MiR204 derived from brassica napus and application thereof

By overexpressing miR204 in *Strombyx mori*, the problem of insufficient drought and salt stress resistance in plants under existing technologies has been solved, the stress resistance gene pool has been enriched, and the stress resistance of plants has been enhanced.

CN115725575BActive Publication Date: 2026-06-19YANGTZE NORMAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210853963.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-12
Publication Date
2026-06-19
Estimated Expiration
2042-07-12

AI Technical Summary

Technical Problem

In the current technology, plant stress resistance research for drought and soil salinization stress is mainly focused on a few model plants, and miRNA research is not yet comprehensive, lacking effective stress resistance gene resources.

Method used

We discovered and utilized miR204 in *Mustela stenoptera*, and improved the expression level of miR204 in plants by constructing recombinant expression vectors and using Agrobacterium-mediated genetic transformation technology, thereby enhancing the salt and drought resistance of plants.

Benefits of technology

It has enriched the plant stress resistance gene pool, provided new targets for stress resistance improvement, significantly improved the plant's resistance to drought and salt stress, and promoted the study of the genetic mechanism of stress resistance in stem mustard.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115725575B_ABST
    Figure CN115725575B_ABST
Patent Text Reader

Abstract

This invention discloses a miR204 derived from *Mustela stenoptera* and its applications. The mature sequence of miR204 is shown in SEQ ID NO. 1, and its precursor sequence is shown in SEQ ID NO. 2. This invention is the first to discover *Mustela stenoptera* miR204 and demonstrates through molecular genetic methods that this miRNA not only affects plant resistance to drought but also has a dual function of regulating plant salt tolerance. This research not only enriches the plant stress resistance gene pool and provides a key target gene for plant genetic improvement but also offers a new option for breeding high-quality stress-resistant varieties. It also provides reliable materials and data support for research on the molecular biological mechanisms of enhancing the stress resistance of *Mustela stenoptera*.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and specifically relates to miR204 derived from stem mustard and its applications. Background Technology

[0002] Abiotic stresses pose a severe threat to agriculture in my country during crop cultivation and breeding, with drought and soil salinization being the main factors limiting the sustainable development of Chinese agriculture. 50% of my country's arable land is affected by drought. Even in the relatively rainy Central and Southern China regions, uneven rainfall distribution means that rice crops are affected by drought almost every year during the critical flowering stage, directly impacting yields and sometimes resulting in complete crop failure. Low rainfall in most parts of northern my country exacerbates soil salinization, severely impacting agricultural production, reducing crop yields, and causing significant economic losses. The impacts of drought and soil salinization on crops have become a global concern, and this problem is becoming increasingly serious with the continuous deterioration of the climate. Improving the plant's self-resistance is crucial for yield and quality. Therefore, breeding drought-resistant and salt-tolerant varieties is an effective way to resist adverse environments and ensure yields.

[0003] microRNAs (miRNAs) are a class of endogenous single-stranded non-coding small RNA molecules, approximately 20-24 nt in length, widely distributed in organisms. The discovery of plant miRNAs and their roles in plant growth, development, and stress responses are a major focus of research in plant molecular biology. Numerous studies have found that plant miRNAs primarily achieve their regulatory functions through complete or near-complete complementary pairing with target genes, cleaving them or repressing translation, playing a crucial role in regulating plant growth, development, cell proliferation, and biotic and abiotic stress responses. The impact of miRNAs on plant growth and development under stress is a research hotspot in botany, contributing to a deeper understanding of the nature of gene expression regulation in plants under stress. Currently, the miRBase database has registered over 1160 plant miRNA sequences and related information. However, research on miRNAs has mainly focused on model plants such as Arabidopsis thaliana and rice. Compared to miRNAs, which account for approximately 1% of all genes, only a small fraction have been discovered, meaning that many more miRNAs remain to be discovered. Summary of the Invention

[0004] To address the problems existing in the prior art, the present invention aims to provide a miR204 derived from stem mustard and its application, providing a new target for breeding stem mustard and even new stress-resistant plant varieties, while enriching the miRNA gene library.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: a miR204 derived from stem mustard, the mature sequence of which is shown in SEQ ID NO.1.

[0006] Furthermore, the precursor sequence of miR204 derived from *Strawberry stalk* is shown in SEQ ID NO.2.

[0007] Another object of the present invention is to provide a biological material containing the above-mentioned miR204 or miR204 precursor sequence from *Streptococcus spp.*, wherein the biological material is one or more of a vector, transgenic cell line, engineered bacteria, host cell or expression cassette.

[0008] Another object of the present invention is to provide the application of the above-mentioned miR204 gene or its precursor sequence or the biological material derived from *Strombyx mori* in improving plant stress resistance.

[0009] Another object of the present invention is to provide the application of the above-mentioned miR204 gene or its precursor sequence or the biological material derived from *Strombyx mori* in the selection and breeding of transgenic plants with altered stress resistance.

[0010] Furthermore, the aforementioned resistance refers to resistance to salt and drought stress.

[0011] Another object of the present invention is to provide a method for improving plant stress resistance, the method comprising introducing the biological material into plant cells to increase the expression level of miR204 in the plant.

[0012] Furthermore, the aforementioned resistance refers to resistance to salt and drought stress.

[0013] Furthermore, the plant is a monocotyledonous or dicotyledonous plant; preferably, it is stem mustard, Arabidopsis thaliana, Chinese cabbage, radish, or rapeseed.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] 1. This invention is the first to discover miR204 in *Strombyx mori*, and molecular genetic methods have shown that this miRNA not only affects the plant's resistance to drought but also has a dual function of regulating the plant's salt tolerance. This research not only enriches the plant stress resistance gene pool and provides a key target gene for plant genetic improvement, but also offers a new option for breeding a high-quality stress-resistant new variety.

[0016] 2. This invention is beneficial to promoting research on the genetic mechanism and molecular breeding of stress resistance in stem mustard, and provides reliable materials and data support for research on the molecular biological mechanism of enhancing stress resistance in stem mustard. Attached Figure Description

[0017] Figure 1 A schematic diagram of the secondary structure folding of the miR204 precursor sequence.

[0018] Figure 2 This study presents a semi-quantitative PCR analysis of the miR204 precursor sequence in transgenic plants; WT represents wild-type stem mustard plants, and #1, #4, and #5 represent transgenic stem mustard plants.

[0019] Figure 3 The image shows the phenotypic pattern of the transgenic lines under drought stress; WT represents the wild-type stem mustard line, and #1, #4, and #5 are transgenic stem mustard lines.

[0020] Figure 4 The survival rate of the transgenic lines after drought stress is represented by WT, which represents wild-type stem mustard lines. #1, #4 and #5 are transgenic stem mustard lines, respectively.

[0021] Figure 5 The image shows the phenotypic distribution of transgenic lines under salt stress; WT represents wild-type stem mustard lines, and #4 and #5 represent transgenic stem mustard lines. Detailed Implementation

[0022] The present invention will be further described in detail below with reference to specific embodiments and accompanying drawings, but the scope of protection of the present invention is not limited to the content described herein. Unless otherwise specified, the raw materials mentioned in the embodiments are all commercially available products. The experimental methods described in the embodiments are not specifically described, and are performed according to conventional molecular biology experimental methods.

[0023] In the early stages, the research group screened a novel miRNA in stem mustard through comparative transcriptome sequencing analysis and named it miR204.

[0024] Example 1 miR204 sequence analysis

[0025] The mature sequence of miR204 of the stem-nostoc of the present invention is 21 bp in length and is located on chromosome 01 of group A of stem-nostoc, as shown in SEQ ID NO.1; its precursor sequence is 149 bp in length, as shown in SEQ ID NO.2.

[0026] The secondary structure of the stem mustard miR204 precursor sequence was folded using the online RNAfold software (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi), and secondary structure parameters were used to determine whether they possessed typical stem-loop structure characteristics of miRNAs (miRNA and its complementary strand located on opposite arms, less than four base mismatches between miRNA and its complementary strand, and a folding free energy less than -18 kcal / mol). The study found that... Figure 1 As shown, the miR204 precursor sequence has a typical secondary stem-loop fold structure (the box shows the mature miR204 sequence).

[0027] Example 2 Construction and transformation of recombinant expression vector pTF101-miR204-GFP

[0028] (1) Constructing the pTF101-miR204-GFP expression vector

[0029] The miR204 precursor sequence (SEQ ID NO.2) was extended upwards by 200 bp at both ends to obtain SEQ ID NO.3. Based on SEQ ID NO.3, specific PCR primers miR204-F (forward primer) and miR204-R (reverse primer) were designed to amplify the miR204 precursor sequence.

[0030] The primer sequences are as follows:

[0031] miR204-F: CCCGGG CCAACCATGCATATGGGAAATGG

[0032] miR204-R: GGATCC CGAATATTTGAAGTATGGAAAAC

[0033] In this context, the underlined sequence in miR204-F represents the SmaI restriction site, while the underlined sequence in miR204-R represents the BamHI restriction site.

[0034] PCR reaction system: 0.5 μL of high-fidelity amplification enzyme PrimeSTAR HS (R010A, TaKaRa), 5x PrimeSTAR Buffer (Mg 2+ 10 μL of plasmid (Plex), 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 1 μL of template (50-fold diluted plasmid), 4 μL of dNTP (2.5 mM), and sterile ddH2O to bring the total to 50 μL.

[0035] PCR reaction conditions: pre-denaturation 95℃, 5 min; 95℃, 30 s; 58℃, 30 s; 72℃, 40 s, 35 cycles; 72℃, 10 min.

[0036] The PCR amplification products were detected by agarose gel electrophoresis. The amplified target fragment was the same size as the expected fragment, and was recovered and purified according to the instructions of the gel extraction kit (9672, Takara) to obtain the target gene fragment.

[0037] The pTF101-GFP expression vector was treated with double digestion using SmaI and BamHI. The digestion system was as follows: 5 μL pTF101-GFP vector; 0.5 μL SmaI; 0.5 μL BamHI; 2 μL Buffer 10XK; and sterile ddH2O to a final volume of 20 μL. The reaction was carried out at 37°C for 3 h. After digestion, the pTF101-GFP vector fragment was recovered using a Takara agarose gel extraction kit.

[0038] The pTF101-miR204-GFP expression vector was constructed using T4 DNA Ligase (FL101, Trans).

[0039] The connection reaction system is as follows:

[0040] 50 ng of purified PCR fragment (recovered miR204 target fragment); 100 ng of linearized vector (pTF101-GFP vector); 2 μL of 5x T4 DNA Ligase Buffer; 0.5 μL of T4 DNA Ligase; and sterile ddH2O to a final volume of 10 μL. The reaction was carried out at 25°C for 30 min. Following the molecular cloning guidelines, the recombinant reaction system was transformed into *E. coli* DH5α and plated on a selection plate containing spectinomycin resistance (75 mg / L). Positive clones were sequenced to obtain the correct recombinant expression vector pTF101-miR204-GFP containing the miR204 precursor sequence. In the recombinant expression vector, the reporter gene GFP is fused to the 5' end of the target gene miR204, located downstream of the constitutive promoter P35S, forming a fusion expression. The 3' end of miR204 is equipped with a NOS terminator, which effectively terminates the transcription of the fusion gene. The reporter gene GFP emits green fluorescence upon blue light excitation without the need for cofactors or substrates, and can be used as a reporter gene to detect the expression of target genes.

[0041] (2) Agrobacterium-mediated genetic transformation of stem mustard

[0042] The recombinant expression vector pTF101-miR204-GFP was transformed into Agrobacterium strain GV3101 using a conventional freeze-thaw method, and positive clones were screened by PCR. Then, Agrobacterium carrying the pTF101-miR204-GFP vector was introduced into *Mucor* stem-nourishing mustard using hypocotyl stable genetic transformation. The expression levels of the miR204 gene in the phenotypically well-developed transgenic lines overexpressing miR204 (#1, #4, and #5) compared to the wild type were identified by semi-quantitative RT-PCR. Trizol reagent (Invitrogen) was used to analyze the expression levels. TMTotal RNA was extracted from the leaves of *Strombyx mori* according to the instructions, and then analyzed using DNase I (Invitrogen). TM Remove residual DNA, and synthesize first-strand cDNA using cDNA reverse transcription reagent (Takara) and following the instructions.

[0043] The primers for detecting the target gene are:

[0044] miR204-RT-F: CCAACCATGCATATGGGAAATGG

[0045] miR204-RT-R: CGAATATTTGAAGTATGGAAAAC

[0046] The Arabidopsis thaliana internal control primers are:

[0047] RT-AtACTIN3-F:GGCTACTCTTTCACCACGAC

[0048] RT-AtACTIN3-R:GGATACCAGCATTCTCCATAC

[0049] The results are as follows Figure 2 As shown, the target gene miR204 was upregulated in all three transgenic lines (#1, #4 and #5), while almost no miR204 expression was detected in wild-type plants (WT) (expression level was too low), indicating that miR204 has been introduced into the genome of *Strawberry mustard* and successfully transcribed and expressed.

[0050] Example 3: Observation and Analysis of Drought Resistance Phenotypic Characteristics of Transgenic Stem Mustard

[0051] Wild-type WT seeds and seeds of the obtained transgenic lines #1, #4, and #5 were disinfected, sterilized, and vernalized before germination on water-soaked filter paper. Four days after germination, the seedlings were transferred to saturated pots containing a growing medium (vermiculite: nutrient soil = 3:1) and placed in a plant culture room with a photoperiod of 16h:8h day:night and a temperature of 22℃. When the seedlings reached the three-leaf stage, both transgenic and wild-type *Strombyx mori* plants were subjected to drought stress (i.e., no watering) for 8 days. Plant growth was observed, and phenotypes were analyzed. The plants were then rehydrated, and the number of plants recovering normal growth was observed and counted after 2 days to calculate the survival rate. The transgenic and wild-type plants were each tested in triplicate, with 25 plants from each experimental group subjected to stress treatment. The results are shown below. Figure 3 As shown.

[0052] The results showed that before drought treatment, both the transgenic lines overexpressing miR204 and the wild-type lines grew normally, with no significant differences. Figure 3 a). After drought treatment, wild-type stems were completely unable to stand upright, while the leaves of transgenic lines overexpressing miR204, although wilting, were mostly able to remain upright. Figure 3 b). After rehydration, only a very small number of wild-type plants recovered to normal, while in the transgenic material, only a portion of the plants recovered to normal. Figure 3 c) Calculations showed that approximately 80% or more of the miR204-transgenic stem mustard lines recovered to normal growth. Among them, transgenic lines #1 and #4 both recovered to normal growth, with a survival rate of approximately 100%; while only about 33% of wild-type stem mustard plants survived. Figure 4 This result indicates that overexpression of the miR204 gene in *Strombax cuneata* can significantly improve the plant's drought resistance.

[0053] Example 4: Observation and Analysis of Salt Tolerance Phenotypic Characteristics of Transgenic Stem Mustard

[0054] Wild-type WT seeds and seeds from the obtained transgenic lines #4 and #5 were disinfected, sterilized, and vernalized before germination on water-soaked filter paper. Four days after germination, the seedlings were transferred to pots saturated with a growing medium (vermiculite: nutrient soil = 3:1) and placed in a plant culture chamber with a photoperiod of 16h:8h day:night and a temperature of 22℃. One week later, both wild-type and transgenic seedlings were simultaneously watered with aqueous solutions containing 0 or 200mM NaCl, and plant growth was observed until a difference in growth between the transgenic and wild-type plants became apparent. Results are as follows: Figure 5 As shown.

[0055] The results showed that in the water-only control, there was no significant difference in growth between wild-type and transgenic seedlings; however, under 200 mM NaCl treatment, wild-type plants exhibited leaf yellowing and shedding, stem yellowing, and even death; while transgenic plants retained their seed pods and stems. This indicates that overexpression of miR204 from *Mustela stenoptera* helps improve the survival rate of plants under salt stress.

[0056] The sequences described in the above embodiments are specifically shown below:

[0057] Sequence 1: Mature sequence of SEQ ID NO.1 miR204, 21 bp

[0058] TGAAGGAATAGAGAGTGGAAT

[0059] Sequence 2: Precursor sequence of SEQ ID NO.2 miR204, 149 bp in length

[0060] TGAAGGAATAGAGAGTGGAATTGAGCCAAGGATGACTTGCCGGTTTATATACAATCGGTTCATGAACCATTGTTTTGGTCACATTCTCAGCCCTTTGGTTGTGTCTGGCAAGTTGACCTTGGCTCTGTTTCGTTCTCTATTTCTCCATG

[0061] Sequence 3: SEQ ID NO.3 miR204 precursor sequence and extended sequence, 549 bp in length

[0062] CCAACCATGCATATGGGAAATGGAATCGAAAATAAAATAATATACAAAATCTGTCGCATTTGTATGCCTATAAATACCAATGCATCTCAACTAGGCTTTACCACAACACATGAGTCAAAGAAAGAGAACACATTTGAAATAAGCAGCTCTAGATCGAGAGACAACGATGGGAGTCTCTGGCTGTATCAGAAGGTCTTGCATGAAGGAATAGAGAGTGGAATTGAGCCAAGGATGACTTGCCGGTTTATATACAATCGGTTCATGAACCATTGTTTTGGTCACATTCTCAGCCCTTTGGTTGTGTCTGGCAAGTTGACCTTGGCTCTGTTTCGTTCTCTATTTCTCCATGTTAGATTCCAGATATACGCATACTCATTTAGTCATATCTATTTTCTAGATTTGGTTATGGATGGGATTAACCGATCGTTTGAAACTGTCACGTCCTATGATACTCAAACCCTCCAAGTGATATACATTATATATTTAGATTTTGATGTTTGCTTCATGGTTAGCAACTCAAATATTAGTTTTCCATACTTCAAATATTCG

[0063] Sequence 4: SEQ ID NO.4 miR204-F nucleotide sequence, 29 bp in length

[0064] CCCGGGCCAACCATGCATATGGGAAATGG

[0065] Sequence 5: SEQ ID NO.5 miR204-R nucleotide sequence, 29 bp in length

[0066] GGATCCCGAATATTTGAAGTATGGAAAAC

[0067] Sequence 6: SEQ ID NO.6 miR204-RT-F nucleotide sequence, 23 bp in length.

[0068] CCAACCATGCATATGGGAAATGG

[0069] Sequence 7: SEQ ID NO.7 miR204-RT-R nucleotide sequence, 23 bp in length.

[0070] CGAATATTTGAAGTATGGAAAAC

[0071] Sequence 8: SEQ ID NO.8RT-AtACTIN3-F nucleotide sequence, 20 bp in length.

[0072] GGCTACTCTTTCACCACGAC

[0073] Sequence 9: SEQ ID NO.9RT-AtACTIN3-R nucleotide sequence, 21 bp in length.

[0074] GGATACCAGCATTCTCCATAC

[0075] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. Overexpression of Brassica napus miR204 In use in improving salt tolerance and drought tolerance in Brassica napus, said miR204 The mature sequence of SEQ ID NO. 1 is shown.

2. Overexpression of Brassica juncea miR204 In the breeding of transgenic Brassica juncea with improved salt and drought tolerance, the miR204 The mature sequence of SEQ ID NO. 1 is shown.

3. A method for improving the salt and drought resistance of stem mustard, characterized in that, The method comprises introducing a biomaterial containing the miR204 of S. rosthomii into the cells of S. rosthomii, increasing the expression amount of miR204 in S. rosthomii, and the biomaterial is one or more of a vector, a rhizobium, or an expression cassette. miR204 The mature sequence of miR204 is shown as SEQ ID NO. 1, and the biomaterial is one or more of a vector, a rhizobium, or an expression cassette.