M Production Validation Experiments

[0084] As can be seen from Table 11: The Reb M-producing strain M015, constructed based on the preceding chassis strain C008, produced 215.22 mg / L of Reb M. Further analysis using the chassis strain with knocked-out components... mgsA, iclR, menA The Reb M yields of the obtained production strains M017, M018, and M019 were only 213.27, 201.78, and 214.71 mg / L, respectively, all showing varying degrees of decline, indicating that... mgsA, iclR, menA While theoretically, knocking out Reb M could optimize precursor supply and redox balance, thus promoting Reb M synthesis, practical verification has shown that knocking out Reb M alone is detrimental to its accumulation. Meanwhile, on the chassis bacteria... mgsA, iclR Perform combined knockout, or... mgsA, menA The production strains M020 and M022 obtained after combined knockout had Reb M yields of only 204.79 and 218.30 mg / L, respectively, which were the same as or slightly lower than those of M015.

[0085] But for bacteria on the chassis iclR, menA The production strain M021 obtained after combined knockout showed a Reb M yield of 266.63 mg / L, compared to M015 and single knockout strains. mgsA, iclR Both M018 and M019 showed extremely significant improvements, indicating that iclR, menA Combination knockout achieved unexpected technical results.

[0086] Combined knockout on chassis bacteria iclR, menA On this basis, further knockout mgsA , mgsA + adhE The obtained production strains M023 and M024 also achieved Reb M yields of 265.7 and 270.35 mg / L, respectively, indicating that...mgsA, iclR, menA , adhE The combined knockout of these molecules can also help improve carbon source utilization and increase Reb M production.

[0087] Example 7: Modification of pathways to improve carbon source utilization (optimization of glucose utilization and transport pathways) 1. Chassis microbial modification Building upon the previously modified chassis strain C016, further optimization of the glucose transport and utilization system (knockout) was achieved. ppc, fnr, fadR, zwf, and / or pgi overexpression ACS, fbaA, tpiA, glf, galP and / or ptsG (See Table 12 for gene and sequence information) to improve carbon source utilization.

[0088] The gene knockout method is described in Example 6, and the gene overexpression method is described in Example 2, only requiring the replacement of the corresponding primers (primers are listed in Table 14). The expression sites involved in the overexpression are: ACS (Expression site: in situ) , fbaA (Expression site: in situ) , tpiA (Expression site: in situ) , glf (Expression site: yijE ) , galP (Expression site: in situ) ptsG (Expression site: in situ), where in situ overexpression means replacing the original promoter with the T7 promoter.

[0089] Using the same method described above, the above genes were modified individually or in combination to obtain chassis strains C017-C036, as detailed in Table 13.

[0090] Table 12. Information on enzymes and encoding genes involved in the construction of this embodiment.

[0091] Table 13 Information on strain modification

[0092] Table 14 Relevant Primers and Sequences

[0093] 2. Construction of a fully synthesized Reb M strain Using the same method as for the production strain M001, plasmid P05 was transformed into competent cells of strains C017-C036 in the basal plate bacteria, and the production strains M025-M044 were obtained by screening with ampicillin and kanamycin resistant plates.

[0094] 3. Reb M production validation experiment: The specific method of the fermentation verification experiment is the same as that of strain M001 producing Reb M in step (3)-S3 of Example 1. The results are shown in Table 15 below.

[0095] Table 15 Results of Reb M Production Validation Experiments

[0096] As can be seen from Table 15: The Reb M-producing strain M024, constructed based on the preceding chassis strain C016, produced 270.3 mg / L of Reb M. Further analysis using this chassis strain, including the knockout of... ppc、fnr、fadR、zwf , pgi The Reb M yields of the obtained production strains M025-M029 ranged from 276 to 283 mg / L, an increase of 2.1% to 4.6% compared to M024, indicating that knocking out the strain alone was effective. ppc、 fnr、fadR、zwf , pgi The gene has no significant effect on Reb M production.

[0097] Combination knockout ppc、fnr、fadR The obtained production strain M030 showed a Reb M yield of 313.80 mg / L, a 16% increase compared to M024, demonstrating significant efficacy. Further enhancement by knockout... zwf , zwf+pgi The Reb M yields of the subsequently obtained production strains M031 and M032 were 333.75 mg / L and 354.78 mg / L, respectively, representing increases of 23.5% and 31.3% compared to M024. This indicates that, compared to single knockout strains, ppc、fnr、fadR Combinatorial knockout, and based on that ppc、fnr、fadR、zwf Combination knockout ， ppc、fnr、fadR、zwf , pgi The combined knockout methods achieved unexpected technical results.

[0098] Therefore, in ppc、fnr、fadR Based on the combined knockout, further treatment of the bacteria on the chassis ACS、fbaA、tpiA、 glf、galP and ptsG Overexpression of one gene resulted in Reb M production of 407-445 mg / L in the production strain M033-M038, compared to the combined knockout strain in the chassis bacteria. ppc、fnr、fadR The Reb M yield of the obtained production strain M030 was 313.80 mg / L, showing a significant increase, especially in the case of the knockout strain on the chassis. ppc、fnr、fadR overexpression tpiAThe Reb M yield of the obtained production strain M035 was 444.82 mg / L, which was 41.75% higher than that of M030, demonstrating a highly significant effect. ppc、 fnr、fadR Further treatment of the chassis bacteria on top of the combined knockout ACS、fbaA、tpiA、glf、galP and ptsG Production strain M039 (overexpressing multiple genes) was obtained by combining and overexpressing them. ACS、fbaA、tpiA M040 (overexpression) ACS、 tpiA、galP The Reb M yields reached 511.26 and 515.06 mg / L, respectively.

[0099] Therefore, in ppc、fnr、fadR、zwf Further on the basis of combined knockout ACS、fbaA、tpiA、glf、galP and ptsG Production strain M041 (overexpressing multiple genes) was obtained by combining and overexpressing them. ACS、tpiA、galP M042 (overexpression) ACS、tpiA、galP、ptsG Reb M yields reached 521.48 mg / L and 564.59 mg / L, respectively, compared to... ppc、fnr、 fadR、zwf The combined knockout of M031 resulted in a 56.24% and 69.17% increase in Reb M production, respectively, which was extremely significant.

[0100] Therefore, in ppc、fnr、fadR、zwf、pgi Further on the basis of combined knockout ACS、fbaA、tpiA、glf、 galP and ptsG Production strain M043 (overexpressing multiple genes) was obtained by combining and overexpressing them. ACS、tpiA、galP、 ptsG M044 (overexpression) ACS、fbaA、tpiA、glf、galP、ptsG Reb M yields reached 597.18 mg / L and 604.78 mg / L, respectively, compared to... ppc、fnr、fadR、zwf、pgi The combined knockout of M032 resulted in a 68.32% and 70.4% increase in Reb M yield, respectively, which was extremely significant.

[0101] Example 7-1 Construction and production of fully synthesized Reb D, Reb I, and Reb A strains 1. Using the same method as strain M001, plasmid P03 was transformed into competent cells of the C016 chassis strain constructed in Example 6 and the C036 chassis strain constructed in Example 7, respectively. Using ampicillin and kanamycin resistant plates, Reb D producing strains D004 and D005 were obtained.

[0102] Using the same method as strain M001, plasmid P04 was transformed into competent cells of the C016 chassis strain constructed in Example 6 and the C036 chassis strain constructed in Example 7, respectively. Using plates containing ampicillin and kanamycin resistance, RebI producing strains I004 and I005 were obtained.

[0103] Using the same method as strain M001, plasmid P01 was transformed into competent cells of the C016 chassis strain constructed in Example 6 and the C036 chassis strain constructed in Example 7, respectively. Reb A producing strains A004 and A005 were obtained by using plates containing ampicillin and kanamycin resistance.

[0104] 2. Production validation experiments for Reb D, Reb I, and Reb A: The specific method of the fermentation verification experiment is the same as the method of producing Reb M by strain M001 in step (3)-S3 of Example 1. The results are shown in Table 16 below.

[0105] Table 16 Results of Production Validation Experiments for Reb D, Reb I, and Reb A

[0106] As can be seen from Table 16: C016 Chasmophyton is developed based on previous modifications by knocking out genes related to organic acid synthesis and bypass metabolism (knockout). mgsA、iclR、menA、 and adhe Improving carbon source utilization will increase the yield of Reb D, Reb I, and Reb A compared to the previous method. E.coli BL21 (DE3) showed a significant improvement in the production of chassis cells. Specifically, the production strain D004 for Reb D achieved a yield of 209.93 mg / L, a 142.0% increase compared to D001; the production strain I004 for Reb I achieved a yield of 208.13 mg / L, a 198.1% increase compared to I001; and the production strain A004 for Reb A achieved a yield of 248.42 mg / L, a 137.2% increase compared to A001.

[0107] C036 chassis bacteria are developed based on the previously modified chassis strain C016, through optimization of the glucose transport and utilization system (knockout). ppc、fnr、fadR、zwf and pgi overexpression ACS、fbaA、tpiA、glf、galP and ptsGThe improved carbon source utilization further significantly boosted the yield of various rebaudioside compounds. The production strain D005 of Reb D achieved a yield of 507.84 mg / L, a 485.5% increase compared to D001; the production strain I005 of Reb I achieved a yield of 509.74 mg / L, a 629.0% increase compared to I001; and the production strain A005 of Reb A achieved a yield of 592.64 mg / L, a 465.9% increase compared to A001.

[0108] In summary, both C016 and C036 chamomile strains, after undergoing different genetic modification strategies to improve carbon source utilization, significantly promoted the synthesis of Reb D, Reb I, and Reb A, with a consistent pattern of improvement. The C016 chamomile strain increased the yield of these three compounds by 137%-198%, while the C036 chamomile strain showed a more pronounced effect, increasing the yield of all three rebaudioside compounds by nearly five times, far exceeding the improvement effect of the C016 chamomile strain. This not only demonstrates the advantage of optimizing glucose transport and utilization systems in increasing product yield but also indicates that genetic modification of chamomile strains related to carbon source utilization can be widely applied to the production of various rebaudioside compounds.

[0109] The above-described embodiments are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that those skilled in the art can make various modifications, combinations, and improvements to the above embodiments without departing from the concept of this patent, and these modifications and combinations all fall within the scope of protection of this patent. Therefore, the scope of protection of this patent should be determined by the claims.

Claims

1. A method for increasing the yield of steviol glycosides, characterized in that, The method involves encoding the glyoxylate bypass operon transcriptional repressor protein gene on the genome of a steviol glycoside-producing strain. iclR and the gene encoding 1,4-dihydroxy-2-naphthoic acid polyisopreneyltransferase menA Simultaneously, the implementation was removed.

2. An engineered strain that produces high levels of steviol glycosides, characterized in that, The engineered bacteria, using *Escherichia coli* as a host, express the steviol glycoside production pathway but lack the gene encoding the transcriptional repressor protein of the glyoxylate bypass operon in the genome. iclR and the gene encoding 1,4-dihydroxy-2-naphthoic acid polyisopreneyltransferase menA The expression.

3. The engineered strain of steviol glycosides with high yield as described in claim 2, characterized in that, The engineered bacteria also lack the gene encoding methylglyoxal synthase in its genome. mgsA, and / or bifunctional acetaldehyde-ethanol dehydrogenase adhE The expression.

4. The engineered strain of steviol glycosides with high yield as described in claim 3, characterized in that, The engineered bacteria also perform gene editing on any one or more of the following items (1)-(5): (1) Overexpression of Arabidopsis thaliana transcription factor encoding genes AtWRKY18 Arabidopsis thaliana transcription factor encoding genes AtWRKY40 Arabidopsis thaliana transcription factor encoding genes AtMYC2 At least one gene in it; (2) Overexpression of the gene encoding 1-deoxy-D-xyulose-5-phosphate synthase dxs 1-Deoxy-D-xyulose-5-phosphate reductase encoding gene dxr At least one gene in it; (3) Overexpression of the gene encoding acetyl-CoA acetyltransferase atoB、 3-Hydroxy-3-methylglutaryl-CoA synthase encoding gene mvaS, 3-Hydroxy-3-methylglutaryl-CoA reductase encoding gene mvaE, Mevalonate kinase mutant encoding gene mvKmut、 Mevalonate kinase-encoding gene pmK Mevalonate pyrophosphate decarboxylase encoding gene mvaD、 Isopentenyl pyrophosphate isomerase encoding gene idi At least one gene in it; (4) Knockout of the gene encoding phosphoenolpyruvate carboxylase PPC Fumarate / nitrate reduction transcription factor encoding genes fnr、 Fatty acid metabolism transcription factor encoding genes fadR、 glucose-6-phosphate dehydrogenase encoding gene zwf、 and / or genes encoding glucose-6-phosphate isomerase pgi At least one gene in it; (5) Overexpression of the gene encoding acetyl-CoA synthase ACS Type II fructose-bisphosphoaldolase encoding gene fbaA、 Triose phosphate isomerase encoding gene tpiA、 UDP-galactopyranotropic enzyme encoding gene glf, galactose transporter encoding gene galP and / or PTS glucose transporter encoding gene ptsG At least one gene in it.

5. The engineered strain of steviol glycosides with high yield as described in claim 4, characterized in that, The glyoxylate bypass operon transcriptional repressor protein has the NCBI accession number WP_001719279.1; the 1,4-dihydroxy-2-naphthoic acid polyisopreneyltransferase has the NCBI accession number WP_222903064.1; the methylglyoxal synthase has the NCBI accession number WP_230003621.1; and the bifunctional acetaldehyde-ethanol dehydrogenase has the NCBI accession number WP_194153327.

1. The AtWRKY18 The nucleotide sequence of the gene is shown in SEQ ID NO. 6; AtWRKY40 The nucleotide sequence of the gene is shown in SEQ ID NO.7; AtMYC2 The nucleotide sequence of the gene is shown in SEQ ID NO. 8; dxs The nucleotide sequence of the gene is shown in SEQ ID NO. 9; dxr The nucleotide sequence of the gene is shown in SEQ ID NO.10; Includes Pt7, atoB, mvaS, mvaE, mvKmut, pmK, mvaD and idi Fragment Pt7- atoB-mvaS-mvaE- mvKmut-pmK-mvaD-idi The nucleotide sequence is shown in SEQ ID NO.11; The phosphoenolpyruvate carboxylase, NCBI accession number: WP_054623263.1; the fumarate / nitrate reduction transcription regulator, NCBI accession number: WP_137553443.1; the fatty acid metabolism transcription factor, GenBank: QTY01543.1; the glucose-6-phosphate dehydrogenase, NCBI accession number: WP_272457244.1; the glucose-6-phosphate isomerase, NCBI accession number: WP_112027816.1; The acetyl-CoA synthase, NCBI accession number: WP_257188176.1; the class II fructose-bisphosphate aldolase, NCBI accession number: WP_137512762.1; the triose phosphate isomerase, NCBI accession number: WP_096149043.1; the UDP-galactopyranotropic isomerase, NCBI accession number: WP_089529626.1; the galactose transporter, NCBI accession number: WP_063101090.1; the PTS glucose transporter, NCBI accession number: WP_404597817.

1.

6. The engineered strain of steviol glycosides as described in claim 2, characterized in that, The steviol glycoside production pathways include, but are not limited to: rebaudioside A, rebaudioside D, rebaudioside M, or rebaudioside I production pathways.

7. The engineered strain of steviol glycosides as described in claim 6, characterized in that, The production route of the rebaudioside M is by expressing a substance containing [the substance] on the pET21a vector. idi , ggpps , cps , ks , ko , CPR , kah , ugt11 , ugt13 , ugt12 , ugt15 , ugt17 The P05 plasmid obtained from the gene is: pET21a-IDI-GGPPs-CPS-KS-KO-CPR-KAH-UGT11-UGT13-UGT12-UGT15-UGT17; the nucleotide sequence of the P05 plasmid is shown in SEQ ID NO.5; The described rebaudioside A production pathway involves replacing the UGT15 and UGT17 genes in plasmid P05 with the coding genes for UGT14 to obtain plasmid P01: pET21a-IDI-GGPPS-CPS-KS-KO-CPR-KAH-UGT11-UGT13-UGT12-UGT14; the GenBank database for UGT14 is ACT33422.

1. The described rebaudioside D production pathway involves replacing UGT15 and UGT17 in plasmid P05 with the encoding genes of UGT14 and UGT15 to obtain plasmid P03: pET21a-IDI-GGPPS-CPS-KS-KO-CPR-KAH-UGT11-UGT13-UGT12-UGT14-UGT15; the GenBank accession number for UGT14 is ACT33422.1; the NCBI accession number for UGT15 is XP_015629141.

1. The described rebaudioside I production pathway involves replacing the UGT15 and UGT17 in plasmid P05 with the coding gene for UGT16 to obtain plasmid P04: pET21a-IDI-GGPPS-CPS-KS-KO-CPR-KAH-UGT11-UGT13-UGT12-UGT16: the coding gene for UGT16 is shown in SEQ ID NO.

13.

8. The engineered strain of steviol glycosides with high yield as described in claim 2, characterized in that, The host is *Escherichia coli*, which includes, but is not limited to: E. coli BL21 (DE3), Rosetta (DE3), JM109 (DE3), MG1655 (DE3), C43 (DE3), ArcticExpress (DE3) or W3110 (DE3).

9. The engineered strain of steviol glycosides as described in claim 2, characterized in that, The engineered bacteria, using Escherichia coli as a host, express the steviol glycoside production pathway while simultaneously undergoing the following gene editing: (1) Deletion of genes encoding transcriptional repressor proteins of the glyoxylate bypass operon in the genome iclR 1,4-Dihydroxy-2-naphthoic acid polyisopreneyltransferase encoding gene menA Methylglyoxal synthase encoding gene mgsA, and bifunctional acetaldehyde-ethanol dehydrogenase adhE The expression; (2) Knockout of the gene encoding phosphoenolpyruvate carboxylase PPC Fumarate / nitrate reduction transcription factor encoding genes fnr、 Fatty acid metabolism transcription factor encoding genes fadR、 glucose-6-phosphate dehydrogenase encoding gene zwf、 and the gene encoding glucose-6-phosphate isomerase pgi; (3) Overexpression of the gene encoding acetyl-CoA synthase ACS Type II fructose-bisphosphoaldolase encoding gene fbaA、 Triose phosphate isomerase encoding gene tpiA、 UDP-galactopyranotropic enzyme encoding gene glf, galactose transporter encoding gene galP and the PTS glucose transporter encoding gene ptsG ; (4) Overexpression of Arabidopsis thaliana transcription factor encoding genes AtWRKY18 Arabidopsis thaliana transcription factor encoding genes AtWRKY40 Arabidopsis thaliana transcription factor encoding genes AtMYC2 1-Deoxy-D-xyulose-5-phosphate synthase encoding gene dxs 1-Deoxy-D-xyulose-5-phosphate reductase encoding gene dxr ; (5) Expressions containing Pt7, atoB, mvaS, mvaE, mvKmut, pmK, mvaD and idi Fragment Pt7- atoB-mvaS- mvaE-mvKmut-pmK-mvaD-idi The nucleotide sequence is shown in SEQ ID NO.11; (6) The specific production pathway of the steviol glycosides is as follows: Reb A produces plasmid P01, Reb D produces plasmid P03, Reb M produces plasmid P05, or Reb I produces plasmid P01.

10. The use of the engineered bacteria according to any one of claims 1-9 in the total fermentation production of steviol glycosides.

Images