A rare earth-dependent alcohol dehydrogenase mutant and its application

Abstract

The present invention discloses a rare earth-dependent alcohol dehydrogenase mutant and its application, and relates to the field of enzyme engineering technology. The present invention adopts a method combining a deep learning-based MutCompute design tool and an energy function-based FoldX tool to determine the mutation site of the rare earth-dependent alcohol dehydrogenase PedH, and obtains a mutant with a 130%-260% increase in methanol, ethanol or 5-hydroxymethylfurfural activity by screening, wherein the stability of the two mutants is improved at the same time. The present invention is of great significance to the construction of artificial methylotrophic bacteria, the green biomanufacturing of important compounds such as FDCA, and the solution to the problem that high enzyme stability and high activity cannot be taken into account.

Description

Technical Field

[0001] The invention relates to the technical field of enzyme engineering, and in particular to a rare earth-dependent alcohol dehydrogenase mutant and application thereof. Background Art

[0002] In order to obtain enzymes with excellent performance, humans continue to explore and develop methods to transform proteins, such as primary rational design, directed evolution, and semi-rational design. In recent years, with the substantial improvement of computer computing power and the rapid development of structural biology, computational biology, and artificial intelligence technology, computer-aided protein design has received great attention and has become an important new direction in protein engineering. Computational protein design based on structural simulation and energy calculation (such as Rosetta, FoldX, etc.) and machine learning (such as MLDE, Mutcompute, etc.) has achieved remarkable results.

[0003] The oxidation of alcohols to form ketones or aldehydes is an important reaction in organic synthesis. Compared with chemical methods, enzymatic oxidation of alcohols is carried out under mild conditions, without the use of any toxic reagents, and often has higher catalytic specificity and selectivity, with fewer by-products. Therefore, it has always been the first choice for the green oxidation of alcohols. Alcohol dehydrogenases (ADHs) are commonly used oxidases. In 2012, the first rare earth-dependent alcohol dehydrogenase XoxF was discovered and reported. Compared with the calcium-dependent alcohol dehydrogenase that also uses PQQ as a coenzyme, XoxF exhibits higher catalytic activity. Unlike ordinary metal ions, the unique 4f valence electron structure of rare earth elements gives them excellent optical, electrical, magnetic and catalytic properties. The characteristics of rare earth ion electronic transitions, spin coupling and orbital hybridization can provide more possibilities for enzyme engineering.

[0004] A rare earth-dependent alcohol dehydrogenase PedH from Pseudomonas putida can be expressed heterologously and soluble in Escherichia coli, which is convenient for enzyme engineering. Studies have shown that Pseudomonas putida expressing PedH can grow with ethanol as the sole carbon source. In addition, PedH can catalyze methanol to produce formaldehyde, and the oxidation of methanol is a key rate-limiting step in one-carbon metabolism and an indispensable step in natural methylotrophic bacteria and artificial methylotrophic bacteria. With the rapid growth of the world's population and the rapid development of industry, resource shortages and environmental pollution have become huge challenges facing mankind, and green biomanufacturing represented by one-carbon metabolism has received increasing attention. One-carbon compounds such as methanol and methane have become ideal raw materials for green biomanufacturing of bulk chemicals due to their wide sources of raw materials, low prices, and high reducing power.

[0005] PedH can catalyze 5-hydroxymethylfurfural (HMF) to generate 5-hydroxymethyl-2-furancarboxylic acid (HFCA) and further oxidize it to 5-formaldehyde furan-2-carboxylic acid (FFCA). FFCA is the precursor of 2,5-furandicarboxylic acid (FDCA). FDCA is an important bio-based platform compound with the potential to be used as a substitute for terephthalic acid (PTA) in the synthesis of renewable polyethylene 2,5-furandicarboxylate (PEF). It is widely used in the production of a variety of bio-based polymers, such as polyamides, polyesters and polyurethanes.

[0006] However, like most alcohol dehydrogenases, PedH has low activity and stability during catalytic oxidation, which limits its industrial application. Therefore, the method combines the deep learning-based MutCompute design tool and the energy function-based FoldX tool to determine the mutation sites of rare earth-dependent alcohol dehydrogenase PedH, and screens mutants with improved stability and / or increased activity for methanol, ethanol, and 5-hydroxymethylfurfural, which is of great significance. It can promote the development of one-carbon metabolism, improve resource shortages and environmental pollution problems, and advance the research on green biomanufacturing of important compounds such as FDCA. Summary of the invention

[0007] In order to solve the problem of low activity and stability of the original rare earth-dependent alcohol dehydrogenase PedH derived from Pseudomonas putida, the present invention provides a rare earth-dependent alcohol dehydrogenase PedH mutant and application thereof.

[0008] The present invention uses the deep learning-based MutCompute online design tool to predict high-performance mutants of rare earth-dependent alcohol dehydrogenase PedH from Pseudomonasputida (amino acid sequence as shown in SEQ ID NO.1, nucleotide sequence as shown in SEQ ID NO.2), obtains a series of predicted mutants, and uses the FoldX tool based on energy function to calculate the binding free energy change ΔΔG of each predicted mutant. The top 10 mutants with the highest MutCompute prediction scores and the 10 mutants with the lowest ΔΔG calculated by FoldX are selected for site-directed mutagenesis. The 20 mutants are cultured, expressed and purified, and the specific enzyme activity of the mutants to methanol, ethanol and 5-hydroxymethylfurfural is determined using an ELISA instrument, and then the dissolution temperature T of each mutant is determined using a protein stability analyzer. m The values ​​were determined, and by combining mutations, mutants of the rare earth-dependent alcohol dehydrogenase PedH with improved activity and / or stability were finally obtained.

[0009] The mutants are Q207N, H486Y, and Q207N / H486Y. Among them, Q207N means that the amino acid at position 207 is mutated from glutamine to asparagine; H486Y means that the amino acid at position 486 is mutated from histidine to tyrosine; Q207N / H486Y means that the amino acid at position 207 is mutated from glutamine to asparagine and the amino acid at position 486 is mutated from histidine to tyrosine.

[0010] The specific technical solutions are as follows:

[0011] The present invention provides a rare earth-dependent alcohol dehydrogenase mutant, which is obtained by mutating a wild-type alcohol dehydrogenase from Pseudomonas putida. The amino acid sequence of the wild-type alcohol dehydrogenase is shown in SEQ ID NO.1, and the specific mutations are (1) and / or (2):

[0012] (1) The amino acid at position 207 was mutated from glutamine to asparagine;

[0013] (2) The amino acid at position 486 mutated from histidine to tyrosine.

[0014] The present invention also provides the use of the rare earth-dependent alcohol dehydrogenase mutant in catalyzing methanol to generate formaldehyde, catalyzing ethanol to generate acetaldehyde, or catalyzing 5-hydroxymethylfurfural to generate 5-hydroxymethyl-2-furancarboxylic acid.

[0015] The invention also provides a gene encoding the rare earth-dependent alcohol dehydrogenase mutant.

[0016] Preferably, the nucleotide sequence of the gene is shown as SEQ ID NO.7, SEQ ID NO.8 or SEQ ID NO.9.

[0017] The present invention also provides the use of the gene in catalyzing methanol to generate formaldehyde, catalyzing ethanol to generate acetaldehyde, or catalyzing 5-hydroxymethylfurfural to generate 5-hydroxymethyl-2-furancarboxylic acid.

[0018] The present invention also provides an expression vector comprising the gene. The original expression vector of the recombinant vector used in the present invention is pET28a.

[0019] The present invention also provides a genetically engineered bacterium for expressing the rare earth-dependent alcohol dehydrogenase mutant. The host cell of the genetically engineered bacterium used in the present invention is E. coli BL21 (DE3).

[0020] The present invention also provides the use of the genetically engineered bacteria in catalyzing methanol to generate formaldehyde, catalyzing ethanol to generate acetaldehyde, or catalyzing 5-hydroxymethylfurfural to generate 5-hydroxymethyl-2-furancarboxylic acid.

[0021] The present invention also provides a method for preparing formaldehyde, acetaldehyde or 5-hydroxymethyl-2-furancarboxylic acid, using the rare earth-dependent alcohol dehydrogenase mutant to catalyze the oxidation reaction of methanol, ethanol or 5-hydroxymethylfurfural to prepare formaldehyde, acetaldehyde or 5-hydroxymethyl-2-furancarboxylic acid.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] (1) The present invention is based on a rare earth-dependent alcohol dehydrogenase, uses the MutCompute online design tool based on deep learning and the FoldX tool based on energy function to predict the sites to be mutated, and screens mutants with improved activity and / or stability, solving the problem that high stability and high activity cannot be taken into account at the same time. Among them, the specific enzyme activities of mutants Q207N, H486Y and combined mutants Q207N / H486Y for ethanol are 2.4, 2.6, and 3.6 times that of the original enzyme PedH, respectively, and the specific enzyme activities for methanol are 2.3, 2.8, and 3.6 times that of the original enzyme PedH, respectively, and the specific enzyme activities for 5-hydroxymethylfurfural are 2.3, 2.6, and 2.8 times that of the original enzyme PedH, respectively. Among them, the mutant H486Y and the combined mutant Q207N / H486Y have improved specific enzyme activities and improved stability, and the melting temperature Tm values ​​are increased by 2.3°C and 2.2°C respectively compared with the original enzyme PedH.

[0024] (2) The rational design method used in the present invention, which combines the MutCompute design tool and the FoldX tool, can quickly obtain highly stable and highly active rare earth-dependent alcohol dehydrogenase mutants through screening with a smaller mutation library. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the SDS-PAGE image of PedH protein expression and purification; from left to right: M: Maker, 1: ultrafiltrate, 2: eluent, 3: flow-through, 4: supernatant.

[0026] Figure 2 The comparative enzyme activities of wild-type PedH and Q207N, H486Y, and Q207N / H486Y mutants against three substrates.

[0027] Figure 3 T for wild-type PedH and Q207N, H486Y, and Q207N / H486Y mutants m Value graph. DETAILED DESCRIPTION

[0028] Reagents used in upstream genetic engineering: E. coli BL21 (DE3), plasmid pET28a, etc. used in the examples of the present invention were purchased from Novagen; gene synthesis, primer synthesis and sequence sequencing of PedH were completed by Qingke Biotechnology Co., Ltd.

[0029] Reagents used in the catalytic reaction: methanol, ethanol, Tris and hydrochloric acid were purchased from Sinopharm Chemical Reagent Co., Ltd.; PQQ (pyrroloquinoline quinone) was purchased from TCI (Shanghai) Chemical Industry Development Co., Ltd.; praseodymium chloride and 5-hydroxymethylfurfural were purchased from Aladdin Reagent (Shanghai) Co., Ltd.; DCPIP (2,6-dichlorophenol indophenol) was purchased from Shanghai MacLean Biochemical Technology Co., Ltd.; PES (phenazine ethyl sulfate) was purchased from Shanghai En Chemical Technology Co., Ltd.

[0030] Definition of enzyme activity unit (U): the amount of enzyme required to consume 1 μM DCPIP in the reaction system per minute.

[0031] Example 1

[0032] Construction of recombinant bacteria producing original rare earth-dependent alcohol dehydrogenase.

[0033] The gene sequence of the original rare earth-dependent alcohol dehydrogenase (amino acid sequence as shown in SEQ ID NO.1) was commissioned to Qingke Bioengineering Co., Ltd., and the sequence was shown in SEQ ID NO.2, and inserted into the restriction sites BamHI and Hind III of the vector pET28a to obtain the recombinant plasmid pET28a-PedH. The recombinant plasmid was transformed into E.co, iBL21 (DE3) competent cells by heat shock method, and the original rare earth-dependent alcohol dehydrogenase recombinant bacteria was obtained after sequencing verification.

[0034] Example 2

[0035] Design of mutation sites in rare earth-dependent alcohol dehydrogenase.

[0036] The high-performance mutants of PedH were predicted using the deep learning-based MutCompute online design tool (https: / / mutcompute.com / ). Specifically, after logging in to the website to register as a user, enter the PDB number of PedH (6zcw), click Predict, and obtain a series of predicted mutants. Then, the FoldX tool based on the energy function was used to calculate the binding free energy change ΔΔG of each predicted mutant. Combining the MutCompute prediction score and the ΔΔG value calculated by FoldX, two potential mutation sites were screened.

[0037] Example 3

[0038] Construction of rare earth-dependent alcohol dehydrogenase mutants.

[0039] Primers were designed based on the mutants obtained in Example 2 to perform site-directed mutagenesis on PedH.

[0040] The specific method is as follows:

[0041] 1. Whole plasmid PCR

[0042] Using pET28a-PedH plasmid as template, upstream and downstream primers covering the mutation site were designed (Table 1) for whole plasmid PCR.

[0043] Table 1 Primers used for site-directed mutagenesis construction

[0044] Primer name Primer sequence (5' to 3') Q207N-F TAATGCATATAATCCGGAAAATGGTGAACTGC Q207N-R CCGGATTATATGCATTAATTTTACCAACAACACCAAATTCA H486Y-F GAAGTTTGGCGTTATAAAAATTATGCACCGCTGTGG H486Y-R TTATAACGCCAAACTTCTTTACCGCTAACCGG

[0045] PCR amplification system:

[0046] DNA polymerase 25 μL,

[0047] Upstream primer (10 μM) 1 μL,

[0048] Downstream primer (10μM) 1μL,

[0049] Template (5ng / μL) 1μL,

[0050] ddH2O 22μL.

[0051] PCR amplification conditions:

[0052] 1) Pre-denaturation: 98℃ for 3min;

[0053] 2) Denaturation: 98°C 10s; annealing: 60°C 15s; extension: 72°C 1min; 33 cycles in total;

[0054] 3) Post-extension: 72°C for 5 min;

[0055] 4) Store at 4℃.

[0056] 2. Conversion and verification

[0057] The PCR product was directly transformed into E. coli BL21 (DE3) competent cells by the heat shock method. After sequencing verification, rare earth-dependent alcohol dehydrogenase mutant strains were obtained, which were named mutant strain Q207N (the nucleotide sequence encoding the rare earth-dependent alcohol dehydrogenase mutant is shown in SEQ ID NO.7), mutant strain H486Y (the nucleotide sequence encoding the rare earth-dependent alcohol dehydrogenase mutant is shown in SEQ ID NO.8) and mutant strain Q207N / H486Y (the nucleotide sequence encoding the rare earth-dependent alcohol dehydrogenase mutant is shown in SEQ ID NO.9).

[0058] Example 4

[0059] Strain culture, protein expression and purification.

[0060] The recombinant bacteria (original rare earth-dependent alcohol dehydrogenase recombinant bacteria and rare earth-dependent alcohol dehydrogenase mutant strains) sequenced correctly in Example 3 were picked and placed in 5 mL LB liquid medium (containing 50 μg / mL kanamycin) and cultured at 37° C. for 12 h. The inoculum was transferred to 50 mL LB liquid medium containing 50 μg / mL kanamycin and 10 g / L α-lactose at a 2% inoculum size and cultured at 30° C. for 12 h.

[0061] After the culture is completed, the bacterial solution is centrifuged at 4000×g for 15 minutes at 4°C, the supernatant is discarded, and the bacteria are collected. After washing the bacteria with 100mM Tris-HCl buffer, pH 8.0, it is resuspended in Tris-HCl buffer and placed in an ice water bath for ultrasonic cell disruption until clarified. The cell lysate is centrifuged at 8000×g for 20 minutes at 4°C, and the supernatant is subjected to affinity chromatography using a nickel column. The impurities are washed with a washing buffer (100mM Tris-HCl buffer, 150mM NaCl, 50mM imidazole, pH 8.0), and the target protein is eluted with an elution buffer (100mMTris-HCl buffer, 150mM NaCl, 250mM imidazole, pH 8.0). The separated target protein is placed in an ultrafiltration centrifuge tube for sufficient desalting and concentration to obtain a pure target protein. SDS-PAGE detection is as shown below. Figure 1 There are obvious protein bands between 55 kDa and 70 kDa in lane 1 (ultrafiltrate), lane 2 (elution) and lane 4 (supernatant), which is consistent with the theoretical protein molecular weight of PedH (63.0 kDa), indicating that PedH was successfully purified.

[0062] Example 5

[0063] Enzyme activity assay of rare earth-dependent alcohol dehydrogenase.

[0064] The amount of DCPIP consumed in the reaction system was quantitatively analyzed by an ELISA instrument, and the specific enzyme activities of the original rare earth-dependent alcohol dehydrogenase and the rare earth-dependent alcohol dehydrogenase mutants on the substrates methanol, ethanol and 5-hydroxymethylfurfural were calculated. The reaction system contained an appropriate amount of enzyme solution, 1.5μM PQQ, 1.5μM PrCl3, 15mM substrate, and the total system was 200μL. The reaction medium was Tris-HCl buffer (100mM, pH 8.0), which contained 1mM PES and 150μM DCPIP. The specific enzyme activity determination results are shown in Figure 2, the specific enzyme activities of mutants Q207N, H486Y and combined mutants Q207N / H486Y on the three substrates were significantly improved compared with the original enzyme PedH. The specific enzyme activities of the original enzyme PedH on ethanol, methanol and 5-hydroxymethylfurfural were 0.433U / mg, 0.088U / mg and 0.053U / mg, respectively. The specific enzyme activities of mutants Q207N, H486Y and combined mutants Q207N / H486Y on ethanol were 2.4, 2.6 and 3.6 times that of the original enzyme PedH, respectively, and the specific enzyme activities on methanol were 2.3, 2.8 and 3.6 times that of the original enzyme PedH, respectively, and the specific enzyme activities on 5-hydroxymethylfurfural were 2.3, 2.6 and 2.8 times that of the original enzyme PedH, respectively.

[0065] Example 6

[0066] Rare earth-dependent alcohol dehydrogenase T m Value determination.

[0067] The enzyme concentrations of the original rare earth-dependent alcohol dehydrogenase and the rare earth-dependent alcohol dehydrogenase mutants were uniformly adjusted to 10 μM and added to a high-precision quartz glass capillary set. The T was measured using a protein stability analyzer (Prometheus NT.Plex). m The results are shown in Figure 3 It can be seen that the melting temperature T of mutant Q207N and wild-type PedH is m There was no significant difference in the values, but the stability of mutant H486Y and combined mutant Q207N / H486Y was improved, and the melting temperature T m The values ​​were 2.3℃ and 2.2℃ higher than those of wild-type PedH (63.7℃), respectively.

Claims

1. A rare earth-dependent alcohol dehydrogenase mutant, characterized in that: The wild-type alcohol dehydrogenase from Pseudomonas putida is mutated, the amino acid sequence of the wild-type alcohol dehydrogenase is shown in SEQ ID NO.1, and the specific mutations are (1) and / or (2): (1) The amino acid at position 207 was mutated from glutamine to asparagine; (2) The amino acid at position 486 mutated from histidine to tyrosine.

2. Use of the rare earth-dependent alcohol dehydrogenase mutant according to claim 1 in catalyzing the oxidation of methanol, ethanol or 5-hydroxymethylfurfural.

3. A gene encoding the rare earth-dependent alcohol dehydrogenase mutant according to claim 1.

4. The gene according to claim 3, characterized in that The nucleotide sequence of the gene is shown as SEQ ID NO.7, SEQ ID NO.8 or SEQ ID NO.

9.

5. Use of the gene as claimed in claim 3 in catalyzing the oxidation of methanol, ethanol or 5-hydroxymethylfurfural.

6. An expression vector comprising the gene according to claim 3.

7. A genetically engineered bacterium expressing the rare earth-dependent alcohol dehydrogenase mutant of claim 1.

8. Use of the genetically engineered bacteria as claimed in claim 7 in catalyzing the oxidation of methanol, ethanol or 5-hydroxymethylfurfural.

Images