Pseudomonas putida high-yield rhamnolipid fermentation medium based on step-by-step optimization strategy, optimization method and application thereof

By constructing a fermentation system with mixed carbon and nitrogen sources and recombinant strains, the problems of unreasonable culture medium formulation and limited metabolic capacity of strains were solved, achieving efficient production of rhamnolipin and meeting industrial needs.

CN121592741APending Publication Date: 2026-03-03ZHEJIANG UNIV OF TECH

Patent Information

Application Number
CN202511991265.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-26
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

In existing technologies, the culture medium formulation is unreasonable and the selection of carbon and nitrogen sources lacks systematicity, resulting in insufficient supply of rhamnolipid synthesis precursors, low extracellular transport efficiency, poor fermentation scale-up effect, and difficulty in achieving industrial production.

Method used

A fermentation system with mixed carbon and nitrogen sources as its core was developed. Through a stepwise optimization strategy, including component screening, single-factor concentration optimization, and multi-factor interaction optimization, combined with molecular biology methods, recombinant strains were constructed to enhance the supply and extracellular transport efficiency of rhamnolipid synthesis precursors.

Benefits of technology

It significantly improved the production capacity of rhamnolipin, with a marked increase in the yield of shake flasks and 5L fermenters, reaching the highest level reported to date, and providing a reliable technical solution for industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121592741A_ABST
    Figure CN121592741A_ABST
Patent Text Reader

Abstract

The invention discloses a Pseudomonas putida high-yield rhamnolipid fermentation medium based on a step-by-step optimization strategy, an optimization method and application thereof, through the step-by-step strategy of component screening-single-factor optimization-multi-factor interactive optimization, a mixed carbon source and a mixed nitrogen source are taken as cores, and a Plackett-Burman test, a steepest climbing test and Box-Behnken response surface design are combined, so that the high-yield rhamnolipid fermentation medium for the pseudomonas putida high-yield rhamnolipid is obtained. Optimizing to obtain a special fermentation culture medium; two genetic engineering strains estA-2 and estA-3 are constructed by heterologous expression of key genes, and the supply and extracellular transport efficiency of a rhamnolipid synthesis precursor is enhanced; the recombinant strain is applied to the optimized culture medium, and efficient production of a shake flask and a 5L fermentation tank is achieved. The rhamnolipid yield of the estA-3 strain in a 5L fermentation tank reaches 35.59 + / -2.18 g / L, the conversion rate is 0.282 g / g, the productivity is 0.404 g / L / h, the rhamnolipid yield, the conversion rate and the productivity are obviously superior to those in the prior art, and a key technical support is provided for industrial production of rhamnolipid.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bio-fermentation technology, specifically relating to a high-yield rhamnolipid fermentation medium for Pseudomonas putida based on a stepwise optimization strategy, the optimization method, and its application. Background Technology

[0002] Rhamnose lipids are a type of glycolipid biosurfactant with the longest research history and the most mature application technology. Their structure consists of an amphipathic molecule composed of one or two rhamnose molecules and one or two fatty acid chains. They have many advantages such as being non-toxic, environmentally friendly, biodegradable, and biocompatible, and are widely used in environmental remediation, agriculture, medicine, cosmetics and other fields.

[0003] Pseudomonas aeruginosa has the ability to synthesize high concentrations of rhamnolipids, but it is an opportunistic pathogen with poor biosafety, which limits its large-scale industrial production. Pseudomonas putida, on the other hand, not only has high metabolic diversity and environmental adaptability, but also has been widely used in the field of industrial biotechnology due to its non-pathogenicity, making it a superior substrate bacterium for the synthesis of rhamnolipids.

[0004] The existing technology has the following shortcomings: First, the culture medium formulation is unreasonable, the selection of carbon and nitrogen sources lacks systematicity, and single carbon or nitrogen sources are often used, failing to fully utilize the synergistic effect of mixed carbon and nitrogen sources, and the concentration optimization of each component is not precise; Second, the metabolic capacity of the strains is limited, the supply of rhamnolipid synthesis precursors is insufficient, the extracellular transport efficiency is low, and there is a lack of targeted molecular modification strategies; Third, the fermentation scale-up effect is poor, the optimization results of shake flasks are difficult to effectively translate into fermenter production, and the yield and production efficiency need to be improved.

[0005] Therefore, developing specialized and efficient fermentation media, constructing high-yield genetically engineered strains, and achieving large-scale production are key to the industrial application of rhamnolipin. Summary of the Invention

[0006] To address the aforementioned problems, this invention provides a high-yield rhamnolipin fermentation medium, optimization method, and application of *Pseudomonas putida* based on a stepwise optimization strategy. On one hand, it innovatively uses a mixed carbon and nitrogen source as the core fermentation system, relying on a systematic stepwise strategy of "component screening - single-factor concentration optimization - multi-factor interactive optimization" to precisely optimize the fermentation medium. On the other hand, it uses molecular biology methods to construct two recombinant strains, estA-2 and estA-3, to enhance the supply and extracellular transport efficiency of rhamnolipin synthesis precursors. Finally, the recombinant strains are applied to the optimized medium, achieving high-efficiency production in shake flasks and 5L fermenters. This invention, through the synergistic effect of medium optimization and strain molecular modification, significantly improves the rhamnolipin production capacity of *Pseudomonas putida*, and has been validated in a 5L fermenter, providing an efficient and reliable technical solution for the industrial production of rhamnolipin, and has significant industrial application value.

[0007] To solve the above problems, the technical solution adopted in this application is:

[0008] The first objective of this invention is to provide an optimization method for a high-yield rhamnolipid fermentation medium of *Pseudomonas putida* based on a stepwise optimization strategy, comprising the following steps:

[0009] Step 1, Initial screening of components: Using Pseudomonas putida rhlAB-Δflag as the starting strain, carbon source, nitrogen source, phosphate and metal ion were screened through single-factor experiments to determine the essential auxiliary components.

[0010] Step 2, Plackett-Burman experiment: Design a multi-factor orthogonal experiment to investigate the effects of each essential auxiliary component on rhamnolipid production, and screen out the significant influencing factors with P<0.05;

[0011] Step 3, Steepest Climbing Experiment: Determine the climbing direction and step size of each significant factor based on the regression coefficients of the Plackett-Burman experiment, and approximate the optimal response region through gradient concentration fermentation experiment to determine the center point concentration for response surface optimization.

[0012] Step 4: Box-Behnken response surface optimization: A four-factor, three-level response surface experiment was designed based on the center point concentration. A quadratic regression model was established with rhamnose lipid yield as the response value. After verifying the effectiveness of the model through analysis of variance, the optimal fermentation medium formulation was obtained.

[0013] Step 5: Model Validation: Prepare the fermentation medium according to the optimal formula and conduct shake-flask fermentation to verify the consistency between the rhamnose lipid yield and the model prediction and the stability of the formula.

[0014] As a preferred embodiment of this application, in step 1, the essential auxiliary components in the fermentation culture medium include at least a carbon source and a nitrogen source.

[0015] Carbon sources serve as the core energy source for microbial growth and metabolism, and the carbon skeleton basis for rhamnolipid synthesis. Glucose can rapidly provide energy to support cell proliferation in the early stages of fermentation, while glycerol is slowly metabolized to continuously provide a carbon source for fatty acid synthesis. The two work synergistically to form a mixed carbon source, achieving gradient utilization and avoiding metabolic imbalance caused by a single carbon source. Preferably, the carbon source is selected from one or two of glucose and glycerol, rapeseed oil, soybean oil, corn oil, olive oil, sunflower oil, methyl oleate, methyl palmitate, and dimethyl silicone oil. More preferably, the carbon source is a mixed carbon source composed of glucose and glycerol.

[0016] As a preferred embodiment of this application, the final concentration of the carbon source in the culture medium is 0–50 g / L.

[0017] Nitrogen source is a key element constituting the biomolecules of bacteria. Organic nitrogen source yeast powder is rich in amino acids and growth factors, which can activate metabolic enzyme systems, while inorganic nitrogen source sodium nitrate can quickly replenish nitrogen. The combination of the two ensures efficient bacterial growth and provides a sufficient nitrogen metabolic basis for rhamnolipid synthesis. As a preferred embodiment of this application, the nitrogen source is selected from one or two of urea, yeast powder and ammonium sulfate, ammonium chloride and sodium nitrate. More preferably, the nitrogen source is composed of yeast powder and sodium nitrate.

[0018] As a preferred embodiment of this application, the final concentration of the nitrogen source in the culture medium is 0–50 g / L.

[0019] As a preferred embodiment of this application, the essential auxiliary components in the fermentation medium also include at least one of potassium dihydrogen phosphate, disodium hydrogen phosphate, and a metal ion solution. Phosphates participate in energy metabolism and biofilm formation, maintaining metabolic balance and providing energy security. The Cu in the metal ion solution... 2+ Zn 2+ As cofactors or activators of metabolic enzymes, these substances can enhance the activity of key enzymes in the fatty acid synthesis pathway, promote the synthesis of β-hydroxy fatty acid precursors, and the synergistic optimization of carbon sources, nitrogen sources and other components creates a stable metabolic environment, thereby directionally increasing the metabolic flux of rhamnolipid synthesis and ultimately achieving a significant increase in product yield.

[0020] As a preferred embodiment of this application, the final concentration of potassium dihydrogen phosphate and disodium hydrogen phosphate in the culture medium is 0-5 g / L.

[0021] As a preferred embodiment of this application, the final concentration of the metal ion solution in the culture medium is 0 to 2 mL / L.

[0022] As a preferred embodiment of this application, the fermentation medium determined by single-factor experiments in step 1 is composed of the following substances in the following weight percentages: glucose 0-30 g / L, glycerol 0-50 g / L, yeast extract 0-50 g / L, sodium nitrate 0-20 g / L, potassium dihydrogen phosphate 0-5 g / L, disodium hydrogen phosphate 0-5 g / L, and metal ion solution 0-2 mL / L.

[0023] More preferably, the fermentation medium screened in step 1 is composed of the following weight percentages of substances: glucose 10 g / L, glycerol 10 g / L, yeast extract 30 g / L, sodium nitrate 16 g / L, potassium dihydrogen phosphate 2 g / L, and disodium hydrogen phosphate 4 g / L as the basal medium. The optimal concentration of each factor is explored by using the single-factor controlled variable method.

[0024] As a preferred embodiment of this application, in step 2, numerous factors are screened through PB experiments to examine the effects of glucose (A), glycerol (B), yeast powder (C), sodium nitrate (D), potassium dihydrogen phosphate (E), disodium hydrogen phosphate (F), and metal ion solution (G) on rhamnolipid production. The significant factors with P < 0.05 are screened through analysis of variance, which are the significant factors that have a significant impact on the optimization objective.

[0025] As a preferred embodiment of this application, in step 2, the significant influencing factors include glucose, glycerol, yeast powder, and sodium nitrate.

[0026] In the optimization method of this application, step 3 determines the climbing direction and step size, as well as the center point concentration for response surface optimization, through the steepest climbing experiment. For insignificant factors, components with positive effects are selected at high levels, while components with negative effects are selected at low levels. Changes in rhamnolipin production are tracked through shake-flask fermentation experiments.

[0027] As a preferred embodiment of this application, the fermentation medium screened in step 3 is composed of the following substances in the following weight percentages: glucose 5-19 g / L, glycerol 10-20 g / L, yeast powder 10-30 g / L, sodium nitrate 4-14 g / L, potassium dihydrogen phosphate 4 g / L, disodium hydrogen phosphate 1 g / L, and metal ion solution 2 mL / L.

[0028] In the optimization method of this application, step 4 further optimizes the addition amount of significant variables through response surface methodology (RSM). A "four-factor, three-level" scheme is adopted, and a response surface design with interactive effects is designed to fit the model regression equation. Glucose, glycerol, yeast extract, and sodium nitrate are selected as factors to be investigated, and the composition of the rhamnolipid fermentation medium is optimized through multi-objective methods to obtain the optimal combination.

[0029] As a preferred embodiment of this application, the optimal fermentation medium determined in step 4 is composed of the following substances in the following weight percentages: glucose 15.91 g / L, glycerol 13.56 g / L, yeast extract 18.83 g / L, sodium nitrate 8.44 g / L, potassium dihydrogen phosphate 4 g / L, disodium hydrogen phosphate 1 g / L, and metal ion solution 2 mL / L.

[0030] As a preferred embodiment of this application, the metal ion solution is prepared by the following weight percentages of substances: CuSO4·5H2O 10 g / L, ZnSO4·7H2O 10 g / L, MgSO4·7H2O 10 g / L, FeSO4·7H2O 10 g / L, MnSO4 10 g / L, and NiCl2·6H2O 0.25 g / L.

[0031] A second objective of this invention is to provide a fermentation medium selected by the aforementioned optimization method.

[0032] A third objective of this invention is to provide a fermentation medium selected by the optimization method or the application of the fermentation medium in the production of rhamnolipids.

[0033] As a preferred embodiment of this application, the application method is as follows: Pseudomonas putida rhlAB-Δflag seed culture is inoculated into the optimal fermentation medium at an inoculation rate of 2%, and fermented in a shake flask at 30°C and 200 rpm for 72 h.

[0034] A fourth objective of this invention is to provide a genetically engineered strain that produces high levels of rhamnolipin, including strain estA-2 and / or strain estA-3. These two genetically engineered strains, through a strategy of heterologous gene introduction and dual-vector co-expression, address the problems of insufficient precursors for rhamnolipin synthesis and low extracellular transport efficiency.

[0035] As a preferred embodiment of this application, the strain estA-2 is obtained by introducing the pMK-AB-estA plasmid into the sclerotium rhlAB-△flag, which is used to achieve dual overexpression of the rhlAB gene and heterologous expression of the estA gene.

[0036] As a preferred embodiment of this application, the strain estA-3 is obtained by introducing the pMK-AB-estA plasmid into the sclerotium rhlAB-rmlBDAC-△flag, which is used to achieve co-expression of the rhlAB gene, the rmlBDAC gene and the estA gene.

[0037] As a preferred embodiment of this application, the chassis bacteria are Δflag engineered strains.

[0038] As a preferred embodiment of this application, the substrate bacteria are selected from one or both of strains rhlAB-Δflag and rhlAB-rmlBDAC-△flag.

[0039] As a preferred embodiment of this application, the rhlAB gene is derived from Pseudomonas aeruginosa PAO1 and encodes a key enzyme in rhamnolipid synthesis (rhamnosyltransferase), which is the core gene for rhamnolipid biosynthesis. The nucleotide sequence of the rhlAB gene is shown in SEQ ID NO.1.

[0040] As a preferred embodiment of this application, the estA gene is derived from Pseudomonas aeruginosa PAO1, which encodes esterase A, can modify the lipid composition and structure of cell membranes, improve cell membrane permeability, and promote the production of fatty acid precursors. The nucleotide sequence of the rhlAB gene is shown in SEQ ID NO.2.

[0041] As a preferred embodiment of this application, the rmLBDAC gene cluster is derived from Pseudomonas aeruginosa PAO1, encodes a key enzyme in the glucose metabolism pathway, and can catalyze the generation of dTDP-L-rhamnose, a precursor in rhamnolipid synthesis, thereby removing the rate-limiting step in the synthesis. The nucleotide sequence of the rhlAB gene is shown in SEQ ID NO.3.

[0042] As a preferred embodiment of this application, the expression vector uses pBB plasmid and pMK plasmid as dual expression vectors, wherein the pBB plasmid contains a gentamicin resistance selection marker and the pMK plasmid contains a kanamycin resistance selection marker, which facilitates the screening and identification of recombinant strains.

[0043] As a preferred embodiment of this application, the pBB plasmid is used to carry the rhlAB gene and the rmLBDAC gene cluster; the pMK plasmid is used to carry the rhlAB and estA tandem gene.

[0044] The fifth objective of this invention is to provide a method for constructing a genetically engineered strain that produces high levels of rhamnolipids, comprising the following steps: tandemly linking the rhlAB gene and the estA gene to a linearized pMK vector to construct the recombinant plasmid PMK-AB-estA; then introducing the recombinant plasmid PMK-AB-estA into the PBB-AB series Δflag engineered strains of Chameleonella spp. to obtain strains estA-2 and estA-3.

[0045] As a preferred embodiment of this application, the engineered strain of the chassis bacterium PBB-AB series Δflag is selected from one or both of strains rhlAB-Δflag and rhlAB-rmlBDAC-Δflag.

[0046] As a preferred embodiment of this application, the method for constructing the genetically engineered strain that produces high levels of rhamnolipin includes the following steps:

[0047] The rhlAB gene and estA gene were ligated together into a linearized pMK vector that had been double-digested with EcoRI / KpnI to construct the recombinant plasmid PMK-AB-estA.

[0048] The recombinant plasmid PMK-AB-estA was introduced into the strain rhlAB-△flag to obtain the strain PMK-AB-estA-PBB-AB-Δflag, which is the strain estA-2.

[0049] The recombinant plasmid PMK-AB-estA was introduced into the strain rhlAB-rmlBDAC-△flag to obtain the strain PMK-AB-estA-PBB-AB-BDAC-Δflag, which is strain estA-3.

[0050] Specifically, for the construction of the plasmid corresponding to strain estA-2, using Pseudomonas aeruginosa PAO1 genomic DNA as a template, an upstream primer containing an EcoRI restriction site and an upstream homologous sequence of the rhlA gene, and a downstream primer containing a KpnI restriction site and a downstream homologous sequence of the estA gene were designed. The tandem fragment of the rhlAB gene and the estA gene was obtained by PCR amplification. The tandem fragment was recombinated with the linearized pMK plasmid using the Novizan ClonExpress Ultra One Step Cloning Kit to construct the recombinant plasmid pMK-AB-estA, which was then combined with the original pBB-rhlAB plasmid to form a dual-vector expression system.

[0051] Specifically, for the construction of the plasmid corresponding to strain estA-3, using the genomic DNA of Pseudomonas putida KT2440 as a template, specific primers were designed for PCR amplification to obtain the complete sequence of the rmLBDAC gene cluster. The recombinant plasmid pBB-rhlAB-rmLBDAC was constructed by inserting it into the multiple cloning site of the pBB-rhlAB plasmid using the Novizan ClonExpress UltraOne Step Cloning Kit. This plasmid was then combined with the pMK-AB-estA plasmid used by strain estA-2 to form a dual-vector co-expression system.

[0052] The sixth objective of this invention is to provide an application of the fermentation medium described above in conjunction with the genetically engineered strain that produces high levels of rhamnolipin in increasing rhamnolipin yield.

[0053] As a preferred embodiment of this application, the application includes shake flask fermentation and / or 5L fermenter fed-batch fermentation.

[0054] As a preferred embodiment of this application, the application involves inoculating the seed culture of strain estA-2 or strain estA-3 into the original LBG medium and the optimized RBS medium, respectively. On the one hand, this aims to increase the Rhl yield compared to the original strain AB; on the other hand, it is used to verify the fermentation effect of the optimized fermentation medium. The inoculation amount is 2%, and the fermentation is carried out at 30°C and 200 rpm for 72 h. Rhamnolipids are then extracted from the fermentation broth.

[0055] As a preferred embodiment of this application, strain estA-2 showed a 66.5% increase in Δflag compared to strain rhlAB in the original LBG medium, while strain estA-3 showed a 127.5% increase in Δflag compared to strain rhlAB under the same conditions, demonstrating the positive effect of strain modification.

[0056] As a preferred embodiment of this application, strain estA-3 showed a 61.69% increase in yield in the optimized RBS medium compared to strain rhlAB-Δflag in RBS, demonstrating a positive synergistic effect between strain modification and fermentation medium optimization.

[0057] As a preferred embodiment of this application, the application involves inoculating the seed culture of strain estA-3 into an optimized fermentation medium. The initial seed culture inoculation amount is 5% (v / v), and the initial fermentation broth volume is 2L. When the initial glucose and glycerol concentrations are higher than 2g / L, the stirring speed is controlled by dissolved oxygen (DO) feedback to maintain the oxygen level above 30%. When the initial glucose and glycerol concentrations are depleted, the stirring speed is kept constant, and the dissolved oxygen level is controlled below 60% by fed-batch feedback. The fermentation temperature is 30°C, and the pH is maintained at 7.0 using fed-batch phosphoric acid and ammonia. After fermentation, rhamnolipin is extracted from the fermentation broth. Under these conditions, strain estA-3 achieves a maximum OD600 of 21.4, a rhamnolipin yield of 35.59±2.18g / L, a conversion rate of 0.282g / g, and a productivity of 0.404g / L / h, reaching the highest values ​​reported to date for *Pseudomonas putida* KT2440 in a 5L fermenter.

[0058] The core feature of this invention is the use of a mixed carbon source and a mixed nitrogen source synergistic fermentation system. Through a step-by-step strategy of “screening key components by single-factor experiments → screening significant factors by PB experiments → determining the center point by steepest ramp experiments → optimizing the Box-Behnken response surface methodology”, the optimal culture medium formulation is accurately obtained.

[0059] Compared with the prior art, the beneficial effects of this application are: the present invention systematically optimizes the liquid fermentation culture medium and strain construction for the production of rhamnolipids by Pseudomonas putida, accurately screens key components of the culture medium and controls the proportion of each component, and constructs high-yield recombinant strains by heterologous expression of key genes, which significantly improves the production efficiency of rhamnolipids. The recombinant strain *Pseudomonas putida* estA-3, fermented in an optimized fermentation medium (15.91 g / L glucose, 13.56 g / L glycerol, 18.825 g / L yeast extract, 8.443 g / L sodium nitrate, 4 g / L potassium dihydrogen phosphate, 1 g / L disodium hydrogen phosphate, and 2 mL / L metal ion solution) in a 500 mL shake flask for 72 h, achieved a rhamnolipin yield of 10.93 g / L, a significant improvement compared to the yield of strain AB in the unoptimized LBG basal medium. In a fed-batch fermentation in a 5 L fermenter, the highest rhamnolipin yield reached 35.59 ± 2.18 g / L, with a conversion rate of 0.282 g / g and a productivity of 0.404%. The yield is g / L / h, reaching the highest level of rhamnolipin production reported by Pseudomonas putida KT2440 to date. The culture medium formula provided by this invention is scientific and reasonable, the raw materials are readily available and the cost is controllable, the constructed recombinant strain has stable fermentation performance, no complicated production process is required, and high-efficiency production of rhamnolipin can be achieved under conventional fermentation conditions, providing key technical support for its industrial application. Attached Figure Description

[0060] Figure 1 This is a graph showing the screening results of carbon source types in Example 1.

[0061] Figure 2 Example 1: Screening of nitrogen sources and results of mixed phosphate salts.

[0062] Figure 3 The figure shows the results of the single-factor experiment in Example 2. In the figure, each bar chart has a lowercase letter in the label. Different lowercase letters indicate significant differences, while the same lowercase letter indicates no significant differences.

[0063] Figure 4 The figure shows the 3D response surface plot in Example 5; the horizontal axis represents: A for glucose, B for glycerol, C for yeast extract, and D for sodium nitrate; a represents the effect of the concentration interaction of glucose (A) and glycerol (B) on rhamnolipid production; b represents the concentration interaction of glucose (A) and yeast extract (C); c represents the concentration interaction of glucose (A) and sodium nitrate (D); d represents the concentration interaction of glycerol (B) and yeast extract (C); e represents the concentration interaction of glycerol (B) and sodium nitrate (D); f represents the concentration interaction of yeast extract (C) and sodium nitrate (D).

[0064] Figure 5This is a comparison graph of shake-flask batch fermentation of LBG medium and optimized fermentation medium in Example 6. LBG and RSM represent LB+10% glucose medium and response surface optimization medium, respectively. *** represents P value <0.001.

[0065] Figure 6 This is a diagram of rhamnolipid synthesis metabolism in Example 7.

[0066] Figure 7 The figure shows the results of shake-flag fermentation of strains PBB-AB-Δflag(AB), PMK-AB-estA-PBB-AB-Δflag(estA-2), and PMK-AB-estA-PBB-AB-BDAC-Δflag(estA-3) in LBG medium. A is the OD600 detection result, B is the Rhl yield detection result, C is the residual glucose concentration in the medium, and D is the relative mRNA expression level of rhlA, rhlB, and estA genes after 12 h of shake-flag fermentation.

[0067] Figure 8 The figures show the results of shake-flask fermentation and RT-QPCR of strains PBB-AB-Δflag(AB), PBB-AB-BDAC-Δflag(BDAC), PBB-AB-estA-Δflag(estA-1), PMK-AB-estA-PBB-AB-Δflag(estA-2), and PMK-AB-estA-PBB-AB-BDAC-Δflag(estA-3) in RSM medium. In the figures, A represents the OD600 detection result, B represents the Rhl yield detection result, C represents the residual glucose concentration in the medium, and D represents the residual glycerol concentration in the medium.

[0068] Figure 9 The images show the fermentation results of strains AB and estA-3 in Example 9 in a 5 L fermenter. In the images, A shows the fermentation results of AB in WT medium, B shows the fermentation results of estA-3 in Optimized medium, C shows the fermentation results of estA-3 in WT medium, and D shows the fermentation results of estA-3 in Optimized medium. Detailed Implementation

[0069] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, unless otherwise specified, the following embodiments and features can be combined with each other. Unless otherwise specified, the methods used in the embodiments of the present invention are conventional methods, and the reagents used are commercially available.

[0070] The *Pseudomonas putida* rhlAB-△flag and rhlAB-rmlBDAC-△flag in this application were obtained by referring to the preparation method in Chinese Invention Patent CN117511841A.

[0071] (a) Extraction and detection of rhamnolipids:

[0072] Rhamnolipin sample preparation in fermentation broth: Take 1 mL of sample from the fermentation broth and centrifuge at 13,000 rpm for 5 minutes. Take 0.2 mL of supernatant, add 0.3 mL of ultrapure water and mix well, then add 0.5 mL of acetonitrile and mix, and store at 4 °C overnight. Centrifuge the overnight sample at 12,000 rpm for 5 minutes, and use the supernatant for HPLC analysis.

[0073] Preparation method of rhamnolipin standard: Dissolve 95% pure rhamnolipin in acetonitrile / water solution to a final concentration of 10 mg / mL water / acetonitrile (50:50, v / v), which is used as a standard for analyzing the concentration of rhamnolipin.

[0074] Rhamnose glycolipids were detected by liquid chromatography using a NUCLEODUR C18 Gravity column and a Vanquish™ Horizon UHPLC system (Thermo Fisher Scientific, USA) with an electrosol detector (Thermo Fisher Scientific Inc, MA, USA). 2 μL of sample was injected at a flow rate of 1 mL / min. The mobile phase consisted of acetonitrile and ultrapure water containing 0.2% (v / v) formic acid. The acetonitrile concentration was 70% from 0 to 1 min, linearly increased to 95% from 1 to 9 min, linearly decreased to 70% from 9 to 11 min, and finally reached 70% from 12 to 15 min.

[0075] β-rhamnolipin production rate P during fermentation V Calculated using the following formula:

[0076] P V =(C1-C2) / (t1-t2) (1;

[0077] Among them, P V t1 and t2 are the production rate of rhamnolipin, expressed in g / (L·h); t1 and t2 are the time points in the fermentation process, expressed in h; C2 and C1 are the concentrations of rhamnolipin in the fermentation broth at time points t1 and t2, expressed in g / L.

[0078] The rhamnose lipid conversion rate Ys during fermentation is calculated using the following formula:

[0079] Ys = C×V / g (2;

[0080] Where Ys is the conversion rate of rhamnolipin, in g / g; C is the concentration of rhamnolipin in the fermentation broth at the detection time point, in g / L; V is the volume of fermentation broth in the fermenter, in L; and g is the total mass of carbon source added to the fermentation broth at the detection time point, in g.

[0081] (b) Determination of other parameters of the strain and fermentation methods:

[0082] Cell growth assay: Take 2 mL of fermentation broth from each fermentation medium and measure the absorbance at 600 nm. Use fresh, unused medium as a blank control.

[0083] RNA extraction and reverse transcription were performed using a bacterial RNA extraction kit R403 and a HiScript II Q RT SuperMix (Vazyme Biotech Co., Ltd.). Real-time qPCR was performed using a ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd.) under the following conditions: initial denaturation at 95 °C for 30 s; followed by 10 s at 95 °C and 15 s at 60 °C, repeated 40 times. Each reaction consisted of a total volume of 20 μL, including 10 μL of SYBR qPCR mixture, 0.4 μM primer-F and Primer-R, 20 ng cDNA, and ddH2O. Relative mRNA levels were normalized using the housekeeping gene rpoD as a reference, and the results were calculated using a 2... -ΔCt The method is given by ΔCt = Ct(test) - Ct(rpoD).

[0084] Shake-flask fermentation: Transfer 2% seed culture to 50 mL of fermentation medium and incubate in a 250 mL Erlenmeyer flask at 200 rpm and 30°C for 72 h. Perform three replicates per experiment. Add ampicillin to the strains used for fermentation at a final concentration of 0.1 mg / L. For strains containing the pBBR1MCS5 vector, add an additional gentamicin at a final concentration of 0.025 mg / L; for strains containing the pMKa vector, add an additional kanamycin at a final concentration of 0.05 mg / L. All fermentation media were sterilized at 115°C for 30 min before use. All fermentations were performed in triplicate, and the average value was taken.

[0085] The specific procedure for electroporation is as follows: the verified plasmid is electroporated into competent cells at a voltage of 1.2-1.5 kV. Then, 1-2 mL of LB is added, and the cells are incubated for 1.5 h in a shaker at 30 ℃ and 200 rpm. The bacterial culture is then spread on LB plates containing the corresponding antibiotics and cultured until single colonies grow. Four different single colonies are picked for well plate fermentation. After the optimal strain is activated, 600 μL of bacterial culture is added to 600 μL of 50% glycerol and stored in a 2 mL sterile glycerol tube at -80 ℃.

[0086] 5L Fermentation: Fed-batch fermentation was conducted in a 5L fermenter (BIOTECH-5BG, BaoXing, Chain). The strain was cultured overnight in 10 mL LB medium to prepare the primary seed culture. Then, 5% of the primary seed culture was transferred to 200 mL LB medium and cultured in a 500 mL Erlenmeyer flask at 200 rpm and 30 °C for 8 h to prepare the secondary seed culture. The secondary seed culture was transferred to a 5L bioreactor containing a final volume of 2 L of fermentation medium. The pH of the medium was adjusted to 7.0 with HCl and NaOH before sterilization. When the initial glucose and glycerol concentrations were above 2 g / L, the stirring speed was controlled by dissolved oxygen (DO) feedback to maintain the oxygen level above 30%. When the initial glucose and glycerol concentrations were depleted, a constant stirring speed was maintained, and the dissolved oxygen level was controlled by fed-batch feedback to keep it below 60%. The fermentation temperature was 30 °C, and the pH was maintained at 7.0 using fed-batch phosphoric acid and ammonia. An antifoaming agent was added to suppress foaming. The fed culture medium contained 320 g / L glucose, 180 g / L glycerol, and 100 g / L yeast extract.

[0087] Example 1 Screening of Culture Medium Components

[0088] (1) In this embodiment, different carbon sources were investigated and the dominant carbon sources were screened. Water-soluble carbon sources glucose and glycerol, and hydrophobic carbon sources rapeseed oil, soybean oil, corn oil, olive oil, sunflower oil, methyl oleate, methyl palmitate, and dimethyl silicone oil were selected and added to LB medium at a concentration of 10 g / L for shake-flask fermentation. The growth status of the strain and the yield of rhamnolipids were used as the evaluation targets. The results are as follows: Figure 1 As shown, the optimal rhamnolipid yield was obtained when fermentation was carried out using 10 g / L glucose and 10 g / L glycerol as a mixed carbon source, with a maximum yield of 1.98 g / L. Therefore, glucose and glycerol were further investigated to determine the optimal concentration.

[0089] (2) Based on the optimal carbon source obtained through screening, this embodiment investigated different nitrogen sources and screened out the dominant nitrogen sources. 30 g / L organic nitrogen sources, urea and yeast extract, and 16 g / L inorganic nitrogen sources, ammonium sulfate, sodium chloride, and sodium nitrate, were selected to investigate single and mixed nitrogen source fermentation. The growth status of the strains and the yield of rhamnolipids were used as the investigation targets. The results are as follows: Figure 2 As shown in -ABC, the highest yield was obtained by adding 30 g / L yeast powder and 16 g / L sodium nitrate as a mixed nitrogen source, which were 3.43 g / L and 3.50 g / L, respectively. Therefore, yeast powder and sodium nitrate were selected for further investigation to determine the optimal concentration.

[0090] (3) Based on the above optimization, this implementation added different concentrations of potassium dihydrogen phosphate and disodium hydrogen phosphate to screen effective components. The growth status of the strain and the yield of rhamnolipin were used as the evaluation targets. The results are as follows: Figure 2 As shown in Figure -D, the optimal results were obtained by adding 2 g / L potassium dihydrogen phosphate and 4 g / L disodium hydrogen phosphate. Therefore, potassium dihydrogen phosphate and disodium hydrogen phosphate were selected for further investigation to determine the optimal concentration.

[0091] Example 2: Single-factor experiment

[0092] (1) Example 2 uses the 10 g / L glucose, 10 g / L glycerol, 30 g / L yeast extract, 16 g / L sodium nitrate, 2 g / L potassium dihydrogen phosphate, and 4 g / L disodium hydrogen phosphate determined in Example 1 as the basal culture medium. Further investigations were conducted, and preliminary optimization experiments were designed to determine the final concentration range of the above-mentioned subjects in the liquid fermentation medium. The culture medium includes different concentrations of glucose, glycerol, yeast extract, sodium nitrate, potassium dihydrogen phosphate, disodium hydrogen phosphate, and metal ion solutions. The fermentation process conditions are the same as in the preparation example.

[0093] (2) It was found that when the added amounts of glucose, glycerol, yeast powder, sodium nitrate, potassium dihydrogen phosphate, disodium hydrogen phosphate, and metal ion solution were 10 g / L, 20 g / L, 20 g / L, 8 g / L, 3 g / L, 2 g / L, and 1.5 mL / L, respectively, the rhamnolipid yield reached its highest value, which was 3.36 g / L, 3.42 g / L, 4.18 g / L, 4.41 g / L, 4.00 g / L, 3.42 g / L, 3.69 g / L, and 3.72 g / L, respectively. The results are shown in […]. Figure 3 . Figure 3 The results of single-factor experiments and high- and low-level designs are presented. Each bar chart has lowercase letters labeled with different lowercase letters, indicating significant differences, while the same lowercase letter indicates no significant differences. A represents LB medium with 10 g / L of different carbon sources added. B represents LB medium with 10 g / L of glucose and glycerol added, and 10 g / L of different nitrogen sources added. C represents shake-flask fermentation with varying glucose concentration in the basal medium. D represents shake-flask fermentation with varying glycerol concentration in the initial medium. E represents shake-flask fermentation with varying yeast concentration in the basal medium. F represents shake-flask fermentation with varying sodium nitrate concentration in the basal medium. G represents shake-flask fermentation with varying potassium dihydrogen phosphate concentration in the basal medium. H represents shake-flask fermentation with varying disodium hydrogen phosphate concentration in the basal medium. I represents shake-flask fermentation with varying metal ion concentration in the basal medium.

[0094] (3) Specifically, the composition of the metal ion solution is shown in Table 1.

[0095] Table 1. Composition and concentration of metal ion solution

[0096] Components concentration <![CDATA[CuSO4·5H2O]]> 10 g / L <![CDATA[ZnSO4·7H2O]]> 10 g / L <![CDATA[MgSO4·7H2O]]> 10 g / L <![CDATA[FeSO4·7H2O]]> 10 g / L <![CDATA[MnSO4]]> 10 g / L <![CDATA[NiCl2·6H2O]]> 0.25 g / L

[0097] .

[0098] Example 3: Plackett-Burman Test (PB Test)

[0099] (1) Based on the single-factor high and low levels determined in Example 2, a PB experiment was conducted. After analyzing the PB experiment results using Minitab software, the linear regression equation for rhamnolipid (Rhl) was obtained:

[0100] Rhl=0.200+0.0473A+0.02663B+0.05074C+0.0440D+0.2013E−0.1004F+0.301G(3);

[0101] (2) Glucose (A), glycerol (B), yeast powder (C), and sodium nitrate (D) were identified as significant factors (P<0.05); KH2PO4 (E), Na2HPO4 (F), and metal ion solution (G) were identified as non-significant factors, and their concentrations were determined to be 4 g / L, 1 g / L, and 2 mL / L, respectively.

[0102] (3) Specifically, the results of the PB experimental design are shown in Table 2, and the PB design variance analysis table is shown in Table 3.

[0103] Table 2 PB Design Results

[0104] Code A (g / L) B (g / L) C (g / L) D (g / L) E(g / L) F(g / L) G (mL / L) Rhl (g / L) 1 20 30 10 16 1 1 0.5 3.66±0.12 2 20 10 30 4 1 1 2 4.14±0.08 3 5 30 30 16 1 4 2 4.19±0.11 4 5 10 10 4 1 1 0.5 1.65±0.13 5 5 10 10 16 4 4 0.5 2.69±0.12 6 5 30 10 4 1 4 2 2.37±0.09 7 20 30 10 16 4 1 2 4.18±0.13 8 20 30 30 4 4 4 0.5 4.28±0.11 9 20 10 30 16 1 4 0.5 3.46±0.08 10 5 10 30 16 4 1 2 4.06±0.12 11 20 10 10 4 4 4 2 3.09±0.14 12 5 30 30 4 4 1 0.5 3.59±0.07

[0105] .

[0106] Example 4: Steepest Climb Experiment

[0107] (1) The climbing step length of the significant factor can be obtained from the Rhl linear regression equation obtained from the experiment in Example 3:

[0108] Step size A = 0.0473 / 0.05074 * (20-5) / 2 ≈ 7;

[0109] B step size = 0.02663 / 0.05074*(30-10) / 2≈5;

[0110] C_step = 0.05074 / 0.05074 * (30 - 10) / 2 ≈ 10;

[0111] Step size D = 0.0440 / 0.05074 * (16 - 4) / 2 ≈ 5;

[0112] (2) Five shake-flask experiments were designed with the low level as the starting point for the climb. The results showed that the concentrations A (12 g / L), B (15 g / L), C (20 g / L) and D (9 g / L) were the best. This data will be used as the center point of the BBD experiment.

[0113] (3) Specifically, the results of the steepest slope test design are shown in Table 4.

[0114] Table 4 Results of the steepest climb test design

[0115] Code A (g / L) B (g / L) C (g / L) D (g / L) E (g / L) F (g / L) G(mL / L) Rhl (g / L) 1 5 10 10 4 4 1 2 3.63±0.21 2 12 15 20 9 4 1 2 5.73±0.32 3 19 20 30 14 4 1 2 4.36±0.08 4 26 25 40 19 4 1 2 1.63±0.06 5 32 30 50 24 4 1 2 0.12±0.05

[0116] .

[0117] Example 5 Response Surface Experiment

[0118] (1) Based on the results of Example 4, a BBD experiment was designed using Design-Expert software, resulting in 29 experimental groups. Data analysis yielded the regression equation for Rhl yield:

[0119] Rhl=-5.54366+0.524274*A+0.631923*B+0.181243*C+0.648902*D-0.003514*AB+ 0.003538*AC-0.001290*AD+0.008949*BC+0.08316*BD+0.000825*CD-0.023346*A 2 -0.030040*B 2 -0.009717*C 2 -0.044821*D 2 ;

[0120] (2) According to the prediction results, the maximum rhamnolipin yield was 5.861 g / L, and the corresponding optimal factor concentrations were: A (15.91 g / L), B (13.56 g / L), C (18.82 g / L), and D (8.44 g / L). To further understand the relationship between rhamnolipin yield and these four significant factors, a 3D response surface plot was drawn, see [link to relevant data]. Figure 4 .

[0121] (3) Specifically, the experimental results of BBD and the specific data and analysis results of related variance analysis are shown in Tables 5 and 6.

[0122] Table 5 BBD Experimental Results

[0123] Code A (g / L) B (g / L) C (g / L) D (g / L) E (g / L) F (g / L) G (mL / L) Rhl (g / L) 1 12 10 20 14 4 1 2 4.13±0.13 2 12 20 10 9 4 1 2 3.95±0.14 3 5 15 30 9 4 1 2 3.78±0.21 45 1219 1020 1020 99 44 11 22 5.36±0.113.65±0.31 6 12 15 20 9 4 1 2 6.11±0.10 7 12 10 30 9 4 1 2 3.95±0.16 8 12 15 20 9 4 1 2 6.19±0.22 9 19 15 20 14 4 1 2 3.39±0.14 10 19 15 10 9 4 1 2 3.57±0.09 11 12 15 30 4 4 1 2 3.86±0.10 12 12 15 10 14 4 1 2 4.07±0.16 13 12 15 10 4 4 1 2 4.35±0.22 14 5 15 20 14 4 1 2 3.80±0.17 15 5 20 20 9 4 1 2 4.13±0.33 16 5 15 20 4 4 1 2 4.24±0.18 17 12 20 30 9 4 1 2 4.34±0.11 18 19 15 20 4 4 1 2 4.01±0.25 19 12 20 20 4 4 1 2 3.78±0.11 20 19 15 30 9 4 1 2 3.58±0.06 21 12 10 20 4 4 1 2 4.78±0.31 22 5 15 10 9 4 1 2 4.75±0.14 23 19 10 20 9 4 1 2 4.53±0.27 24 12 20 20 14 4 1 2 3.96±0.15 25 12 15 20 9 4 1 2 6.07±0.26 26 12 15 30 14 4 1 2 3.75±0.34 27 12 15 20 9 4 1 2 5.88±0.17 28 5 10 20 9 4 1 2 4.52±0.41 29 12 15 20 9 4 1 2 6.19±0.14

[0124] .

[0125] Table 6 BBD ANOVA Table

[0126] Source Sum of Squares df Mean Square F-value P-value Model 21.00 14 1.50 70.84 <0.0001 A-AB-B 0.51470.9964 11 0.51470.9964 24.3147.06 0.0002<0.0001 CC 0.6517 1 0.6517 30.78 <0.0001 DC 0.3095 1 0.3095 14.62 0.0019 AB 0.0605 1 0.0605 2.86 0.1130 AC 0.2453 1 0.2453 11.59 0.0043 AD 0.0082 1 0.0082 0.3851 0.5448 BC 0.8008 1 0.8008 37.83 <0.0001 BD 0.1729 1 0.1729 8.17 0.0127 CD 0.0068 1 0.0068 0.3215 0.5797 <![CDATA[A 2 ]]> 8.49 1 8.49 400.92 <0.0001 <![CDATA[B 2 ]]> 3.66 1 3.66 172.80 <0.0001 <![CDATA[C 2 ]]> 6.12 1 6.12 289.25 <0.0001 <![CDATA[D 2 ]]> 8.14 1 8.14 384.68 <0.0001 Residual 0.2946 14 0.0212 Lack of Fit 0.2307 10 0.0231 1.40 0.3980 Pure Error 0.0657 4 0.0164 Cor Total 21.29 28

[0127] .

[0128] Example 6 Model Validation

[0129] Based on the results of Example 5, the optimized culture medium was obtained as follows: glucose 15.91 g / L, glycerol 13.56 g / L, yeast extract 18.82 g / L, sodium nitrate 8.44 g / L, potassium dihydrogen phosphate 4 g / L, disodium hydrogen phosphate 1 g / L, and metal ion solution 2 mL / L (hereinafter referred to as RSM medium). Shake-flask fermentation experiments were conducted using LBG (LB + 10% glucose) medium and the optimized fermentation medium, respectively. Figure 5It can be seen that when the optimized fermentation medium was used for 72 h of shake-flask fermentation, cell growth was significantly improved, by 53.58% compared with LBG medium. The yield of rhamnolipin reached 6.08 g / L, which is basically consistent with the predicted value of 5.861 g / L. Compared with 1.50 g / L in LBG medium, the yield increased by 305.99%.

[0130] Example 7: Construction of high-yielding rhamnolipid strains estA-2 and estA-3, seeking to increase Rhl yield compared to AB.

[0131] Construction of strain estA-2:

[0132] S1. Preparation of AB-△flag competent cells of *Pseudomonas putida*, a fungus;

[0133] Streaking *Pseudomonas putida* rhlAB -△flag onto LB solid medium and incubating overnight at 30°C. Single colonies were then inoculated into 10 ml of LB liquid medium and incubated at 30°C and 200 rpm for 12 h. Following this, 2% inoculum was added to 50 ml of LB liquid medium and incubated at 30°C and 200 rpm until OD (out of control) was reached. 600 =0.7~1.4, immediately incubate on ice for 20 min. Transfer the bacterial culture to a pre-chilled 50 ml sterile centrifuge tube, centrifuge at 5000 rpm for 10 min, discard the supernatant, resuspend in 20 ml pre-chilled HEPES buffer, centrifuge at 5000 rpm for 10 min, repeat the washing three times, and finally resuspend in 1 ml 10% glycerol and aliquot into sterile 1.5 ml EP tubes, 100 μL per tube, and store at -80℃.

[0134] The *Pseudomonas putida* rhlAB-△flag in this application was obtained by referring to the preparation method in Chinese Invention Patent CN117511841A.

[0135] S2. Construct the recombinant plasmid PMK-AB-estA:

[0136] Using primer pair P1 / P2, the rhlAB gene (nucleotide sequence shown in SEQ ID NO.1) was amplified by PCR using P. aeruginosa PAO1 bacterial culture as a template. Using primer pair P3 / P4, the estA gene (nucleotide sequence shown in SEQ ID NO.2) was amplified by PCR using P. aeruginosa PAO1 bacterial culture as a template. The PCR reaction system is shown in Table 7, and the PCR procedure is shown in Table 8. The pMK plasmid was digested with EcoRI and KpnI, and then the rhlAB gene, estA gene, and pMK (EcoRI and KpnI) were ligated using C115 from Vazyme. Sequencing was used for verification, and the sequencing verification primers were P5 / P6, resulting in the recombinant plasmid PMK-AB-estA.

[0137] Table 7. Composition of the gene amplification PCR system

[0138] Components Dosage Template (PAO1 genome) 1 μL Upstream primer (10 μM) 1 μL Downstream primer (10 μM) 1 μL 2 × Phanta Max Buffer 25 μL dNTP Mix (10 mM) 1 μL Phanta Max Super-Fidelity DNA Polymerase 0.5 μL <![CDATA[dd H2O]]> Add to 50 μL

[0139] .

[0140] Table 8. Gene Amplification PCR Procedure

[0141] .

[0142] Table 9. Composition of the Colony Validation PCR System

[0143] Components Dosage Template (recombinant plasmid) 1 μL Upstream primer (10 μM) 1 μL Downstream primer (10 μM) 1 μL 2 × Phanta Max Buffer 25 μL dNTP Mix (10 mM) 1 μL Phanta Max Super-Fidelity DNA Polymerase 0.5 μL <![CDATA[dd H2O]]> Add to 50 μL

[0144] .

[0145] Table 10 Colony Validation PCR Procedure

[0146] .

[0147] Table 11 Primer Sequences

[0148] Primer name sequence P1 TCACACAGGAAACAGAATTCAAATTTTTGGGAGGTGTGAAATGCGGCCGAAAGTCTG P2 TCTAGATCAGGACGCAGCCTTCAG P3 AGGCTGCGTCCTGATCTAGAGTACAGGGCAAGGCCCC P4 TCGATGCATGCCATGGTACCTCAGAAGTCCAGGCTCAGC P5 GCAGGTCGTAAATCACTGCA P6 TTCAAAAGGTCATCCACCGG

[0149] .

[0150] S3. Constructing the genetically engineered strain estA-2:

[0151] The correctly sequenced recombinant plasmid PMK-AB-estA was electroporated into rhlAB-△flag competent cells at 1.2-1.5 kV. 1-2 ml of LB broth was added, and the cells were incubated for 1.5 h in a shaker at 30 °C and 200 rpm. The bacterial culture was then plated on LB agar plates containing gentamicin (25 mg / L), ampicillin (100 mg / L), and kanamycin (25 mg / L) and cultured until a single colony grew. A single colony was picked and inoculated into 10 ml of LB broth containing gentamicin (25 mg / L), ampicillin (100 mg / L), and kanamycin (25 mg / L). After incubation at 30 °C and 200 rpm for 12 h, 600 μL of the bacterial culture was added to 600 μL of 50% glycerol and stored in a 2 ml sterile glycerol tube at -80 °C. The strain was named estA-2.

[0152] Construction of strain estA-3:

[0153] S1. Preparation of competent cells of *Pseudomonas putida* rhlAB-rmlBDAC-△flag;

[0154] The specific operation method is the same as that used in Example 7 to construct S1 with strain estA-3;

[0155] The *Pseudomonas putida* rhlAB-rmlBDAC-△flag in this application was obtained by referring to the preparation method in Chinese Invention Patent CN117511841A.

[0156] S2. Construct the recombinant plasmid PMK-AB-estA:

[0157] The specific operation method is the same as that used in Example 7 for constructing S2 with strain estA-3.

[0158] S3. Constructing the genetically engineered strain estA-3:

[0159] The specific operation method is the same as that used in Example 7 to construct S3 from strain estA-3, and the final strain was named estA-3.

[0160] The recombinant plasmid PMK-AB-estA was introduced into the basal strains rhlAB-△flag and rhlAB-rmlBDAC-△flag, respectively, to construct strains PMK-AB-estA-PBB-AB-Δflag (strain estA-2) and PMK-AB-estA-PBB-AB-BDAC-Δflag (strain estA-3). The rhamnolipid synthesis metabolism diagram involving these genes is shown in Figure 6. The results showed that due to the higher metabolic burden of the dual-vector strains, their carbon source consumption capacity was weaker than that of the single-vector strains. However, compared to strain AB, Rhl production was significantly increased, with strain estA-2 showing a 66.5% increase and strain estA-3 a 127.7% increase. The results are as follows... Figure 7 .

[0161] Example 8: High-yielding rhamnolipid strains estA-2 and estA-3 were constructed to verify the fermentation effect of the optimized culture medium.

[0162] Strains PBB-AB-Δflag (AB), estA-2, and estA-3 were shake-flask fermented in RSM medium to verify the fermentation effect of the optimized medium. For strain AB used in the medium optimization, the Rhl yield in RSM was 6.76 ± 0.81 g / L, exceeding the final predicted value of 5.861 g / L from the response surface methodology. The success of this medium optimization was verified by fermentation of AB and other recombinant strains. The highest Rhl yield of estA-2 in RSM medium was 7.03 ± 0.29 g / L, and the highest Rhl yield of estA-3 in RSM medium was 10.93 ± 0.34 g / L. The Rhl yield of estA-3 in RSM was 61.69% higher than that of AB. The fermentation results are as follows: Figure 8 .

[0163] Example 9: Application of the modified high-yield strain in a 5L RBS medium tank

[0164] Strains PBB-AB-Δflag(AB) and PMK-AB-estA-PBB-AB-BDAC-Δflag(estA-3) were fermented in a 5 L fermenter using LBG medium and RBS fermentation medium, respectively, as used in previous work. The fermentation results are as follows: Figure 9 As shown in AD, strain AB grew slowly in WT medium and consumed glycerol very slowly, with a maximum OD600 of 22.3 and a maximum Rhl of 7.36 ± 0.698 g / L. However, in RSM medium, OD600 continued to increase, reaching a maximum of 29.75, and Rhl production reached a maximum of 15.71 ± 0.923 g / L. Rhl production saw a burst of growth around 24 hours, while in WT medium it was delayed until around 48 hours. The fermentation results of strain estA-3 in the two different media were basically consistent with AB. Also in RSM medium, the growth and Rhl production of the strain were significantly improved, with a maximum OD600 of 21.4 and a maximum Rhl production of 35.59 ± 2.18 g / L, reaching the highest value reported so far for *Pseudomonas putida* KT2440 in a 5 L fermenter. Throughout the fermentation process, the strain grew steadily, the carbon source was continuously consumed, and after the addition of an inducer, Rhl accumulated steadily until the end of fermentation. At the peak Rhl yield of 88 hours, a total of 93.72 g of glucose and 79.07 g of glycerol were added, resulting in a productivity of 0.404 g / L / h and a conversion rate of 0.282 g / g.

[0165] This invention significantly improves the rhamnolipin production capacity of *Pseudomonas putida* through the synergistic effect of culture medium optimization and strain molecular modification, and has been validated in a 5L fermenter. It provides an efficient and reliable technical solution for the industrial production of rhamnolipin and has important industrial application value.

[0166] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. An optimization method for a high-yield rhamnolipid fermentation medium of *Pseudomonas putida* based on a stepwise optimization strategy, characterized in that, Includes the following steps: Step 1, Initial screening of components: Using *Pseudomonas putida* rhlAB-Δflag as the starting strain, carbon source, nitrogen source, phosphate and metal ions were screened through single-factor experiments to determine the essential auxiliary components; Step 2, Plackett-Burman experiment: Design a multi-factor orthogonal experiment to investigate the effects of each essential auxiliary component on rhamnolipid production, and screen out the significant influencing factors with P<0.05; Step 3, Steepest Climbing Experiment: Determine the climbing direction and step size of each significant factor based on the regression coefficients of the Plackett-Burman experiment, and approximate the optimal response region through gradient concentration fermentation experiment to determine the center point concentration for response surface optimization. Step 4: Box-Behnken response surface optimization: A four-factor, three-level response surface experiment was designed based on the center point concentration. A quadratic regression model was established with rhamnose lipid yield as the response value. After verifying the effectiveness of the model through analysis of variance, the optimal fermentation medium formulation was obtained. Step 5: Model Validation: Prepare the fermentation medium according to the optimal formula and conduct shake-flask fermentation to verify the consistency between the rhamnose lipid yield and the model prediction and the stability of the formula.

2. The optimization method according to claim 1, characterized in that, In step 1, the essential auxiliary components include: a mixed carbon source consisting of glucose and glycerol, a mixed nitrogen source consisting of yeast powder and sodium nitrate, and potassium dihydrogen phosphate, disodium hydrogen phosphate, and a metal ion solution.

3. The optimization method according to claim 1, characterized in that, The fermentation medium selected in step 1 is composed of the following substances in the following weight percentages: glucose 0-30 g / L, glycerol 0-50 g / L, yeast extract 0-50 g / L, sodium nitrate 0-20 g / L, potassium dihydrogen phosphate 0-5 g / L, disodium hydrogen phosphate 0-5 g / L, and metal ion solution 0-2 mL / L.

4. The optimization method according to claim 3, characterized in that, The fermentation medium screened in step 3 is composed of the following substances in the following weight percentages: glucose 5-19 g / L, glycerol 10-20 g / L, yeast powder 10-30 g / L, sodium nitrate 4-14 g / L, potassium dihydrogen phosphate 4 g / L, disodium hydrogen phosphate 1 g / L, and metal ion solution 2 mL / L.

5. The fermentation medium according to claim 4, characterized in that, The optimal fermentation medium determined in step 4 consists of the following components in weight percentage: glucose 15.91 g / L, glycerol 13.56 g / L, yeast extract 18.83 g / L, sodium nitrate 8.44 g / L, potassium dihydrogen phosphate 4 g / L, disodium hydrogen phosphate 1 g / L, and metal ion solution 2 mL / L.

6. A fermentation medium selected by the optimization method according to any one of claims 1-5.

7. The application of a fermentation medium selected by the optimization method according to any one of claims 1-5 or the fermentation medium according to claim 6 in the production of rhamnolipids.

8. The application according to claim 7, characterized in that, The application method is as follows: inoculate the seed culture of *Pseudomonas putida* rhlAB-Δflag at a 2% inoculation rate into the optimal fermentation medium, and ferment in a shake flask at 30°C and 200 rpm for 72 hours.

9. A genetically engineered strain that produces high levels of rhamnolipin, characterized in that, The strains include estA-2 and / or estA-3; wherein, the strains estA-2 and estA-3 are obtained by introducing the pMK-AB-estA plasmid into the *Bacillus subtilis*; wherein, strain estA-2 is used to achieve dual overexpression of the rhlAB gene and heterologous expression of the estA gene; strain estA-3 is used to achieve co-expression of the rhlAB gene, the rmlBDAC gene, and the estA gene; the *Bacillus subtilis* is a Δflag engineered strain.

10. The application of the fermentation medium of claim 6 in conjunction with the genetically engineered strain of claim 9 that produces high rhamnolipin in order to improve rhamnolipin yield.

Citation Information

Patent Citations

  • Genetically engineered bacterium for producing rhamnolipid at high yield, construction method and application of genetically engineered bacterium

    CN117511841A

Cited By

  • A library of genomic insertion sites of pseudomonas putida and a method for constructing the same

    CN122128813A