Alfalfa pectin acetylesterase MsPAE12 and its encoding gene and application

Abstract

The present invention discloses an alfalfa pectin acetylesterase MsPAE12, its encoding gene, and its application. The amino acid sequence of the pectin acetylesterase MsPAE12 is shown in SEQ ID NO: 2, and the encoding gene sequence is shown in SEQ ID NO: 1. In addition, the present invention also provides the application of the pectin acetylesterase MsPAE12 protein and its encoding gene in increasing the number of alfalfa branches, as well as the application of its nucleotide sequence, amino acid sequence, cloning vector, expression vector, or host cell in genetic engineering. The present invention utilizes genetic engineering technology to cultivate MsPAE12 transgenic plants, significantly increasing the number of plants' branches, providing an important theoretical basis for the cultivation and breeding of new alfalfa varieties, and having great application value.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to an alfalfa pectin acetylesterase MsPAE12 and an encoding gene thereof and application thereof in promoting plant branching. Background Art

[0002] Alfalfa (Medicago sativa L.) is a perennial herb of the genus Medicago in the legume family. It has the characteristics of high grass yield, excellent quality, strong adaptability, and good palatability. It also has protective functions such as maintaining water and soil and improving sandy beaches. It plays an important role in animal husbandry production and protecting the ecological environment.

[0003] Pectin acetylesterase (PAE) is a carbohydrate esterase that acts on the C-2 or C-3 carboxyl groups of galacturonic acid, cleaving the acetyl ester bond to release acetic acid, thereby acetylating pectin. Pectin acetylation alters the physicochemical properties of pectin components, affecting pectin solubility and crucially affecting cell adhesion and cell wall structure. Plant PAEs are involved in numerous processes of plant growth and development and stress defense, including fruit firmness, pollen tube and grain formation, and plant resistance to Phytophthora and aphids. Although several plant PAE genes have been identified (e.g., Arabidopsis, soybean, and apple), functional studies of these enzymes have been limited to a few plant species. Currently, few PAE-encoding gene sequences have been reported for alfalfa.

[0004] Therefore, those skilled in the art are committed to developing a new pectin acetylesterase that can effectively change the plant type, especially increase the number of branches, and achieve an increase in plant yield, especially an improvement in breeding work that promotes plant branching. Summary of the Invention

[0005] In view of the above-mentioned defects of the prior art, the technical problem to be solved by the present invention is how to provide a pectin acetylesterase with the functional characteristics of regulating the content of plant auxin and promoting branching.

[0006] To achieve the above object, the present invention provides an alfalfa pectin acetylesterase MsPAE12, wherein the MsPAE12 protein is A1, A2, A3 or A4:

[0007] A1, a protein with an amino acid sequence as shown in SEQ ID NO: 2;

[0008] A2, a protein obtained by deleting, inserting and / or replacing 1 to 22 amino acids in A1;

[0009] A3, a protein obtained by adding 1 to 20 amino acids to the C-terminus and / or N-terminus of the protein described in A1;

[0010] A4: A protein with more than 94.9% homology to A1.

[0011] The second aspect of the present invention is to provide the use of the alfalfa pectin acetylesterase MsPAE12 protein in changing the number of plant branches.

[0012] The third aspect of the present invention is to provide the coding gene of the alfalfa pectin acetylesterase MsPAE12, wherein the coding gene comprises the nucleotide sequence shown in nucleotide sequence SEQ ID NO: 1.

[0013] Furthermore, the nucleotide sequence is B1 or B2 or B3 or B4:

[0014] B1, having the sequence shown in SEQ ID NO. 1, positions 1 to 1278;

[0015] B2, sequences with more than 95.5% homology to B1;

[0016] B3, a sequence that can hybridize with A1;

[0017] B4: A sequence obtained by deleting, inserting and / or replacing 1 to 58 nucleotides in B1.

[0018] Preferably, the nucleotide sequence is obtained by alfalfa cloning and / or artificial synthesis methods.

[0019] The third aspect of the present invention is to provide the use of the encoding gene in changing the number of plant branches.

[0020] Furthermore, the application includes: constructing an expression vector containing the coding gene of the pectin acetylesterase MsPAE12; transforming a plant host; and cultivating and screening to obtain transgenic plants.

[0021] Preferably, the plant host is a plant tissue or a plant cell.

[0022] The fourth aspect of the present invention is to provide a method for cultivating MsPAE12 overexpressing transgenic plants, comprising: constructing an expression vector containing the pectin acetylesterase MsPAE12 encoding gene as described in claim 3 or 4; transforming the constructed expression vector into plant tissues or plant cells; and cultivating and screening to obtain MsPAE12 overexpressing transgenic plants.

[0023] The fifth aspect of the present invention is to provide a plant overexpression vector, which includes the pectin acetylesterase MsPAE12 encoding gene.

[0024] The beneficial effects of the present invention are:

[0025] 1) The provided pectin acetylesterase MsPAE12 and its encoding gene have significant effects on changing the number of plant branches, providing a basis for breeding transgenic plants with excellent characteristics such as multiple branches and high yields;

[0026] 2) The present invention successfully constructed an expression vector containing the MsPAE12 gene and cultivated transgenic alfalfa plants that can overexpress the MsPAE12 gene. The auxin content in the plants was significantly reduced, and the plant type of the original plants was changed. This provides an important foundation for the cultivation of high-yield alfalfa and the improvement of its breeding work, and has great application value.

[0027] The concept, specific structure and technical effects of the present invention will be further described below in conjunction with the accompanying drawings to fully understand the purpose, characteristics and effects of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 is the amino acid sequence and conserved domain analysis diagram of MsPAE12;

[0029] Figure 2 This is a schematic diagram of the predicted results of the transmembrane domain and signal peptide of the MsPAE12 amino acid sequence;

[0030] Figure 3 It is a schematic diagram of the results of the MsPAE12 evolutionary tree analysis;

[0031] Figure 4 This is a schematic diagram of the analysis results of the expression of MsPAE12 gene in different tissues;

[0032] Figure 5 Schematic diagram of MsPAE12 subcellular localization. A shows the localization of p35S-YFP and pm-rk co-transfected tobacco, B shows the localization of p35S-MsPAE12-YFP and pm-rk co-transfected tobacco, and C shows the localization of p35S-MsPAE12-YFP and pm-rk co-transfected tobacco after plasmolysis.

[0033] Figure 6 Figure 1 is a phenotypic analysis of MsPAE12 promoting plant branching. A is the PCR result of the hygromycin gene, B is the relative expression level of the MsPAE12 gene, C is a photo of the branching phenotype, and D is the branch number statistics.

[0034] Figure 7 This is an analysis of auxin content in the apical buds and stems of MsPAE12 overexpressing transgenic lines;

[0035] Figure 8 This is an analysis chart of the expression levels of auxin synthesis-related genes in the apical buds of MsPAE12-overexpressing transgenic lines. DETAILED DESCRIPTION

[0036] The following describes several preferred embodiments of the present invention with reference to the accompanying drawings to make its technical content clearer and easier to understand. The present invention can be embodied in many different forms of embodiments, and the scope of protection of the present invention is not limited to the embodiments mentioned herein.

[0037] Example 1: Cloning and sequence analysis of the alfalfa MsPAE12 gene

[0038] 1. RNA Extraction and cDNA Synthesis

[0039] Total RNA was extracted from leaf tissue of Medicago sativa WL525 using the TransZol Up Plant Total RNA Extraction Kit. The integrity of the RNA was identified by gel electrophoresis, and the purity and concentration of the RNA were determined by a spectrophotometer (Thermo Scientific Nanodrop 1000). Reverse transcription was performed using TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (purchased from Quanshijin) to synthesize cDNA.

[0040] 2. Full-length cloning of the gene

[0041] Based on a nucleotide sequence highly homologous to the MsPAE12 gene fragment in Medicago truncatula, the following primers were designed: ORF-F (5'-ATGGCTAAACTTTTCTGGGTTT-3') and ORF-R (5'-TCAACTGAAAACCAAATGGTGA-3'). PCR was performed using the cDNA of Medicago truncatula WL525 as a template, resulting in a 1278-bp full-length coding sequence for the Medicago WL525 MsPAE12 protein (SEQ ID NO. 1). The sequencing results were compared against the GenBank database using a BLAST (http: / / blast.ncbi.nlm.nih.gov / ) NCBI website. The nucleotide sequence and encoded protein showed high homology to known Medicago truncatula PAE genes, leading to the initial conclusion that this is a PAE gene.

[0042] 3. Sequence Information and Homology Analysis of the MsPAE12 Gene from WL525 of Medicago sativa

[0043] The full-length open reading frame sequence of the alfalfa MsPAE12 of the present invention is 1278 bp, and the detailed sequence is shown in SEQ ID NO. 1. The amino acid sequence of the alfalfa MsPAE12 protein was deduced based on the open reading frame sequence, which has a total of 425 amino acid residues, and the detailed sequence is shown in SEQ ID NO. 2.

[0044] Medicago sativa MsPAE12 has very high similarity with PAE genes from Medicago truncatula (accession number: AES82343.1) and two Arabidopsis thaliana (accession numbers: AT5G26670 and AT3G05910) at the amino acid level, and has nine conserved domains typical of plant PAE genes, namely CLDG, PXYH, GGGWC, GS, NWN, RYCDG, GCSAG, NXAYDXWQ, and HCQ, as indicated by red stars. Figure 1 The signal peptide and transmembrane domain of MsPAE12 were predicted using Signal IP 6.0 and TMHMM 2.0 online software, respectively. The results showed that the N-terminus of MsPAE12 protein contained a transmembrane domain and a signal peptide consisting of 21 amino acids, as shown in Figure 2. Figure 2 shown.

[0045] The amino acid sequences of 26 PAEs from Arabidopsis thaliana and Medicago truncatula were compared using MEGA7.0 software using the complete amino acid sequences of PAE genes. The 26 PAE amino acid sequences were obtained from the NCBI website (http: / / www.ncbi.nlm.nih.gov / genbank / ). The neighbor joining method (NJ) was used to construct the evolutionary tree. The main parameters were set as follows: distance model, Poisson moder; gene tree robustness test, bootstrap method, 1000 repetitions; processing of gap missing data, pairwise deletion. Figure 3 As shown, the PAE gene evolutionary tree is divided into three branches, and the alfalfa WL525MsPAE12 gene is classified into the first branch.

[0046] Example 2: Expression differences of the MsPAE12 gene in different tissues of alfalfa

[0047] 1. Cultivation and treatment of alfalfa WL525 plants: Remove the coating from the seeds, wash them, and evenly distribute them on a tray lined with filter paper. Keep them moist. After 7 days, select seedlings that are growing well and uniformly and transplant them into 1 / 2 Hoagland nutrient solution for hydroponics. The formula of Hoagland culture medium is as follows: Ca(NO3)2·4H2O 0.62g / L, KNO3 0.34g / L, KH2PO40.06g / L, NH4NO3 0.053g / L, MgSO4 0.24g / L, MgCl2 0.67mg / L, H3BO3 0.38mg / L, MnSO40.2mg / L, ZnSO4·7H2O 0.29mg / L, CuSO4 0.01mg / L, FeSO4·7H2O 0.02785g / L, EDTA-Na20.0373g / L, pH 5.7-5.8), cultured at 28°C under 16 h light / 8 h dark conditions, and after 2 weeks, the root tip (0-1 cm), root base, terminal bud, node, young leaf, mature leaf, old leaf, stem, petiole and stipule of alfalfa were collected, wrapped in tin foil, frozen with liquid nitrogen and stored in a -80°C ultra-low temperature freezer.

[0048] 2. RNA extraction, determination of RNA integrity, purity, and concentration, and acquisition of cDNA were performed as described in Example 1;

[0049] 3. Based on the obtained PAE12 gene sequence of WL525Ms of alfalfa, specific primers for quantitative analysis were designed: primer qPAE12-F (5'-ACGGCGTGGATCATCATTATACATGG-3') and primer qPG1-R (5'-TCGCTGTCCTCTGAATTGCAGTTC-3'). The internal reference gene was the elongation factor EF-α gene, and the primers were EF-F (5'-GCACCAGTGCTCGATTGC-3') and EF-R (5'-TCGCCTGTCAATCTTGGTAACAA-3').

[0050] 4. Real-time fluorescence quantitative PCR was performed using a Bio-rad real-time quantitative PCR instrument with the cDNA of the sample taken above as a template. The reaction system contained 10 μL of 2×SYBR qPCR SuperMix (purchased from Quanshijin), 0.4 μL of Primer F / R each, 2 μL of cDNA, and water to a total volume of 20 μL. The reaction procedure was 94°C for 30 s; 95°C for 5 s, 57°C for 15 s, 72°C for 15 s, and 40 cycles. Each treatment was repeated 3 times biologically and 3 times technically. The data were analyzed using the 2-ΔΔCT method, statistical analysis was performed using SAS 9.0, and graphing was performed using sigmplot10.0. The expression pattern is shown in the figure. Figure 4 shown.

[0051] Example 3: Subcellular localization analysis of MsPAE12 in alfalfa and tobacco leaves

[0052] 1. Construction of plant expression vector

[0053] Specific primers were designed to introduce restriction sites at the start and stop codons: PAE12-F (5'-CGGGATCCATGGCTAAACTTTTCTGGGTTT-3') and PAE12-R (5'-GGACTAGTACTGAAAACCAAATGGTGACAT-3'). PCR products were recovered and ligated into the pMD18-T vector. Single colonies were identified for PCR verification and sequencing. Plasmids from positive clones were isolated. The target fragment plasmid and the PHB binary transformation vector were double-digested with BamHI and SpeI. The PHB vector and MsPAE12 fragment were recovered and ligated with T4 ligase overnight at 16°C. The cells were then transformed into Escherichia coli. Plasmids from positive clones were isolated and transformed into Agrobacterium tumefaciens GV3101.

[0054] 2. Transient Expression in Tobacco Leaves

[0055] (1) Agrobacterium preparation: Streak and activate the glycerol Agrobacterium strain containing pHB-MsPAE12-YFP, pm-rk (plasma membrane marker) and an empty vector, pick a single clone into 5 ml LB liquid medium containing 50 mg / L Kan and 25 mg / L Rif, and shake at 28°C, 200 rpm for 24 h; then expand the culture into LB medium containing the same resistance at a ratio of 1:100, and culture at 28°C, 200 rpm until the OD 600 The temperature is about 1.2, 18℃, 6000rpm, and the bacteria are collected for 15 minutes.

[0056] (2) Transient transformation of tobacco leaves: suspend the cells in MS liquid medium until the OD 600 The volume ratio of pm-rk was 0.6, and pm-rk was mixed with pHB-MsPAE12-YFP and empty load at 1:1, and AS (final concentration was 0.2mM) and MES (final concentration was 10mM) were added. The mixture was placed in the dark at room temperature for 3 hours. The tobacco leaves were injected and placed in the dark for 48 hours. The tobacco leaves infected with Agrobacterium were placed under a laser confocal microscope for microscopic observation. The leaves were treated with 0.3g / mL sucrose for 10 minutes for plasmolysis. MsPAE12 is located in the cell membrane, and the results are as follows. Figure 5 shown.

[0057] Example 4. Phenotypic Analysis of Transgenic Alfalfa Overexpressing MsPAE12

[0058] 1. Acquisition and identification of transgenic alfalfa overexpressing MsPAE12

[0059] 1) Explant Preparation: Clean alfalfa seeds of the Gannong 3 variety and place them in a 60°C oven for 72 hours. Disinfect them with sodium hypochlorite and then anhydrous ethanol, inoculate them on MS solid medium for germination and growth, and use Agrobacterium infection after 20 days.

[0060] 2) Agrobacterium Preparation: The pHB-MsPAE12-Flag Agrobacterium strain stored at -80°C was streaked onto LB solid medium containing the antibiotics Kan50 and Rif100. After incubation at 28°C for 48 h, a single colony was picked and transferred to LB liquid medium containing the same antibiotics. The culture was incubated on a shaker at 200 rpm at 28°C to an OD600 of 0.8. The culture was centrifuged at 4500 rpm at room temperature for 15 min. The resuspension solution was adjusted to an OD600 of 0.4 in a sterile culture flask before infection.

[0061] 3) Agrobacterium infection: Gently pinch the sterile seedling leaves, place them in the bacterial solution prepared in (2), cover the bottle, evacuate for 10 minutes, ultrasonicate in an ultrasonic cleaner at 40kHz and 20℃ for 2 minutes, remove them, and evacuate again for 10 minutes. Use tweezers to remove the leaves, lay them flat between multiple layers of sterile paper, cover them for 25 minutes, and then transfer them to the co-cultivation medium and incubate them in the dark for 5 days.

[0062] 4) Callus Induction and Differentiation: Infected leaves are placed on a screening medium under light to induce callus for 4 weeks, with one subculture. Once callus is formed, it is transferred to a regeneration medium. After 6-8 weeks, calli with budding points are transferred to a stem elongation medium. After 2-4 weeks, leaves are differentiated and transferred to a rooting medium. After 2-4 weeks, roots are formed and the plants are transplanted to a substrate for culture. After 4 weeks, cuttings are used for propagation.

[0063] 5) Identification of transgenic lines: Approximately 0.2 g of leaves from wild-type alfalfa and transgenic lines were thoroughly ground in liquid nitrogen. The gDNA was extracted using a Plant Genomic DNA Extraction Kit (purchased from Quanshijin) for hygromycin verification. The hygromycin upstream and downstream primer sequences were: hyg-F: 5′-GGATATGTCCTGCGGGTAAA-3′; hyg-R: 5′-ATTTGTGTACGCCCGACAGT-3′. The PCR reaction system was the same as in Example 1, with an extension time of 1 min. The gel electrophoresis results are shown in Figure 2. Figure 6 As shown in A. After positive strains were identified, the relative expression levels of MsPAE12 in wild-type and transgenic strains were detected by qRT-PCR. The qRT-PCR reaction system was the same as that in Example 2. The relative expression detection results were shown in Figure 6 As shown in B.

[0064] The culture medium formulation for this genetic transformation method is based on the literature reference: Chunxiang Fu, Timothy Hernandez, Chuanen Zhou et al. Agrobacterium Protocols, Springer New York, 2015.

[0065] 2. Phenotypic Analysis of Transgenic Medicago Overexpressing MsPAE12

[0066] Wild-type and MsPAE12-overexpressing transgenic lines with good and consistent growth were selected. The stems were cut into 4-5 cm segments. Two oblique cuts were made at the nodes and internodes. The nodes contain a leaf and an axillary bud. The internode cuts were dipped in a small amount of rooting powder and cultured in a 1:2 (peat:vermiculite) medium. After 5, 35, 40, and 45 days of culture, the growth phenotypes were observed and the number of branches was counted. The results are as follows: Figure 6 As shown in C and 6D, overexpression of MsPAE12 significantly increased the number of branches in alfalfa.

[0067] Example 5: Analysis of auxin content in alfalfa plants overexpressing MsPAE12

[0068] 1. The plant material culture process was the same as in Example 4. After 40 days of culture, 0.5 g of the terminal buds and stems of the wild type and transgenic lines were respectively taken, wrapped in tin foil, frozen with liquid nitrogen, and stored at -80°C for later use.

[0069] 2. Determination of Auxin Content

[0070] Since MsPAE12 is expressed at the highest level in the terminal bud, and auxin, a key hormone regulating branching, is mainly synthesized in the terminal bud, the auxin content was determined using a plant auxin enzyme-linked immunosorbent assay kit (Jianglai Biotechnology Co., Ltd.) according to the kit instructions. Figure 7 As shown, compared with the wild type, overexpression of MsPAE12 significantly reduced the auxin content in the terminal buds and stems.

[0071] Example 6: Analysis of the expression levels of auxin synthesis genes in the terminal buds of alfalfa plants overexpressing MsPAE12

[0072] The plant material culture process was the same as in Example 4. After 40 days of culture, the terminal buds of the wild type and MsPAE12 overexpressing transgenic lines were collected and total RNA was extracted as in Example 1. The qRT-PCR reaction system was the same as in Example 2. The primer sequences for each gene are as follows:

[0073] TAA1q-F:GGGTGGTGATGCTGTGTATG,

[0074] TAA1q-R:CACGAAGGGTTCCATCAGGGTG;

[0075] TAR2q-F:CGAACAGGTGGAAGCAGCTAAGAG,

[0076] TAR2q-R:TCCACATTTCCCTCACACTTCAACC;

[0077] YUC4q-F:AGCAATGTGCCTAGTTGGCTCAAG,

[0078] YUC4q-R:AGACCTCTTCTTGTGAAACCCACTG;

[0079] YUC1q-F:AGGAATAAGTGGCCTACTTGCTTGC,

[0080] YUC1q-R:GCCTCCATAATCCTCCAACACCATC;

[0081] YUC2q-F:GTTGTGCCTCAAATTGAAGGGATGG,

[0082] YUC2q-R: TTTCCACACCCCACCACCAAAAC;

[0083] YUC6q-F:TTCAGTACACGTCCTACCACGAGAG,

[0084] YUC6q-R:AGCCATGACACTATGAGCAAGAACC.

[0085] The relative expression detection results are as follows Figure 8 Compared with the wild type, the expression levels of MsTAA1, MsTAR2 and MsYUCC4 were significantly downregulated in MsPAE12 overexpressing transgenic plants ( Figure 8 AC), the expression levels of MsYUCC1, MsYUCC2 and MsYUCC6 were up-regulated ( Figure 8 DF).

[0086] The preferred embodiments of the present invention have been described in detail above. It should be understood that numerous modifications and variations based on the concepts of the present invention are possible without inventive effort by those skilled in the art. Therefore, any technical solution that can be derived by one skilled in the art through logical analysis, reasoning, or limited experimentation based on the concepts of the present invention and the prior art should be within the scope of protection defined by the claims.

Claims

1. A method for increasing the number of branches of transgenic alfalfa by overexpressing alfalfa pectin acetylesterase MsPAE12 protein, characterized in that: The amino acid sequence of the MsPAE12 protein is shown in SEQ ID NO:

2.

2. A method for increasing the number of branches of transgenic alfalfa by overexpressing a gene encoding a protein of alfalfa pectin acetylesterase MsPAE12, characterized in that: The coding gene for overexpressing alfalfa pectin acetylesterase MsPAE12 is shown in the nucleotide sequence SEQ ID NO: 1, and the nucleotide sequence is obtained by alfalfa cloning and / or artificial synthesis methods.

3. The use according to claim 2, characterized in that The application comprises: constructing an expression vector containing the pectin acetylesterase MsPAE12 coding gene; transforming alfalfa plant hosts; and cultivating and screening to obtain transgenic alfalfa plants.

4. The use according to claim 3, characterized in that The plant host is plant tissue or plant cell.

5. A method for cultivating MsPAE12 overexpressing transgenic plants, characterized in that: The method comprises: constructing an expression vector for overexpressing alfalfa pectin acetylesterase MsPAE12 encoding gene; the overexpressed alfalfa pectin acetylesterase MsPAE12 encoding gene is as shown in the nucleotide sequence SEQ ID NO: 1, transforming the constructed expression vector into alfalfa; and cultivating and screening to obtain MsPAE12 overexpressing transgenic alfalfa.

Images