Apis cerana cerana antioxidant gene AccCDK10 and its application

Abstract

This invention discloses an antioxidant gene, AccCDK10, from the Chinese honeybee, and its applications, belonging to the fields of biochemistry and molecular biology. This invention is the first to discover the AccCDK10 gene, which is associated with resistance to oxidative stress, in the Chinese honeybee. It also investigates its specific expression and demonstrates its antioxidant capacity in vitro. This discovery provides a theoretical basis for research on stress resistance in the Chinese honeybee, and is particularly significant for studying the molecular mechanisms of resistance to pesticides and heavy metals, which improves the ability of the honeybee to survive stressful conditions.

Description

Technical Field

[0001] The present invention relates to the technical field of biochemistry and molecular biology, and in particular to an antioxidant gene AccCDK10 of honey bees and an application thereof. Background Art

[0002] Cyclin-dependent kinases (CDKs) are a family of proteins composed of a serine / threonine catalytic core that coordinates cell cycle progression. There are over 20 CDKs, each of which binds to a different cyclin to form a complex. Together with their regulatory factors, they act as cellular engines to directly or indirectly regulate cell cycle progression, playing a role in cell regulation, transcription, differentiation, and death, making them an integral part of the cell cycle.

[0003] CDK10 (cyclin dependent kinase 10) was first discovered in the pre-genomic era. Its research has primarily focused on tumors, often acting as a suppressor. It also plays a crucial role in neural development. CDK10 belongs to the CDK subfamily and is regulated during the G2 / M phase of the cell cycle. Its overexpression can inhibit cell proliferation and regulate cancer cell survival. Existing reports on CDK10 have primarily linked it to cancer.

[0004] Honey bees are important pollinators. The Chinese honey bee (Apis cerana cerana), also known as the Chinese native bee, Chinese honey bee, or native honey bee, is a high-quality bee germplasm resource. Its advantages include strong foraging capacity, adaptability, and resistance to mites, and it has significant economic and social benefits. Crops primarily rely on animals for pollination, and honey bees are the primary pollinators. They are crucial to biodiversity and ecosystems, and are an integral part of nature.

[0005] However, in recent years, the survival of the Chinese honeybee (Apis cerana) has been severely challenged by both biotic and abiotic stressors, leading to a gradual decline in its population. Pesticides and heavy metals in the environment are a major source of these pollutants. Honeybees are exposed to pesticides and heavy metals during foraging and water scavenging, which can lead to oxidative stress caused by these chemicals. Consequently, the effects of pesticides and heavy metals on the Chinese honeybee have become a hot topic of research. Research on the antioxidant capacity of the Chinese honeybee has garnered significant attention, potentially aiding in the improvement and breeding of new species and profoundly impacting the development of honeybee germplasm resources. However, CDK10 has rarely been reported in bees or even insects, and its role in the Chinese honeybee remains largely unexplored. Its function in the Chinese honeybee warrants further investigation. Summary of the Invention

[0006] In response to the above-mentioned prior art, the present invention aims to provide an antioxidant gene AccCDK10 from Apis cerana and its application. The present invention has found that AccCDK10 can serve as a response gene for Apis cerana to resist oxidative stress, providing a theoretical basis for breeding high-quality antioxidant bees and for studying the stress resistance of Apis cerana.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] In a first aspect of the present invention, the use of the AccCDK10 gene or its expression product as a target in the following 1) or 2) is provided:

[0009] 1) Regulate the antioxidant capacity of honey bees under environmental stress conditions;

[0010] 2) Cultivate bee strains with enhanced antioxidant capacity under environmental stress conditions.

[0011] In the above application, the nucleotide sequence of the AccCDK10 gene is shown as SEQ ID No. 1.

[0012] In the above application, the environmental stress conditions include: pesticide stress and heavy metal stress.

[0013] A second aspect of the present invention provides use of a reagent for specifically detecting the AccCDK10 gene in the preparation of a product for detecting the antioxidant capacity of honey bees under environmental stress.

[0014] In the above application, the product uses a real-time fluorescence quantitative PCR method to detect the AccCDK10 gene.

[0015] In the above application, the product includes: a real-time fluorescence quantitative PCR detection kit.

[0016] In the above application, the real-time fluorescence quantitative PCR detection kit contains: a primer pair for specifically detecting the AccCDK10 gene, whose sequences are shown in SEQ ID No. 5 and SEQ ID No. 6.

[0017] A third aspect of the present invention provides use of an agent for silencing AccCDK10 gene expression in constructing a honeybee model with reduced antioxidant capacity.

[0018] In the above application, the reagent includes: a primer pair for amplifying the AccCDK10 gene silencing fragment, the sequences of which are shown as SEQ ID No. 9 and SEQ ID No. 10.

[0019] A fourth aspect of the present invention provides the use of the AccCDK10 gene or its expression product in improving the tolerance of Escherichia coli to pesticides and heavy metals.

[0020] Beneficial effects of the present invention:

[0021] This study, published in the journal Nature Communications, identifies the AccCDK10 gene, a gene associated with oxidative stress resistance, in Apis cerana cerana. The study also explores its specific expression, demonstrating its in vitro antioxidant capacity. This research provides a theoretical basis for studying stress resistance in Apis cerana cerana, and is particularly important for studying the molecular mechanisms of pesticide and heavy metal resistance, which improves survival in stressful environments.

[0022] Silencing the AccCDK10 gene will reduce the honeybee's ability to resist oxidative stress under pesticide and heavy metal stress conditions. If this gene is overexpressed in honeybees or other animals containing homologous genes of this gene, it is expected to improve their resistance to pesticide and heavy metal stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 : Electrophoresis of PCR amplification of AccCDK10 gene.

[0024] In the figure, the marker is DL2000 DNA Marker, and the bands are 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp respectively. Lanes 1-3 are AccCDK10 gene amplification bands. The results are consistent with the predicted band sizes, indicating correct amplification.

[0025] Figure 2 : SDS-polyacrylamide gel electrophoresis of AccCDK10 recombinant protein; M is the protein molecular weight standard; lane 1: uninduced AccCDK10 recombinant protein at 28°C; lanes 2-4: AccCDK10 recombinant protein induced and expressed at 28°C; lane 5: uninduced AccCDK10 recombinant protein at 37°C; lanes 6-8: AccCDK10 recombinant protein induced and expressed at 37°C.

[0026] As can be seen from the figure, after SDS-polyacrylamide gel electrophoresis, the band was consistent with the predicted size, and AccCDK10 was successfully expressed.

[0027] Figure 3Figures 1 and 2 show inhibition zone assays after ligation of the expression vector and survival curves of E. coli cells treated with HgCl2 and cumene hydroperoxide. A: Inhibition zone assay after HgCl2 treatment, with concentrations 1-5 representing HgCl2 from 0 mg / L, 40 mg / L, 60 mg / L, 80 mg / L, and 100 mg / L. B: Inhibition zone assay after cumene hydroperoxide treatment, with concentrations 1-5 representing cumene hydroperoxide from 0 mg / L, 20 mg / L, 40 mg / L, 80 mg / L, and 160 mg / L. C: Survival curves of E. coli cells containing the recombinant AccCDK10 protein and an empty vector in the control group. D: Survival curves of E. coli cells containing the recombinant AccCDK10 protein and an empty vector in HgCl2 treatment. E: Survival curves of E. coli cells containing the recombinant AccCDK10 protein and an empty vector in cumene hydroperoxide treatment.

[0028] As can be seen from the figure, the survival rate of recombinant AccCDK10 is high under the treatment of HgCl2 and cumene hydroperoxide, and AccCDK10 has antioxidant ability.

[0029] Figure 4 : The expression level of AccCDK10 under different pesticide and heavy metal stress conditions. A: The expression level of AccCDK10 under avermectin treatment; B: The expression level of AccCDK10 under cypermethrin treatment; C: The expression level of AccCDK10 under cypermethrin treatment; D: The expression level of AccCDK10 under spirodiclofen treatment; E: The expression level of AccCDK10 under glyphosate isopropylamine treatment; F: The expression level of AccCDK10 under glufosinate treatment; G: The expression level of AccCDK10 under paraquat treatment; H: The expression level of AccCDK10 under fluazifop-ethyl treatment; I: The expression level of AccCDK10 under pyraclostrobin treatment; J: The expression level of AccCDK10 under carbendazim treatment; K: The expression level of AccCDK10 under HgCl2 treatment; L: The expression level of AccCDK10 under CdCl2 treatment.

[0030] As can be seen from the figure, the expression level of AccCDK10 changed significantly under different pesticide and heavy metal stress conditions.

[0031] Figure 5 Figure 3: Phenotypes and mortality of honey bees under glyphosate isopropylamine stress. The first group shows honey bees fed normal sugar water, the second group shows honey bees fed water with glyphosate isopropylamine added after silencing, the third group shows honey bees fed dsRNA-GFP with glyphosate isopropylamine added after silencing, and the fourth group shows honey bees fed double-stranded RNA dsAccCDK10 with glyphosate isopropylamine added after silencing.

[0032] As can be seen from the figure, the AccCDK10 gene plays an important role in the Chinese honeybee's resistance to pesticides and heavy metals.

[0033] Figure 6 : Graphs showing the activities of several antioxidant enzymes, including POD, SOD, and CAT, after silencing the AccCDK10 gene. A: POD activity; B: SOD activity; C: CAT activity.

[0034] As can be seen from the figure, the activities of three enzymes, POD, SOD and CAT, increased after silencing AccCDK10.

[0035] Figure 7 Specific expression profiles of antioxidant-related genes after AccCDK10 silencing. A: AccCAT; B: AccGSTD; C: AccTpx5; D: AccTrx1; E: AccTrx2; F: AccTrxr1. β-actin served as an internal control. Bees fed water and dsRNA-GFP served as controls to analyze enzyme activity after silencing.

[0036] As can be seen from the figure, the expression levels of antioxidant-related genes increased after gene silencing, and AccCDK10 is closely related to antioxidant activity. DETAILED DESCRIPTION

[0037] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.

[0038] As mentioned above, due to the impact of pesticides and heavy metals in the environment, the survival of the Chinese honey bee faces great challenges. How to improve the tolerance of the Chinese honey bee to pesticides and heavy metals is currently an urgent problem to be solved.

[0039] Based on this, the present invention conducted in-depth research on stress resistance genes in the Chinese honey bee, discovering that the AccCDK10 gene is induced to express when exposed to stresses such as pesticides and heavy metals. Silencing the AccCDK10 gene reduced the honey bee's ability to resist oxidative stress. Therefore, the AccCDK10 gene may serve as a response gene for oxidative stress in the Chinese honey bee, and overexpressing the AccCDK10 gene may improve honey bees' tolerance to pesticides and heavy metals.

[0040] The AccCDK10 gene is derived from the Chinese honey bee; the nucleotide sequence of the AccCDK10 gene is shown in SEQ ID No. 1, and the amino acid sequence of the encoded protein is shown in SEQ ID No. 2. Specifically,

[0041] Nucleotide sequence:

[0042]

[0043]

[0044] Amino acid sequence:

[0045]

[0046] Although previous studies have shown that the CDK5 gene in the Chinese honeybee (Apis cerana cerana) plays a role in antioxidant processes, CDK5 is primarily involved in neuronal migration, axon guidance, and synaptic formation and transmission; in contrast, CDK10 primarily plays a role in cell proliferation. CDK10 also regulates the cell cycle, while CDK5 does not. Sequence comparisons of CDK10 and CDK5 revealed a 38.83% similarity. We also investigated several genes in the CDK family, including CDK2 and CDK8, and found no resistance to oxidative stress, suggesting that antioxidant activity is not a common property of the CDK family. Therefore, it is difficult to predict the functions of other CDK family members based on the function of CDK5.

[0047] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below with reference to specific embodiments.

[0048] The test materials used in the examples of the present invention are all conventional test materials in the field and can be purchased through commercial channels. Experimental methods without detailed conditions were carried out according to conventional test methods or the operating instructions recommended by the supplier.

[0049] Example 1: Cloning of the Apis cerana AccCDK10 gene

[0050] The full-length cDNA sequence of AccCDK10 obtained from NCBI was used to design appropriate primers AccCDK10-F and AccCDK10-R as follows:

[0051] AccCDK10-F: ggatccatga caaaagacga aacattagag aa; (SEQ ID No. 3)

[0052] AccCDK10-R: gaattcttca actcgccttt tcttgacaag. (SEQ ID No.4)

[0053] Using reverse transcribed cDNA as a template, the AccCDK10 fragment was amplified by PCR using an appropriate amplification system as follows:

[0054] Pre-denaturation at 94°C for 10 min → (94°C for 50 s, 46°C for 40 s) × 35 cycles → 72°C for 1 min 15 s → 72°C for 10 min.

[0055] The cDNA fragment of AccCDK10 was obtained and stored at -20℃ for future use. The cloning vector was transferred into Trans1-T1 phage-resistant, chemically competent cells. Positive clones were selected for sequencing and comparison. Sequencing confirmed that the cloned gene sequence was consistent with the cDNA fragment of AccCDK10.

[0056] Example 2: Expression of AccCDK10 recombinant protein

[0057] The target gene AccCDK10 fragment was ligated into the prokaryotic expression vector pGEX-4T-3, which contains BamH I and EcoRI restriction enzyme sites, and the recombinant expression plasmid pGEX-4T-3-AccCDK10 was generated using primers AccCDK10-F and AccCDK10-R and transferred into Escherichia coli (DE3) to obtain E. coli containing the recombinant expression plasmid.

[0058] The E. coli containing the recombinant expression plasmid was activated for the second time. Eight tubes were added with 0 μl, 1 μl, 2 μl, and 3 μl of 50 mg / ml IPTG, respectively, and induced in a shaker at 28°C and 37°C for 8 hours. Since the recombinant protein was fused with a 26 kDa GST tag, its size was 72 kDa. The experimental results were consistent with the predicted bands after SDS-polyacrylamide gel electrophoresis ( Figure 2 ), AccCDK10 protein was successfully expressed and used in the inhibition zone experiment.

[0059] Example 3: Inhibition zone experiment

[0060] In order to study the anti-heavy metal and antioxidant properties of AccCDK10 recombinant protein, antibacterial experiments were carried out on Escherichia coli containing the recombinant expression plasmid to verify its antioxidant capacity.

[0061] The IPTG-induced E. coli strains containing recombinant AccCDK10 recombinant protein and empty vector (pGEX-4T-3) were spread on the culture medium, cultured at 37°C for one hour, and filter paper was placed on the upper layer. Different concentrations of HgCl2 (0 mg / L, 40 mg / L, 60 mg / L, 80 mg / L, 100 mg / L) and cumene hydroperoxide (0 mg / L, 20 mg / L, 40 mg / L, 80 mg / L, 160 mg / L) were dropped on the filter paper. After being cultured at 37°C for one night after treatment, the diameter of the inhibition zone of E. coli containing recombinant AccCDK10 was much smaller than that of the control group (E. coli containing the empty vector) ( Figure 3 A and B).

[0062] To further verify the above results, the growth rates of E. coli strains containing the recombinant AccCDK10 protein and the empty vector were measured under HgCl2 and cumene hydroperoxide stress. 10 μl of IPTG-induced E. coli strains containing the recombinant AccCDK10 protein and the empty vector were added to 10 ml of liquid culture medium. The cells were divided into three groups: the first group was not supplemented with any substance, the second group was supplemented with 40 mg / L HgCl2, and the third group was supplemented with 20 mg / L cumene hydroperoxide. Under the stress of HgCl2 and cumene hydroperoxide, the E. coli strains containing the recombinant AccCDK10 protein had a higher survival rate than the E. coli strains containing the empty vector ( Figure 3 CE).

[0063] The experimental results indicate that AccCDK10 may be related to anti-oxidative stress response.

[0064] Example 4: Expression pattern of AccCDK10 under different stress conditions

[0065] Fifteen-day-old worker honeybees were collected and divided into 12 groups of 50 each. They were then treated with different pesticides and heavy metals. Groups 1-4 were fed 20 mg / mL of avermectin, bifenthrin, beta-cypermethrin, and spirodiclofen, respectively; Groups 5-8 were fed 6 μL / mL of glyphosate isopropylamine, glufosinate, paraquat, and beta-cypermethrin, respectively; Groups 9-10 were fed 1 μL / mL of pyraclostrobin and carbendazim, respectively; and Groups 11-12 were fed 3 mg / mL each of HgCl₂ and CdCl₂. The honeybees in the treated and control groups were placed in an incubator for 24 hours. Honeybees were collected at 0, 1, 2, 3, 4, and 5 hours after treatment and immediately snap-frozen in liquid nitrogen for storage at -80°C.

[0066] Total RNA was extracted from Apis cerana cerana samples using RNAiso Plus (TaKaRa, Japan) and stored in a -80°C ultra-low temperature freezer until ready for use. Reverse-transcribed cDNA was used as a template. qRT-PCR was performed using TaKaRa's TB Green™ Premix ExTaq™ (Tli RNaseH Plus) and a Bio-Rad CFX96™ Real-Time System to detect AccCDK10 transcription levels under stress conditions. β-actin (GenBank accession number HM640276.1) was used as an internal reference gene. The primer sequences used for qRT-PCR are as follows:

[0067] qRT-PCR primers for AccCDK10:

[0068] Forward primer: CCATGGTTAAGTGCTGCTGG; (SEQ ID No. 5)

[0069] Reverse primer: TAGTTTCCTTTGGTGGAGCAGC; (SEQ ID No. 6)

[0070] β-actin qRT-PCR primers:

[0071] Forward primer: TTATATGCCAACACTGTCCTTT; (SEQ ID No. 7)

[0072] Reverse primer: AGAATTGATCCACCAATCCA; (SEQ ID No. 8)

[0073] The results are as follows Figure 4 As shown, the experimental results showed that the transcription level of AccCDK10 was affected by pesticide and heavy metal stress conditions, indicating that they may be involved in the antioxidant stress response of Chinese honey bees against multiple stresses.

[0074] Example 5: Effect of silencing AccCDK10 on the survival ability of Apis cerana cerana under pesticide stress

[0075] The AccCDK10 silenced fragment was amplified using PCR technology. The fragment was located at 738-1072 bp in the nucleotide sequence of the AccCDK10 coding region. At the same time, a 500 bp sequence of GFP (GenBank accession number U87974.1) was amplified.

[0076] The primers for amplifying the AccCDK10 silenced fragment are:

[0077] Forward primer: GGATCCTAATACGACTCACTATAGGTGATATGTGGGCTGCAGGTTG; (SEQ ID No. 9)

[0078] Reverse primer: GGATCCTAATACGACTCACTATAGG GATCACATGGCAAAGGAGCTT; (SEQ IDNo.10)

[0079] The primers for amplifying GFP are:

[0080] Forward primer: GGATCCTAATACGACTCACTATAGG AGTGGAGAGGGTGAAGGTGA; (SEQ ID No.11)

[0081] Reverse primer: GGATCCTAATACGACTCACTATAGG GGTAAAAGGACAGGGCCATC; (SEQ ID No. 12)

[0082] The underlined parts in the above four primers are the promoter sequences of T7 RNA polymerase.

[0083] First, we silenced AccCDK10 using RNAi technology to verify that this gene can be silenced. Then, we conducted a formal experiment and re-collected bees and silenced them in groups. The details are as follows:

[0084] AccCDK10 was silenced using dsRNA-mediated RNAi technology, and qRT-PCR was used to detect silencing of the AccCDK10 gene. After successful silencing, Chinese honey bees were randomly collected and divided into four groups of 35 each. Appropriate silencing fragments were designed based on the gene sequence and amplified by PCR. dsRNA was synthesized using the RiboMAX™ Large Scale RNA Production System-T7 kit. The first group was fed double-stranded RNA (dsRNA)-AccCDK10, the second group was fed dsRNA-GFP, the third group was fed water, and the fourth group was fed normal sugar water. The experiment was repeated three times. Twenty-four hours after silencing, the bees were fed 2 μL / mL of 41% glyphosate isopropylamine salt. The survival of the bees was observed and photographed to record the survival.

[0085] The results are as follows Figure 5 As shown, the results showed that after silencing the AccCDK10 gene, the antioxidant capacity of Chinese honeybees decreased after being stressed by pesticides, further proving that the AccCDK10 gene is related to resistance to pesticide oxidative stress.

[0086] Example 6: Antioxidant gene expression profile and enzyme activity determination after AccCDK10 gene knockout

[0087] Apis cerana cerana was randomly collected and divided into three groups of 30 each. Group 1 was fed double-stranded RNA (dsRNA)-AccCDK10, Group 2 was fed dsRNA-GFP, and Group 3 was fed water. Group 1 served as the experimental group, while Groups 2 and 3 served as the control group. After 24 hours of silencing, samples were collected and immediately snap-frozen in liquid nitrogen and stored at -80°C.

[0088] The samples treated with various methods were taken out of liquid nitrogen and ground into powder, and then prepared into 10% tissue homogenate with physiological saline.

[0089] A portion of the tissue homogenate was diluted to 1% tissue homogenate, and the protein concentration of the tissue homogenate was measured using a total protein quantitative test kit (BCA method) produced by Nanjing Jiancheng Company.

[0090] The enzyme activities of POD, CAT and T-SOD were determined using peroxidase (POD) test kit, catalase (CAT) test kit and total superoxide dismutase (T-SOD) test kit produced by Nanjing Jiancheng Company.

[0091] The results are as follows Figure 6 The results showed that the enzyme activities of POD, CAT and T-SOD in the mice fed with double-stranded RNA (dsRNA)-AccCDK10 were lower than those in the control group, indicating that the AccCDK10 gene is related to anti-oxidation.

[0092] RNA was extracted from the above-treated samples and reverse transcribed into cDNA. The transcription levels of antioxidant-related genes AccCAT, AccGSTD, AccTpx5, AccTrx1, AccTrx2, and AccTrxr1 were determined by qRT-PCR. The results are shown in Figure 2. Figure 7 shown.

[0093] Compared with the control group, the expression levels of antioxidant-related genes in the experimental group were generally increased, which further demonstrated that AccCDK10 is closely related to antioxidant activity.

[0094] The above description is merely a preferred embodiment of the present application and is not intended to limit the present application. Various modifications and variations are possible for those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present application shall be included within the scope of protection of the present application.

Claims

1. Application of overexpression of the AccCDK10 gene in improving the tolerance of Escherichia coli to HgCl2 and cumene hydroperoxide; the nucleotide sequence of the AccCDK10 gene is shown in SEQ ID No. 1.

Images