A method for constructing a recombinant Bacillus subtilis expressing MTSase and MTHase ​​in a heterologous manner and its application

Abstract

The present invention relates to a construction method and application of a recombinant Bacillus subtilis expressing MTSase and MTHase ​​in a heterologous homologous manner, and belongs to the technical field of genetic engineering and fermentation engineering. The present invention adopts a multi-site genome integration method of Bacillus subtilis to construct a four-site integrated recombinant strain of amyE, lacA, lipA, and eglS, which can effectively improve the expression of maltooligosaccharide-based trehalose synthase MTSase in Bacillus subtilis, and simultaneously realize the homologous expression of maltooligosaccharide-based trehalose synthase MTSase and maltooligosaccharide-based trehalose hydrolase MTHase ​​in Bacillus subtilis, and perform a dual enzyme conversion method to produce trehalose.

Description

Technical Field

[0001] The invention relates to a construction method and application of a recombinant Bacillus subtilis expressing MTSase and MTHase ​​in a heterologous manner, belonging to the technical field of genetic engineering and fermentation engineering. Background Art

[0002] Trehalose is a non-reducing disaccharide formed by two glucose molecules connected by 1,1-glycosidic bonds. Trehalose is widely used in food, cosmetics, medicine and other industries because of its moderate sweetness, stable nature, difficulty in decomposition, non-reducing nature and protective effect on biological macromolecules.

[0003] The main ways of producing trehalose include phosphorylase method, trehalose synthase method and double enzyme method. Among them, the double enzyme method uses maltodextrin or starch saccharification liquid as substrate, maltodextrin is catalyzed by maltooligosaccharide trehalose synthase (MTSase) to produce maltooligosaccharide trehalose, and maltooligosaccharide trehalose is catalyzed by maltooligosaccharide trehalose hydrolase (MTHase) to produce trehalose. The double enzyme method has the characteristics of low production cost, high conversion rate, and easy separation and extraction of products, and has received widespread attention. At present, the endotoxin content of trehalose produced in China is relatively high, which limits the application of trehalose in food and medicine. Bacillus subtilis is a food safety strain that does not produce endotoxins. However, the heterologous expression of maltooligosaccharide trehalose synthase and maltooligosaccharide trehalose hydrolase in Bacillus subtilis is relatively low, which limits the application of Bacillus subtilis in trehalose production.

[0004] In order to improve the expression of MTSase and MTHase ​​in Bacillus subtilis, the present invention improves the gene copy number through multi-site integration, further improves the expression of MTSase and MTHase; at the same time, MTSase and MTHase ​​are heterologously expressed in Bacillus subtilis, thereby reducing the production cost of MTSase and MTHase. Summary of the invention

[0005] In view of the deficiencies in the prior art, the present invention provides a method for constructing a recombinant Bacillus subtilis that heterologously expresses MTSase and MTHase ​​and its application.

[0006] The technical solution of the present invention is as follows:

[0007] A method for constructing a recombinant Bacillus subtilis that heterologously expresses MTSase and MTHase ​​comprises the following steps:

[0008] Step 1: Construction of the Bacillus subtilis amyE site integration plasmid pDG-amyE-P 43 -MTSase-amyE, including the following steps:

[0009] (1) Using the Bacillus subtilis genome as a template, PCR amplified the constitutive promoter P 43 Gene fragments;

[0010] (2) Using the genome of Sulfolobus acidocaldarius ATCC 33909 as a template, PCR amplified the maltooligosyltrehalose synthase MTSase gene fragment;

[0011] (3) Using pDG1730 plasmid as template, inverse PCR amplification was performed to obtain the pDGamyE linearized vector gene fragment;

[0012] (4) Using seamless cloning technology, the promoter P in step (1) was cloned into 43 The gene fragment, the maltooligosaccharide trehalose synthase MTSase gene fragment in step (2), and the pDGamyE linearized vector gene fragment in step (3) are connected together to obtain the Bacillus subtilis amyE site integration plasmid pDG-amyE-P 43 -MTSase-amyE.

[0013] Step 2: Construction of the Bacillus subtilis lacA site integration plasmid pDG-lacA-P 43 -MTSase-Cm-lacA, comprising the following steps:

[0014] ①Using the Bacillus subtilis genome as a template, PCR amplified the lacA upstream homology arm gene fragment;

[0015] ②Using the Bacillus subtilis genome as a template, PCR amplified the lacA downstream homology arm gene fragment;

[0016] ③ pDG-amyE-P 43 -MTSase-amyE plasmid was used as template and PCR amplified P 43 -MTSase gene fragment;

[0017] ④Using pHT01 plasmid as template, PCR amplification was performed to obtain the chloramphenicol Cm resistance gene fragment;

[0018] ⑤Using pDG1730 plasmid as template, inverse PCR amplification was performed to obtain the pDGlacA linearized vector gene fragment;

[0019] ⑥Use seamless cloning technology to clone the lacA upstream homology arm gene fragment in step ① and the P 43-MTSase gene fragment, the chloramphenicol Cm resistance gene fragment in step ④, the lacA downstream homology arm gene fragment in step ②, and the pDGlacA linearized vector gene fragment in step ⑤ are connected together to obtain the Bacillus subtilis lacA site integration plasmid pDG-lacA-P 43 -MTSase-Cm-lacA.

[0020] Step 3: Construction of Bacillus subtilis lipA site integration plasmid pDG-lipA-P 43 -MTSase-Em-lipA, comprising the following steps:

[0021] [1] Using the Bacillus subtilis genome as a template, PCR amplified the lipA upstream homology arm gene fragment;

[0022] [2] Using the Bacillus subtilis genome as a template, PCR amplified the lipA downstream homology arm gene fragment;

[0023] [3] using pDG-lacA-P 43 -MTSase-Cm-lacA plasmid was used as template and PCR amplified P 43 -MTSase gene fragment;

[0024] [4] Using the pMAD plasmid as a template, PCR amplification was performed to obtain the erythromycin Em resistance gene fragment;

[0025] [5] Using pDG1730 plasmid as template, inverse PCR amplification was performed to obtain the linearized vector gene fragment of pDGlipA;

[0026] [6] Using seamless cloning technology, the lipA upstream homology arm gene fragment in step [1] and the P in step [3] were cloned into 43 -MTSase gene fragment, the erythromycin Em resistance gene fragment in step [4], the lipA downstream homology arm gene fragment in step [2], and the pDGlipA linearized vector gene fragment in step [5] are connected together to obtain the Bacillus subtilis lipA site integration plasmid pDG-lipA-P 43 -MTSase-Em-lipA.

[0027] Step 4: Construction of Bacillus subtilis eglS site integration plasmid pDG-eglS-P 43 -MTHase-Km-eglS, comprising the following steps:

[0028] A. Using the Bacillus subtilis genome as a template, PCR amplified the gene fragment of the upstream homology arm of eglS;

[0029] B. Using the Bacillus subtilis genome as a template, PCR amplified the gene fragment of the downstream homology arm of eglS;

[0030] C with pHT01-P 43 -MTHase ​​plasmid was used as template to amplify P 43 -MTHase ​​gene fragment;

[0031] D. Using pMA5 plasmid as template, PCR amplification was performed to obtain the kanamycin Km resistance gene fragment;

[0032] E. Using pDG1730 plasmid as template, inverse PCR amplification was performed to obtain the linearized vector gene fragment of pDGeglS;

[0033] F used seamless cloning technology to clone the eglS upstream homology arm gene fragment in step A and the P in step C. 43 -MTHase ​​gene fragment, kanamycin Km resistance gene fragment in step D, eglS downstream homology arm gene fragment in step B, and pDGeglS linearized vector gene fragment in step E are connected together to obtain Bacillus subtilis eglS site integration plasmid pDG-eglS-P 43 -MTHase-Km-eglS.

[0034] Step 5: Construction of the Bacillus subtilis amyE site-integrated strain Bacillus subtilis / amyE::P 43 -MTSase:

[0035] The pDG-amyE-P constructed in step 1 was 43 The -MTSase-amyE plasmid was transformed into B. subtilis WB800N to generate the amyE single-site integration strain B. subtilis WB800n / amyE::P 43 -MTSase;

[0036] Step 6: Construction of amyE and lacA double-site integration strain Bacillus subtilis / amyE::P 43 -MTSase / lacA::P 43 -MTSase:

[0037] The pDG-lacA-P constructed in step 2 was 43 -MTSase-Cm-lacA plasmid was transformed into B. subtilis WB800n / amyE::P 43 -MTSase was used to generate the amyE and lacA double-site integration strain B. subtilis WB800n / amyE::P43 -MTSase / lacA::P 43 -MTSase;

[0038] Step 7: Construction of amyE, lacA and lipA site-integrated strain Bacillus subtilis / amyE::P 43 -MTSase / lacA::P 43 -MTSase / lipA::P 43 -MTSase:

[0039] Step 3 to construct pDG-lipA-P 43 -MTSase-Em-lipA plasmid was transformed into B. subtilis WB800n / amyE::P 43 -MTSase / lacA::P 43 -MTSase was used to prepare the amyE, lacA, and lipA three-site integration strain B. subtilis WB800n / amyE::P 43 -MTSase / lacA::P 43 -MTSase / lipA::P 43 -MTSase;

[0040] Step 8: Construction of the Bacillus subtilis amyE, lacA, lipA and eglS four-site integration strain Bacillus subtilis / amyE::P 43 -MTSase / lacA::P 43 -MTSase / lipA::P 43 -MTSase / eglS::P 43 -MTHase:

[0041] The pDG-eglS-P constructed in step 4 was 43 -MTHase-Km-eglS plasmid was transformed into B. subtilis WB800n / amyE::P 43 -MTSase / lacA::P 43 -MTSase / lipA::P 43 -MTSase was used to prepare the amyE, lacA, lipA, and eglS four-site integration strain B. subtilis WB800n / amyE::P 43 -MTSase / lacA::P 43 -MTSase / lipA::P 43 -MTSase / eglS::P43 -MTHase, namely, recombinant Bacillus subtilis expressing MTSase and MTHase ​​heterologously.

[0042] According to the present invention, preferably: in step (1), the promoter P 43 The nucleotide sequences of the PCR amplification primers for the gene fragment are as follows:

[0043] P 43 -F: 5'-GATCG GATCC AGCTTCGTGCATGCAGGC-3′;

[0044] P 43 -MTSase-R: 5'-CTGATATCATGTGTACATTCCTCTCTTACCTATAATGG-3';

[0045] Preferably, according to the present invention, the nucleotide sequence of the PCR amplification primer for the maltooligosyltrehalose synthase MTSase gene fragment in step (2) is as follows:

[0046] MTSase-P 43 -F:5'-GAATGTACACATGATATCAGCAACCTACAGATTACA-3';

[0047] MTSase-R: 5'- GAATTC TTAGTGGTGGTGGTGGTGGTGCATTCTAACTAGTATCCTAG G-3';

[0048] Preferably, according to the present invention, the nucleotide sequence of the PCR amplification primers for the pDGamyE linearized vector gene fragment in step (3) is as follows:

[0049] pDG-F: 5'-CACCACCACCACCACCACTAA GGATTCC TGCAGCCCTGGC-3′;

[0050] pDG-R:5'-GCACGAAGCT GGATCC GATCAGACCAGTTTTTAAT-3′;

[0051] According to the present invention, preferably: the nucleotide sequence of the PCR amplification primer for the lacA upstream homology arm gene fragment in step ① is as follows:

[0052] lacA-Front-F: 5'-TTCAAGAATTTGTGATGTCAAAGCTTGAAAAAAC-3';

[0053] lacA-Front-R: 5'-GCACGAAGCTGTTATGCCAATTGACCGCG-3';

[0054] Preferably according to the present invention, the nucleotide sequence of the PCR amplification primer for the lacA downstream homology arm gene fragment in step ② is as follows:

[0055] lacA-Back-F: 5'-AATAACTTAACGGACAGCGTTCTCTATTTCCAAT-3';

[0056] lacA-Back-R: 5'-GCAGACAATATAATGTGTGTTTACGACAATTCT-3';

[0057] According to the preferred embodiment of the present invention, in step ③, P 43 The nucleotide sequences of the PCR amplification primers for the -MTSase gene fragment are as follows:

[0058] P 43 -MTSase-F1: 5'-TTGGCATAACAGCTTCGTGCATGCAGGC-3';

[0059] MTSase-P 43 -R1: 5'-TCACGACGTTTTAGGTGGTGGTGGTGGTGGTGCATTCTAACTAGTATCCTAGG-3';

[0060] Preferably according to the present invention, the nucleotide sequence of the PCR amplification primers for the chloramphenicol Cm resistance gene fragment in step ④ is as follows:

[0061] Cm-F: 5'-CCACCACTAAAACGTCGTGACTGGGAAAACCCTGGC-3';

[0062] Cm-R: 5'-ACGCTGTCCGTTAAGTTATTGGTATGACTGGTTTTAAG-3';

[0063] Preferably, according to the present invention, the nucleotide sequence of the PCR amplification primers for the pDGlacA linearized vector gene fragment in step ⑤ is as follows:

[0064] pDGlacA-F: 5'-ACACACATTAATTGTCTGCATTTGCGCCGG-3';

[0065] pDGlacA-R: 5'-TGACATCACAAATTCTTGAAGACGAAAGGGC-3';

[0066] According to the preferred embodiment of the present invention, the nucleotide sequence of the PCR amplification primer for the lipA upstream homology arm gene fragment in step [1] is as follows:

[0067] lipA-Front-F: 5'-TTCAAGAATTTTCATCTGTGCCATACGACAG-3';

[0068] lipA-Front-R: 5'-GCACGAAGCTCGCCATCTTTCTGATCGTC-3';

[0069] Preferably, according to the present invention, the nucleotide sequence of the PCR amplification primer for the lacA downstream homology arm gene fragment in step [2] is as follows:

[0070] lipA-Back-F: 5'-TTTTTGTGAAGCGAACAACGTGGATATTATGGC-3';

[0071] lipA-Back-R: 5'-GCAGACAATATTTGAATAAGAATCATGATCTCACCT-3';

[0072] According to the preferred embodiment of the present invention, in step [3] 43 The nucleotide sequences of the PCR amplification primers for the -MTSase gene fragment are as follows:

[0073] P 43 -MTSase-F2: 5'-AAAGATGGCGAGCTTCGTGCATGCAGGC-3';

[0074] MTSase-P 43 -R2: 5'-TTTAACGACTTTAGTGGTGGTGGTGGTGGTGCATTCTAACTAGTATCCTAGG-3';

[0075] Preferably, according to the present invention, the nucleotide sequence of the PCR amplification primers for the erythromycin Em resistance gene fragment in step [4] is as follows:

[0076] Em-F: 5'-CCACCACTAAAGTCGTTAAAACCGTGTGCTCT-3';

[0077] Em-R: 5'-CGTTGTTCGCTTCACAAAAAATAGGCACACGAAAA-3';

[0078] Preferably, according to the present invention, the nucleotide sequence of the PCR amplification primers for the pDGlipA linearized vector gene fragment in step [5] is as follows:

[0079] pDGlipA-F: 5'-CTTATTCAAATATTGTCTGCATTTGCGCCGG-3';

[0080] pDGlipA-R: 5'-CACAGATGAAAATTCTTGAAGACGAAAGGGC-3';

[0081] According to the present invention, preferably, the nucleotide sequence of the PCR amplification primer for the eglS upstream homology arm gene fragment in step A is as follows:

[0082] eglS-Front-F: 5'-TTCAAGAATTCTTTCATCGCAGTCGCAA-3';

[0083] eglS-Front-R: 5'-GCACGAAGCTCACGGACGGGTTGTCAATAT-3';

[0084] Preferably according to the present invention, the nucleotide sequence of the PCR amplification primer for the eglS downstream homology arm gene fragment in step B is as follows:

[0085] eglS-Back-F: 5'-GGGGATTTTAAAAGATAAACCCACACAGGAAAA-3';

[0086] eglS-Back-R: 5'-GCAGACAATAAAATCGCTTTTTTATTTTGTTGCTGA-3';

[0087] According to a preferred embodiment of the present invention, in step C, P 43 The nucleotide sequences of the PCR amplification primers for the -MTHase ​​gene fragment are as follows:

[0088] P 43 -MTHase-F: 5'-CCCGTCCGTGAGCTTCGTGCATGCAGGC-3';

[0089] MTHase-P 43 -R: 5'-TTCAATCCTTTTATCAGTGGTGGTGGTGGTGGTGTTCTAATTGAT ATACC-3';

[0090] Preferably according to the present invention, the nucleotide sequence of the PCR amplification primers for the kanamycin Km resistance gene fragment in step D is as follows:

[0091] Km-F: 5'-ACCACTGATAAAAGGATTGAAGGATGCTTAGGA-3';

[0092] Km-R: 5'-GTTTATCTTTTAAAATCCCCTTTCATTTTCTAATGTAAATCT-3';

[0093] Preferably, according to the present invention, the nucleotide sequence of the PCR amplification primers for the pDGeglS linearized vector gene fragment in step E is as follows:

[0094] pDGeglS-F: 5'-AAAGCGATTTTATTGTCTGCATTTGCGCCGG-3';

[0095] pDGeglS-R: 5'-GCGATGAAAGAATTCTTGAAGACGAAAGGGC-3';

[0096] Preferably according to the present invention, the PCR amplification system in step 1 is as follows:

[0097] 10μmol / L upstream primer 2.5μL, 10μmol / L downstream primer 2.5μL, gene template 2.5μL, 2×PhantaMax Master Mix 25μL, add ddH2O to 50μL;

[0098] The amplification procedure is as follows:

[0099] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; extension at 72°C for 5 min.

[0100] The 72°C extension of 30 sec / kb refers to the amplification speed of DNA polymerase at 72°C of 30 sec / kb. Due to the different lengths of the amplified genes, the amplification is performed for 30 cycles and the extension time at 72°C is different.

[0101] Preferably, according to the present invention, the integration plasmid construction method in step 1 is as follows, with a total volume of 20 μL:

[0102] 0.03 pmol of each gene fragment obtained by PCR amplification, 0.03 pmol of linearized vector gene fragment obtained by reverse PCR amplification, 4 μL 5×CE MultiS Buffer, 2 μL Exnase MultiS, add ddH2O to 20 μL; place the reaction system at 37°C for 30 min, transform the obtained recombinant product into Escherichia coli, and obtain the integrated plasmid after successful identification and correct sequencing.

[0103] According to the preferred embodiment of the present invention, in step 5, the pDG-amyE-P constructed in step 1 is 43 -MTSase-amyE plasmid was transferred into B.subtilis WB800N and integrated into the amyE site in the genome. After screening, the amyE single-site integrated recombinant strain B.subtilis WB800N / amyE::P 43 -MTSase.

[0104] Further preferably, the screening is to spread the transformants on an LB plate containing 100 μg / mL spectinomycin resistance, culture at 37°C for 12 h, pick the transformants on the spectinomycin resistance LB plate with a toothpick, inoculate them into LB liquid culture medium containing 100 μg / mL spectinomycin resistance, culture at 37°C for 12 h, perform colony PCR amplification verification using the bacterial liquid as a template, obtain the corresponding target band through agarose gel electrophoresis, and obtain positive transformants.

[0105] Preferably according to the present invention, the PCR amplification system in step 2 is as follows:

[0106] 10μmol / L upstream primer 2.5μL, 10μmol / L downstream primer 2.5μL, gene template 2.5μL, 2×PhantaMax Master Mix 25μL, add ddH2O to 50μL;

[0107] The amplification procedure is as follows:

[0108] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; extension at 72°C for 5 min.

[0109] The 72°C extension of 30 sec / kb refers to the amplification speed of DNA polymerase at 72°C of 30 sec / kb. Due to the different lengths of the amplified genes, the amplification is performed for 30 cycles and the extension time at 72°C is different.

[0110] Preferably, according to the present invention, the integration plasmid construction method in step 2 is as follows, with a total volume of 20 μL:

[0111] 0.03 pmol of each gene fragment obtained by PCR amplification, 0.03 pmol of linearized vector gene fragment obtained by reverse PCR amplification, 4 μL 5×CE MultiS Buffer, 2 μL Exnase MultiS, add ddH2O to 20 μL; place the reaction system at 37°C for 30 min; transform the obtained recombinant product into Escherichia coli, and obtain the integrated plasmid after successful identification and correct sequencing.

[0112] According to the preferred embodiment of the present invention, in step 6, the pDG-lacA-P constructed in step 2 is 43 -MTSase-Cm-lacA plasmid was transformed into B. subtilis WB800N / amyE::P 43 -MTSase was integrated into the lacA site in the genome, and after screening, the amyE and lacA double-site integrated recombinant strain B. subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43 -MTSase.

[0113] Further preferably, the screening is to spread the transformants on an LB plate containing 15 μg / mL chloramphenicol resistance, culture at 37°C for 12 h, pick the transformants on the chloramphenicol resistance LB plate with a toothpick, inoculate them into LB liquid culture medium containing 15 μg / mL chloramphenicol resistance, culture at 37°C for 12 h, perform colony PCR amplification verification using the bacterial liquid as a template, obtain the corresponding target band by agarose gel electrophoresis, and obtain the positive transformant.

[0114] Preferably according to the present invention, the PCR amplification system in step 3 is as follows:

[0115] 10μmol / L upstream primer 2.5μL, 10μmol / L downstream primer 2.5μL, gene template 2.5μL, 2×PhantaMax Master Mix 25μL, add ddH2O to 50μL;

[0116] The amplification procedure is as follows:

[0117] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; extension at 72°C for 5 min.

[0118] The 72°C extension of 30 sec / kb refers to the amplification speed of DNA polymerase at 72°C of 30 sec / kb. Due to the different lengths of the amplified genes, the amplification is performed for 30 cycles and the extension time at 72°C is different.

[0119] Preferably, according to the present invention, the integration plasmid construction method in step 3 is as follows, with a total volume of 20 μL:

[0120] 0.03 pmol of each gene fragment obtained by PCR amplification, 0.03 pmol of linearized vector gene fragment obtained by reverse PCR amplification, 4 μL 5×CE MultiS Buffer, 2 μL Exnase MultiS, add ddH2O to 20 μL; place the reaction system at 37°C for 30 min, transform the obtained recombinant product into Escherichia coli, and obtain the integrated plasmid after successful identification and correct sequencing.

[0121] Preferably, in step 7, the pDG-lipA-P constructed in step 3 is 43 -MTSase-Em-lipA plasmid was transformed into B. subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43 -MTSase was integrated into the lipA site in the genome, and after screening, the amyE, lacA, and lipA three-site integrated recombinant strain B. subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43 -MTSase / lipA::P 43 -MTSase.

[0122] Further preferably, the screening is to spread the transformants on an LB plate containing 5 μg / mL erythromycin resistance, culture at 37°C for 12 hours, pick the transformants on the LB plate with erythromycin resistance with a toothpick, inoculate them into LB liquid culture medium containing 5 μg / mL erythromycin resistance, culture at 37°C for 12 hours, perform colony PCR amplification verification using the bacterial liquid as a template, obtain the corresponding target band through agarose gel electrophoresis, and obtain the positive transformants.

[0123] Preferably according to the present invention, the PCR amplification system in step 4 is as follows:

[0124] 10μmol / L upstream primer 2.5μL, 10μmol / L downstream primer 2.5μL, gene template 2.5μL, 2×PhantaMax Master Mix 25μL, add ddH2O to 50μL;

[0125] The amplification procedure is as follows:

[0126] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; extension at 72°C for 5 min.

[0127] The 72°C extension of 30 sec / kb refers to the amplification speed of DNA polymerase at 72°C of 30 sec / kb. Due to the different lengths of the amplified genes, the amplification is performed for 30 cycles and the extension time at 72°C is different.

[0128] Preferably, according to the present invention, the integration plasmid construction method in step 4 is as follows, with a total volume of 20 μL:

[0129] 0.03 pmol of each gene fragment obtained by PCR amplification, 0.03 pmol of linearized vector gene fragment obtained by reverse PCR amplification, 4 μL 5×CE MultiS Buffer, 2 μL Exnase MultiS, add ddH2O to 20 μL; place the reaction system at 37°C for 30 min, transform the obtained recombinant product into Escherichia coli, and obtain the integrated plasmid after successful identification and correct sequencing.

[0130] Preferably, in step 8, the pDG-eglS-P constructed in step 4 is 43 -MTHase-Km-eglS plasmid was transformed into B. subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43 -MTSase / lipA::P 43 -MTSase was integrated into the eglS site in the genome, and after screening, the amyE, lacA, lipA, and eglS four-site integrated recombinant strain B. subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43 -MTSase / lipA::P 43 -MTSase / eglS::P 43 -MTHase.

[0131] Further preferably, the screening is to spread the transformants on an LB plate containing 100 μg / mL kanamycin resistance, culture at 37°C for 12 h, pick the transformants on the kanamycin resistance LB plate with a toothpick, inoculate them into LB liquid culture medium containing 100 μg / mL kanamycin resistance, culture at 37°C for 12 h, perform colony PCR amplification verification using the bacterial liquid as a template, obtain the corresponding target band through agarose gel electrophoresis, and obtain positive transformants.

[0132] The heterologous recombinant Bacillus subtilis expressing MTSase and MTHase ​​constructed according to the above method is used in the fermentation production of trehalose.

[0133] Beneficial effects:

[0134] The present invention adopts the method of multi-site genome integration of Bacillus subtilis to construct amyE, lacA, lipA, eglS four-site integration type recombinant strain, which can effectively improve the expression of maltooligosaccharide trehalose synthase MTSase in Bacillus subtilis, and realize the homologous expression of maltooligosaccharide trehalose synthase MTSase and maltooligosaccharide trehalose hydrolase MTHase ​​in Bacillus subtilis, and carry out double enzyme conversion method to produce trehalose. Through actual fermentation, it is found that MTSase and MTHase ​​are heterologously expressed in Bacillus subtilis, and the optimal catalytic ratio of MTSase and MTHase ​​is achieved, and trehalose is converted and produced, and the conversion rate of trehalose is increased to 79.7%. BRIEF DESCRIPTION OF THE DRAWINGS

[0135] Figure 1 P 43 -MTSase gene fragment (a), lacA-P 43 -MTSase-Cm-lacA gene fragment (b), lipA-P 43 -MTSase-Em-lipA gene fragment (c), eglS-P 43 -Agarose gel electrophoresis of the MTHase-Km-eglS gene fragment (d). Specific implementation methods

[0136] The technical scheme of the present invention is further described below in conjunction with the embodiments, but the protection scope of the present invention is not limited thereto. The reagents, plasmids and drugs involved in the embodiments are all common commercially available products unless otherwise specified. The steps and methods involved in the embodiments are all conventional operations in the art unless otherwise specified.

[0137] The Bacillus subtilis genomes involved in the examples are all extracted from Bacillus subtilis WB800N according to conventional methods, and Bacillus subtilis genomes extracted from other Bacillus subtilis may also be used.

[0138] Example 1: Construction of recombinant plasmid

[0139] 1. amyE site integration plasmid pDG-amyE-P 43 -MTSase-amyE construct

[0140] (1) Cloning the constitutive promoter P 43 Gene fragment

[0141] Using the Bacillus subtilis genome as a template, primers were designed for PCR amplification of promoter P 43 Gene fragments;

[0142] The promoter P43 The nucleotide sequences of the PCR amplification primers for the gene fragment are as follows:

[0143] P 43 -F: 5'-GATCG GATCC AGCTTCGTGCATGCAGGC-3′;

[0144] P 43 -MTSase-R: 5'-CTGATATCATGTGTACATTCCTCTCTTACCTATAATGG-3';

[0145] The PCR amplification reaction system is as follows:

[0146] 10 μmol / L upstream primer P 43 -F 2.5μL, 10μmol / L downstream primer P 43 -MTSase-R 2.5μL, genomic template 2.5μL, 2×Phanta Max Master Mix 25μL, make up to 50μL with ddH2O;

[0147] The above PCR amplification reaction was carried out according to the following procedure:

[0148] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 15 sec, 30 cycles; extension at 72°C for 5 min;

[0149] (2) Cloning of the gene fragment of maltooligosaccharide-trehalose synthase MTSase

[0150] Using the genome of Sulfolobus acidocaldarius ATCC 33909 as a template, primers were designed to amplify the gene fragment of maltooligosyltrehalose synthase MTSase by PCR.

[0151] The nucleotide sequence of the PCR amplification primer of the maltooligosaccharide-trehalose synthase MTSase gene fragment is as follows:

[0152] MTSase-P 43 -F:5'-GAATGTACACATGATATCAGCAACCTACAGATTACA-3';

[0153] MTSase-R: 5'- GAATTC TTAGTGGTGGTGGTGGTGGTGCATTCTAACTAGTATCCTAG G-3';

[0154] The PCR amplification reaction system is as follows:

[0155] 10 μmol / L upstream primer MTSase-P 43 -F 2.5μL, 10μmol / L downstream primer MTSase-R 2.5μL, genomic template 2.5μL, 2×Phanta Max Master Mix 25μL, make up to 50μL with ddH2O;

[0156] The above PCR amplification reaction was carried out according to the following procedure:

[0157] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 1 min 10 sec, 30 cycles; extension at 72°C for 5 min;

[0158] (3) Cloning the pDGamyE linearized vector gene fragment

[0159] Using pDG1730 plasmid as template, primers were designed for inverse PCR amplification of the pDGamyE linearized vector gene fragment;

[0160] The nucleotide sequence of the reverse PCR amplification primer of the pDGamyE linearized vector gene fragment is as follows:

[0161] pDG-F: 5'-CACCACCACCACCACCACTAA GGATTCC TGCAGCCCTGGC-3′;

[0162] pDG-R:5'-GCACGAAGCT GGATCC GATCAGACCAGTTTTTAAT-3′;

[0163] The reverse PCR amplification reaction system is as follows:

[0164] 10 μmol / L upstream primer pDG-F 2.5 μL, 10 μmol / L downstream primer pDG-R 2.5 μL, pDG1730 plasmid template 2.5 μL, 2×Phanta Max Master Mix 25 μL, make up to 50 μL with ddH2O;

[0165] The above-mentioned reverse PCR amplification reaction was carried out according to the following procedure:

[0166] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 3 min 40 sec, 30 cycles; extension at 72°C for 5 min;

[0167] (4) Using seamless cloning technology, 0.03 pmol of promoter P was added 43 gene fragment, 0.03 pmol maltooligosaccharide-trehalose synthase MTSase gene fragment, 0.03 pmol pDGamyE linearized vector gene fragment, 4 μL 5×CE MultiS Buffer, 2 μL Exnase MultiS, add ddH2O to 20 μL; place the reaction system at 37°C for 30 min, transform the obtained recombinant product into Escherichia coli, and after successful identification and sequencing, the obtained amyE site integration plasmid is named pDG-amyE-P 43 -MTSase-amyE, where P 43 The nucleotide sequence of -MTSase is shown in SEQ ID NO.1.

[0168] 2. lacA site integration plasmid pDG-lacA-P 43 -MTSase-Cm-lacA construction

[0169] (1) Cloning the lacA upstream homology arm gene fragment

[0170] Using the Bacillus subtilis genome as a template, primers were designed to amplify the lacA upstream homology arm gene fragment by PCR;

[0171] The nucleotide sequence of the PCR amplification primer of the lacA upstream homology arm gene fragment is as follows:

[0172] lacA-Front-F: 5'-TTCAAGAATTTGTGATGTCAAAGCTTGAAAAAAC-3';

[0173] lacA-Front-R: 5'-GCACGAAGCTGTTATGCCAATTGACCGCG-3';

[0174] The PCR amplification reaction system is as follows:

[0175] 10 μmol / L upstream primer lacA-Front-F 2.5 μL, 10 μmol / L downstream primer lacA-Front-R 2.5 μL, genomic template 2.5 μL, 2×Phanta Max Master Mix 25 μL, make up to 50 μL with ddH2O;

[0176] The above PCR amplification reaction was carried out according to the following procedure:

[0177] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 30 sec, 30 cycles; extension at 72°C for 5 min;

[0178] (2) Cloning the lacA downstream homology arm gene fragment

[0179] Using the Bacillus subtilis genome as a template, primers were designed to amplify the lacA downstream homology arm gene fragment by PCR;

[0180] The nucleotide sequence of the PCR amplification primer of the lacA downstream homology arm gene fragment is as follows:

[0181] lacA-Back-F: 5'-AATAACTTAACGGACAGCGTTCTCTATTTCCAAT-3';

[0182] lacA-Back-R: 5'-GCAGACAATATAATGTGTGTTTACGACAATTCT-3';

[0183] The PCR amplification reaction system is as follows:

[0184] 10 μmol / L upstream primer lacA-Back-F 2.5 μL, 10 μmol / L downstream primer lacA-Back-R 2.5 μL, genomic template 2.5 μL, 2×Phanta Max Master Mix 25 μL, make up to 50 μL with ddH2O;

[0185] The above PCR amplification reaction was carried out according to the following procedure:

[0186] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 30 sec, 30 cycles; extension at 72°C for 5 min;

[0187] (3) Cloning P 43 -MTSase gene fragment

[0188] pDG-amyE-P 43 -MTSase-amyE plasmid was used as template and primers were designed for PCR amplification. 43 -MTSase gene fragment;

[0189] The P 43 The nucleotide sequences of the PCR amplification primers for the -MTSase gene fragment are as follows:

[0190] P 43-MTSase-F1: 5'-TTGGCATAACAGCTTCGTGCATGCAGGC-3';

[0191] MTSase-P 43 -R1: 5'-TCACGACGTTTTAGGTGGTGGTGGTGGTGGTGCATTCTAACTAGTATCCTAGG-3';

[0192] The PCR amplification reaction system is as follows:

[0193] 10 μmol / L upstream primer P 43 -MTSase-F1 2.5μL, 10μmol / L downstream primer MTSase-P 43 -R1 2.5 μL, pDG-amyE-P 43 -MTSase-amyE plasmid template 2.5 μL, 2×Phanta Max Master Mix 25 μL, make up to 50 μL with ddH2O;

[0194] The above PCR amplification reaction was carried out according to the following procedure:

[0195] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 1 min 20 sec, 30 cycles; extension at 72°C for 5 min;

[0196] (4) Cloning of the chloramphenicol Cm resistance gene fragment

[0197] Using pHT01 plasmid as template, primers were designed to amplify the chloramphenicol Cm resistance gene fragment by PCR;

[0198] The nucleotide sequence of the PCR amplification primer of the chloramphenicol Cm resistance gene fragment is as follows:

[0199] Cm-F: 5'-CCACCACTAAAACGTCGTGACTGGGAAAACCCTGGC-3';

[0200] Cm-R: 5'-ACGCTGTCCGTTAAGTTATTGGTATGACTGGTTTTAAG-3';

[0201] The PCR amplification reaction system is as follows:

[0202] 10μmol / L upstream primer Cm-F 2.5μL, 10μmol / L downstream primer Cm-R 2.5μL, pHT01 plasmid template 2.5μL, 2×Phanta Max Master Mix 25μL, make up to 50μL with ddH2O;

[0203] The above PCR amplification reaction was carried out according to the following procedure:

[0204] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 45 sec, 30 cycles; extension at 72°C for 5 min;

[0205] (5) Clone the pDGlacA linearized vector gene fragment

[0206] Using pDG1730 plasmid as template, primers were designed for inverse PCR amplification of pDGlacA linearized vector gene fragment;

[0207] The nucleotide sequences of the PCR amplification primers for the pDGlacA linearized vector gene fragment are as follows:

[0208] pDGlacA-F: 5'-ACACACATTAATTGTCTGCATTTGCGCCGG-3';

[0209] pDGlacA-R: 5'-TGACATCACAAATTCTTGAAGACGAAAGGGC-3';

[0210] The PCR amplification reaction system is as follows:

[0211] 10 μmol / L upstream primer pDGlacA-F 2.5 μL, 10 μmol / L downstream primer pDGlacA-R 2.5 μL, pDG1730 plasmid template 2.5 μL, 2×Phanta Max Master Mix 25 μL, make up to 50 μL with ddH2O;

[0212] The above PCR amplification reaction was carried out according to the following procedure:

[0213] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 2 min 20 sec, 30 cycles; extension at 72°C for 5 min;

[0214] (6) Using seamless cloning technology, 0.03 pmol of lacA upstream homology arm gene fragment and 0.03 pmol of P 43-MTSase gene fragment, 0.03pmol chloramphenicol Cm resistance gene fragment, 0.03pmol lacA downstream homology arm gene fragment, 0.03pmol pDGlacA linearized vector gene fragment, 4μL 5×CE MultiS Buffer, 2μL Exnase MultiS, add ddH2O to 20μL; place the reaction system at 37℃ for 30min, transform the obtained recombinant product into Escherichia coli, and after successful identification and sequencing, the obtained lacA site integration plasmid is named pDG-lacA-P 43 -MTSase-Cm-lacA, where lacA-P 43 The nucleotide sequence of -MTSase-Cm-lacA is shown in SEQ ID NO.2.

[0215] 3. Integration of plasmid pDG-lipA-P at lipA site 43 -MTSase-Em-lipA construction

[0216] (1) Cloning the lipA upstream homology arm gene fragment

[0217] Using the Bacillus subtilis genome as a template, primers were designed to amplify the lipA upstream homology arm gene fragment by PCR;

[0218] The nucleotide sequence of the PCR amplification primer of the lipA upstream homology arm gene fragment is as follows:

[0219] lipA-Front-F: 5'-TTCAAGAATTTTCATCTGTGCCATACGACAG-3';

[0220] lipA-Front-R: 5'-GCACGAAGCTCGCCATCTTTCTGATCGTC-3';

[0221] The PCR amplification reaction system is as follows:

[0222] 10 μmol / L upstream primer lipA-Front-F 2.5 μL, 10 μmol / L downstream primer lipA-Front-R 2.5 μL, genomic template 2.5 μL, 2×Phanta Max Master Mix 25 μL, make up to 50 μL with ddH2O;

[0223] The above PCR amplification reaction was carried out according to the following procedure:

[0224] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 30 sec, 30 cycles; extension at 72°C for 5 min;

[0225] (2) Cloning the lipA downstream homology arm gene fragment

[0226] Using the Bacillus subtilis genome as a template, primers were designed to amplify the lipA downstream homology arm gene fragment by PCR;

[0227] The nucleotide sequence of the PCR amplification primer of the lipA downstream homology arm gene fragment is as follows:

[0228] lipA-Back-F: 5'-TTTTTGTGAAGCGAACAACGTGGATATTATGGC-3';

[0229] lipA-Back-R: 5'-GCAGACAATATTTGAATAAGAATCATGATCTCACCT-3';

[0230] The PCR amplification reaction system is as follows:

[0231] 10 μmol / L upstream primer lipA-Back-F 2.5 μL, 10 μmol / L downstream primer lipA-Back-R 2.5 μL, genomic template 2.5 μL, 2×Phanta Max Master Mix 25 μL, make up to 50 μL with ddH2O;

[0232] The above PCR amplification reaction was carried out according to the following procedure:

[0233] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 30 sec, 30 cycles; extension at 72°C for 5 min;

[0234] (3) Cloning P 43 -MTSase gene fragment

[0235] pDG-lacA-P 43 -MTSase-Cm-lacA plasmid was used as template and primers were designed for PCR amplification. 43 -MTSase gene fragment;

[0236] The P 43 The nucleotide sequences of the PCR amplification primers for the -MTSase gene fragment are as follows:

[0237] P 43-MTSase-F2: 5'-AAAGATGGCGAGCTTCGTGCATGCAGGC-3';

[0238] MTSase-P 43 -R2: 5'-TTTAACGACTTTAGTGGTGGTGGTGGTGGTGCATTCTAACTAGTATCCTAGG-3';

[0239] The PCR amplification reaction system is as follows:

[0240] 10 μmol / L upstream primer P 43 -MTSase-F2 2.5μL, 10μmol / L downstream primer MTSase-P 43 -R2 2.5 μL, pDG-lacA-P 43 -MTSase-Cm-lacA plasmid template 2.5 μL, 2×Phanta Max Master Mix 25 μL, make up to 50 μL with ddH2O;

[0241] The above PCR amplification reaction was carried out according to the following procedure:

[0242] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 1 min 20 sec, 30 cycles; extension at 72°C for 5 min;

[0243] (3) Cloning of the erythromycin Em resistance gene fragment

[0244] Using pMAD plasmid as template, primers were designed to amplify the erythromycin Em resistance gene fragment by PCR;

[0245] The nucleotide sequence of the PCR amplification primer of the erythromycin Em resistance gene fragment is as follows:

[0246] Em-F: 5'-CCACCACTAAAGTCGTTAAAACCGTGTGCTCT-3';

[0247] Em-R: 5'-CGTTGTTCGCTTCACAAAAAATAGGCACACGAAAA-3';

[0248] The PCR amplification reaction system is as follows:

[0249] 10 μmol / L upstream primer Em-F 2.5 μL, 10 μmol / L downstream primer Em-R 2.5 μL, pMAD plasmid template 2.5 μL, 2×Phanta Max Master Mix 25 μL, make up to 50 μL with ddH2O;

[0250] The above PCR amplification reaction was carried out according to the following procedure:

[0251] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 45 sec, 30 cycles; extension at 72°C for 5 min;

[0252] (5) Clone the pDGlipA linearized vector gene fragment

[0253] Using pDG1730 plasmid as template, primers were designed for inverse PCR amplification of the pDGlipA linearized vector gene fragment;

[0254] The nucleotide sequence of the PCR amplification primer of the pDGlipA linearized vector gene fragment is as follows:

[0255] pDGlipA-F: 5'-CTTATTCAAATATTGTCTGCATTTGCGCCGG-3';

[0256] pDGlipA-R: 5'-CACAGATGAAAATTCTTGAAGACGAAAGGGC-3';

[0257] The PCR amplification reaction system is as follows:

[0258] 10 μmol / L upstream primer pDGlipA-F 2.5 μL, 10 μmol / L downstream primer pDGlipA-R 2.5 μL, pDG1730 plasmid template 2.5 μL, 2×Phanta Max Master Mix 25 μL, make up to 50 μL with ddH2O;

[0259] The above PCR amplification reaction was carried out according to the following procedure:

[0260] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 2 min 30 sec, 30 cycles; extension at 72°C for 5 min;

[0261] (6) Using seamless cloning technology, 0.03 pmol of lipA upstream homology arm gene fragment and 0.03 pmol of P 43-MTSase gene fragment, 0.03pmol erythromycin Em resistance gene fragment, 0.03pmol lipA downstream homology arm gene fragment, 0.03pmol pDGlipA linearized vector gene fragment, 4μL 5×CE MultiS Buffer, 2μL Exnase MultiS, add ddH2O to 20μL; place the reaction system at 37℃ for 30min, transform the obtained recombinant product into Escherichia coli, and after successful identification and sequencing, the obtained lipA site integration plasmid is named pDG-lipA-P 43 -MTSase-Em-lipA, where lipA-P 43 The nucleotide sequence of -MTSase-Em-lipA is shown in SEQ ID NO.3.

[0262] 4. eglS site integration plasmid pDG-eglS-P 43 -MTHase-Km-eglS construction

[0263] (1) Cloning the eglS upstream homology arm gene fragment

[0264] Using the Bacillus subtilis genome as a template, primers were designed to amplify the eglS upstream homology arm gene fragment by PCR;

[0265] The nucleotide sequences of the PCR amplification primers for the eglS upstream homology arm gene fragment are as follows:

[0266] eglS-Front-F: 5'-TTCAAGAATTCTTTCATCGCAGTCGCAA-3';

[0267] eglS-Front-R: 5'-GCACGAAGCTCACGGACGGGTTGTCAATAT-3';

[0268] The PCR amplification reaction system is as follows:

[0269] 10 μmol / L upstream primer eglS-Front-F 2.5 μL, 10 μmol / L downstream primer eglS-Front-R 2.5 μL, genomic template 2.5 μL, 2×Phanta Max Master Mix 25 μL, make up to 50 μL with ddH2O;

[0270] The above PCR amplification reaction was carried out according to the following procedure:

[0271] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 30 sec, 30 cycles; extension at 72°C for 5 min;

[0272] (2) Cloning the gene fragment of the downstream homology arm of eglS

[0273] Using the Bacillus subtilis genome as a template, primers were designed to amplify the eglS downstream homology arm gene fragment by PCR;

[0274] The nucleotide sequences of the PCR amplification primers for the eglS downstream homology arm gene fragment are as follows:

[0275] eglS-Back-F: 5'-GGGGATTTTAAAAGATAAACCCACACAGGAAAA-3';

[0276] eglS-Back-R: 5'-GCAGACAATAAAATCGCTTTTTTATTTTGTTGCTGA-3';

[0277] The PCR amplification reaction system is as follows:

[0278] 10 μmol / L upstream primer eglS-Back-F 2.5 μL, 10 μmol / L downstream primer eglS-Back-R 2.5 μL, genomic template 2.5 μL, 2×Phanta Max Master Mix 25 μL, make up to 50 μL with ddH2O;

[0279] The above PCR amplification reaction was carried out according to the following procedure:

[0280] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 30 sec, 30 cycles; extension at 72°C for 5 min;

[0281] (3) Cloning P 43 -MTHase ​​gene fragment

[0282] pHT01-P 43 -MTHase ​​plasmid as template, and primers were designed for PCR amplification P 43 -MTHase ​​gene fragment;

[0283] The P 43 The nucleotide sequences of the PCR amplification primers for the -MTHase ​​gene fragment are as follows:

[0284] P 43-MTHase-F: 5'-CCCGTCCGTGAGCTTCGTGCATGCAGGC-3';

[0285] MTHase-P 43 -R: 5'-TTCAATCCTTTTATCAGTGGTGGTGGTGGTGGTGTTCTAATTGAT ATACC-3';

[0286] The PCR amplification reaction system is as follows:

[0287] 10 μmol / L upstream primer P 43 -MTHase-F 2.5μL, 10μmol / L downstream primer MTHase-P 43 -R 2.5 μL, pHT01-P 43 -MTHase ​​plasmid template 2.5 μL, 2×Phanta Max Master Mix 25 μL, make up to 50 μL with ddH2O;

[0288] The above PCR amplification reaction was carried out according to the following procedure:

[0289] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 1 min 20 sec, 30 cycles; extension at 72°C for 5 min;

[0290] (4) Cloning of the kanamycin Km resistance gene fragment

[0291] Using pMA5 plasmid as template, primers were designed to amplify the kanamycin Km resistance gene fragment by PCR;

[0292] The nucleotide sequence of the PCR amplification primer of the kanamycin Km resistance gene fragment is as follows:

[0293] Km-F: 5'-ACCACTGATAAAAGGATTGAAGGATGCTTAGGA-3';

[0294] Km-R: 5'-GTTTATCTTTTAAAATCCCCTTTCATTTTCTAATGTAAATCT-3';

[0295] The PCR amplification reaction system is as follows:

[0296] 10 μmol / L upstream primer Km-F 2.5 μL, 10 μmol / L downstream primer Km-R 2.5 μL, pMA5 plasmid template 2.5 μL, 2×Phanta Max Master Mix 25 μL, make up to 50 μL with ddH2O;

[0297] The above PCR amplification reaction was carried out according to the following procedure:

[0298] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 45 sec, 35 cycles; extension at 72°C for 5 min;

[0299] (5) Cloning the pDGeglS linearized vector gene fragment

[0300] Using pDG1730 plasmid as template, primers were designed for inverse PCR amplification of the pDGeglS linearized vector gene fragment;

[0301] The nucleotide sequences of the PCR amplification primers for the pDGeglS linearized vector gene fragment are as follows:

[0302] pDGeglS-F: 5'-AAAGCGATTTTATTGTCTGCATTTGCGCCGG-3';

[0303] pDGeglS-R: 5'-GCGATGAAAGAATTCTTGAAGACGAAAGGGC-3';

[0304] The PCR amplification reaction system is as follows:

[0305] 10 μmol / L upstream primer pDGeglS-F 2.5 μL, 10 μmol / L downstream primer pDGeglS-R 2.5 μL, pDG1730 plasmid template 2.5 μL, 2×Phanta Max Master Mix 25 μL, make up to 50 μL with ddH2O;

[0306] The above PCR amplification reaction was carried out according to the following procedure:

[0307] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 2 min 30 sec, 30 cycles; extension at 72°C for 5 min;

[0308] (6) Using seamless cloning technology, 0.03 pmol of eglS upstream homology arm gene fragment and 0.03 pmol of P 43-MTHase ​​gene fragment, 0.03pmol kanamycin Km resistance gene fragment, 0.03pmol eglS downstream homology arm gene fragment, 0.03pmol pDGeglS linearized vector gene fragment, 4μL 5×CE MultiS Buffer, 2μL ExnaseMultiS, add ddH2O to 20μL; place the reaction system at 37℃ for 30min, transform the obtained recombinant product into Escherichia coli, and after successful identification and sequencing, the obtained eglS site integration plasmid is named pDG-eglS-P 43 -MTHase-Km-eglS, where eglS-P 43 The nucleotide sequence of -MTHase-Km-eglS is shown in SEQ ID NO.4.

[0309] Example 2: Preparation of B. subtilis WB800N competent cells

[0310] Pick a single colony of B. subtilis WB800N on the surface of fresh LB solid medium and place it in 5 mL LB liquid medium for 12 h. Take 1 mL of the culture that has been cultured for 12 h and inoculate it into 50 mL GM medium (GM medium: LB + 0.5 M sorbitol) and culture at 37 °C with shaking until OD 600 1.0. Place the bacterial solution in an ice-water bath for 10 minutes, centrifuge at 5000 rpm and 4°C for 8 minutes to collect the bacterial cells; resuspend the bacterial cells in 20 mL of pre-cooled ETM medium (ETM medium: 0.5 M sorbitol + 0.5 M mannitol + 10% glycerol), centrifuge at 5000 rpm and 4°C for 8 minutes, remove the supernatant, and wash three times; resuspend the washed bacterial cells in 500 μL of ETM medium to obtain B. subtilis WB800N competent cells, and dispense them into EP tubes, 60 μL per tube.

[0311] Embodiment 3:

[0312] The amyE site prepared in Example 1 was integrated into the plasmid pDG-amyE-P 43 -MTSase-amyE was transferred into the B. subtilis WB800N competent cells prepared in Example 2 to obtain the amyE single-site integrated recombinant bacteria B. subtilis WB800N / amyE::P 43 -MTSase, the specific method is:

[0313] 6 μL pDG-amyE-P 43-MTSase-amyE plasmid was added to 60 μL B.subtilis WB800N competent cells, incubated on ice for 5 min, added to a pre-cooled electroporation cup (2 mm), and electroporated at 2500 V and 5 ms. After the electroporation, 1 mL of RM medium (RM medium: LB + 0.5 M sorbitol + 0.38 M mannitol) preheated at 37°C was immediately added to the electroporation cup, shaken and revived at 37°C for 3 h, spread on an LB plate containing 100 μg / mL spectinomycin, inverted and cultured at 37°C for 12 h, and transformants on the spectinomycin-resistant LB plate were picked up with a toothpick and inoculated into LB liquid culture medium containing 100 μg / mL spectinomycin resistance, respectively, and cultured at 37°C for 12 h. Colony PCR amplification was performed using the bacterial solution as a template for verification, and the corresponding target bands were obtained by agarose gel electrophoresis to obtain positive transformants. The positive transformants screened were amyE site-integrated recombinant bacteria B. subtilis WB800N / amyE::P 43 -MTSase.

[0314] Embodiment 4:

[0315] The lacA site prepared in Example 1 was integrated into the plasmid pDG-lacA-P 43 -MTSase-Cm-lacA was transferred into the amyE single-site integration recombinant bacteria B. subtilis WB800N / amyE::P prepared in Example 3 43 -MTSase, and obtained the amyE and lacA double-site integration recombinant bacteria B. subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43 -MTSase, the specific method is:

[0316] 6 μL of pDG-lacA-P 43 -MTSase-Cm-lacA plasmid was added to 60 μL B. subtilis WB800N / amyE::P 43 -MTSase competent cells (B. subtilis WB800N / amyE::P 43-MTSase competent cells were prepared in the same manner as the preparation method of B. subtilis WB800N competent cells in Example 2), incubated on ice for 5 min, added to a pre-cooled electroporation cup (2 mm), and electrotransformed at 2500 V and 5 ms. After the electroporation was completed, 1 mL of 37°C preheated RM medium (RM medium: LB + 0.5 M sorbitol + 0.38 M mannitol) was immediately added to the electroporation cup, and cultured at 37°C for 3 h with shaking recovery, and then spread on an LB plate containing 15 μg / mL chloramphenicol, and cultured inverted at 37°C for 12 h. The transformants on the chloramphenicol-resistant LB plate were picked up with a toothpick and inoculated into LB liquid culture medium containing 15 μg / mL chloramphenicol resistance, respectively, and cultured at 37°C for 12 h. Colony PCR amplification was performed using the bacterial solution as a template for verification, and the corresponding target bands were obtained by agarose gel electrophoresis to obtain positive transformants. The positive transformants screened were the recombinant bacteria with double integration of amyE and lacA sites, B. subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43 -MTSase.

[0317] Embodiment 5:

[0318] The lipA site prepared in Example 1 was integrated into the plasmid pDG-lipA-P 43 -MTSase-Em-lipA was transferred into the amyE and lacA double-site integrated recombinant bacteria B. subtilis WB800N / amyE::P prepared in Example 4 43 -MTSase / lacA::P 43 -MTSase, amyE, lacA, lipA three-site integration recombinant bacteria B.subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43 -MTSase / lipA::P 43 -MTSase, the specific method is:

[0319] 6 μL pDG-lipA-P 43 -MTSase-Em-lipA plasmid was added to 60 μL B. subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43 -MTSase competent cells (B. subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43-MTSase competent cells were prepared in the same manner as the preparation method of B. subtilis WB800N competent cells in Example 2), incubated on ice for 5 min, added to a pre-cooled electroporation cup (2 mm), and electrotransformed at 2500 V and 5 ms. After the electroporation was completed, 1 mL of RM medium (RM medium: LB + 0.5 M sorbitol + 0.38 M mannitol) preheated at 37°C was immediately added to the electroporation cup, cultured at 37°C for 3 h with shaking recovery, spread on an LB plate containing 5 μg / mL erythromycin, and cultured inverted at 37°C for 12 h. Transformants on the erythromycin-resistant LB plate were picked up with a toothpick and inoculated into LB liquid culture medium containing 5 μg / mL erythromycin resistance, respectively, and cultured at 37°C for 12 h. Colony PCR amplification was performed using the bacterial solution as a template for verification, and the corresponding target bands were obtained by agarose gel electrophoresis to obtain positive transformants. The positive transformants screened were the recombinant bacteria B. subtilis WB800N / amyE::P with integration of three sites of amyE, lacA and lipA. 43 -MTSase / lacA::P 43 -MTSase / lipA::P 43 -MTSase.

[0320] Embodiment 6:

[0321] The eglS site prepared in Example 1 was integrated into the plasmid pDG-eglS-P 43 -MTHase-Km-eglS was transferred into the amyE, lacA, lipA three-site integration recombinant bacteria B. subtilis WB800N / amyE::P prepared in Example 5 43 -MTSase / lacA::P 43 -MTSase / lipA::P 43 -MTSase, and obtained the recombinant bacterium B. subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43 -MTSase / lipA::P 43 -MTSase / eglS::P 43 -MTHase, the specific method is:

[0322] 6 μL pDG-eglS-P 43 -MTHase-Km-eglS plasmid was added to 60 μL B. subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43-MTSase / lipA::P 43 -MTSase competent cells (B. subtilisWB800N / amyE::P 43 -MTSase / lacA::P 43 -MTSase / lipA::P 43 -MTSase competent cells were prepared in the same manner as the preparation method of B. subtilis WB800N competent cells in Example 2), incubated on ice for 5 min, added to a pre-cooled electroporation cup (2 mm), and electrotransformed at 2500 V and 5 ms. After the electroporation was completed, 1 mL of RM medium (RM medium: LB + 0.5 M sorbitol + 0.38 M mannitol) preheated at 37°C was immediately added to the electroporation cup, cultured at 37°C for 3 h with shaking recovery, spread on an LB plate containing 100 μg / mL kanamycin, and cultured inverted at 37°C for 12 h. The transformants on the kanamycin-resistant LB plate were picked up with a toothpick and inoculated into LB liquid culture medium containing 100 μg / mL kanamycin resistance, respectively, and cultured at 37°C for 12 h. Colony PCR amplification was performed using the bacterial solution as a template for verification, and the corresponding target bands were obtained by agarose gel electrophoresis to obtain positive transformants. The positive transformants screened were the recombinant bacteria B. subtilis WB800N / amyE::P with four integration sites of amyE, lacA, lipA and eglS. 43 -MTSase / lacA::P 43 -MTSase / lipA::P 43 -MTSase / eglS::P 43 -MTHase.

[0323] Example 7: Identification of positive recombinant bacteria prepared in Example 6

[0324] The above positive recombinant colonies were inoculated into LB liquid culture medium containing 100 μg / mL spectinomycin, 15 μg / mL chloramphenicol, 5 μg / mL erythromycin, and 100 μg / mL kanamycin and cultured overnight at 37°C. Genomic DNA was extracted using the kit provided by Shanghai Bioengineering Co., Ltd., and the obtained genomic DNA was used as a template to obtain the corresponding P 43 PCR amplification was performed using primers -F / MTSase-R, lacA-Front-F / lacA-Back-R, lipA-Front-F / lipA-Back-R, and eglS-Front-F / eglS-Back-R.

[0325] The PCR amplification system is 20 μL:

[0326] 1 μL of 10 μmol / L upstream primer; 1 μL of 10 μmol / L downstream primer; 1 μL of genomic template; 10 μL of 2×Phanta MaxMaster Mix; make up to 20 μL with ddH2O;

[0327] The PCR amplification procedure is as follows:

[0328] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 3 min 20 sec, 30 cycles; extension at 72°C for 5 min;

[0329] Agarose gel electrophoresis Figure 1 As shown, agarose gel electrophoresis confirmed that the exogenous fragment P 43 -MTSase was inserted into the amyE, lacA, and lipA gene sites of Bacillus subtilis, and the exogenous fragment P 43 -MTHase ​​was inserted into the eglS gene site of Bacillus subtilis, and the positive recombinant bacteria were named B. subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43 -MTSase / lipA::P 43 -MTSase / eglS::P 43 -MTHase.

[0330] Embodiment 8:

[0331] The eglS site prepared in Example 1 was integrated into the plasmid pDG-eglS-P 43 -MTHase-Km-eglS was transferred into the B. subtilis WB800N competent cells prepared in Example 2 to obtain the eglS single-site integrated recombinant bacteria B. subtilis WB800N / eglS::P 43 -MTHase, the specific method is:

[0332] 6 μL pDG-eglS-P 43-MTHase-Km-eglS plasmid was added to 60 μL B.subtilis WB800N competent cells, incubated on ice for 5 min, added to a pre-cooled electroporation cup (2 mm), and electroporated at 2500 V and 5 ms. After the electroporation, 1 mL of 37°C preheated RM medium (RM medium: LB + 0.5 M sorbitol + 0.38 M mannitol) was immediately added to the electroporation cup, shaken and revived at 37°C for 3 h, spread on an LB plate containing 100 μg / mL kanamycin, and inverted at 37°C to screen the kanamycin-resistant strain as the eglS single-site integrated recombinant strain B.subtilis WB800N / eglS::P 43 -MTHase.

[0333] Example 9: Fermentation of positive recombinant bacteria

[0334] a. The positive recombinant bacteria of Example 7 were inoculated into LB solid medium and cultured at 37°C for 12 h;

[0335] b. Inoculate the recombinant bacteria in LB solid medium into LB liquid medium, and culture at 37°C and 200 rpm in a constant temperature shaker for 12 h to obtain an initial seed solution;

[0336] c. The initial seed solution prepared in step b was transferred to TB liquid culture medium at a ratio of 1% by volume, and cultured in a constant temperature shaker at 37° C. and 200 r / min for 10 h to obtain an inoculation seed solution;

[0337] d. Transfer the inoculated seed liquid obtained in step c to 50 L fermentation medium at a volume percentage of 10%, and ferment at a speed of 500 rpm and a temperature of 37° C. for 48 h; filter the fermentation liquid using a ceramic membrane to obtain a fermentation liquid clear liquid with the bacteria removed.

[0338] Culture medium:

[0339] LB solid medium: peptone 1g / L, yeast extract powder 0.5g / L, NaCl 1g / L, agar powder 2g / L, solvent water;

[0340] LB liquid medium: peptone 1g / L, yeast extract powder 0.5g / L, NaCl 1g / L, solvent water, pH 7.0;

[0341] TB liquid culture medium: tryptone 12 g / L, yeast extract powder 24 g / L, glycerol 4 mL / L, KH2PO4 2.4 g / L, K2HPO4 16.5 g / L, solvent water;

[0342] Fermentation medium: tryptone 12g / L, yeast extract powder 24g / L, sucrose 12g / L, KH2PO4 0.6g / L, K2HPO44g / L, solvent water.

[0343] The above positive recombinant bacteria were fermented and expressed, and trehalose conversion experiments were performed.

[0344] Example 10: Trehalose conversion experiment

[0345] The fermentation liquid obtained in Example 9 was crushed by a high-pressure homogenizer to obtain a crude enzyme solution for converting trehalose. Maltodextrin with a DE value of 8.8, pullulanase 5U / g maltodextrin, cyclodextrin glucosyltransferase CGTase 1U / g maltodextrin were added to a constant temperature reactor, and the crude enzyme solution was added, and the amount of MTHase ​​added in the crude enzyme solution was controlled to be 35U / g maltodextrin, the conversion temperature was controlled to be 60°C, the pH was controlled to be 6.0, and the conversion time was 48h; after the conversion was completed, saccharifying enzyme was added to convert the residual miscellaneous sugars into glucose. The content of trehalose was detected by high performance liquid chromatography, and the trehalose conversion rate was calculated.

[0346]

[0347] Where: Y—trehalose conversion rate (%)

[0348] m1—Trehalose mass (g)

[0349] m2—Mass of maltodextrin (g)

[0350] Comparative Example 1

[0351] The amyE single site obtained in Example 3 was integrated into the recombinant bacteria B. subtilis WB800N / amyE::P 43 -MTSase and the eglS single-site integration recombinant bacteria B. subtilis WB800N / eglS::P obtained in Example 8 43 -MTHase, the positive recombinant bacteria were fermented and expressed by the fermentation method of Example 9; the trehalose conversion method of Example 10 was used to transform B.subtilis WB800N / amyE::P 43 -MTSase and B. subtilis WB800N / eglS::P 43 -MTHase ​​were mixed at a mass ratio of 1:1 for trehalose conversion.

[0352] Comparative Example 2

[0353] The amyE single site obtained in Example 3 was integrated into the recombinant bacteria B. subtilis WB800N / amyE::P 43-MTSase and the eglS single-site integration recombinant bacteria B. subtilis WB800N / eglS::P obtained in Example 8 43 -MTHase, the positive recombinant bacteria were fermented and expressed by the fermentation method of Example 9; the trehalose conversion method of Example 10 was used to transform B.subtilis WB800N / amyE::P 43 -MTSase and B. subtilis WB800N / eglS::P 43 -MTHase ​​were mixed at a mass ratio of 2:1 for trehalose conversion.

[0354] Comparative Example 3

[0355] The amyE single site obtained in Example 3 was integrated into the recombinant bacteria B. subtilis WB800N / amyE::P 43 -MTSase and the eglS single-site integration recombinant bacteria B. subtilis WB800N / eglS::P obtained in Example 8 43 -MTHase, the positive recombinant bacteria were fermented and expressed by the fermentation method of Example 9; the trehalose conversion method of Example 10 was used to transform B.subtilis WB800N / amyE::P 43 -MTSase and B. subtilis WB800N / eglS::P 43 -MTHase ​​were mixed at a mass ratio of 3:1 for trehalose conversion.

[0356] Comparative Example 4

[0357] The eglS site in Example 1 was integrated into the plasmid pDG-eglS-P 43 -MTHase-Km-eglS was transferred into the recombinant bacteria B. subtilis WB800N / amyE::P 43 -MTSase was used to obtain the positive amyE and eglS double-site integration recombinant bacteria B. subtilis WB800N / amyE::P 43 -MTSase / eglS::P 43 -MTHase.

[0358] The positive recombinant bacteria were fermented and expressed using the fermentation method of Example 9; and the trehalose conversion method of Example 10 was used to convert trehalose.

[0359] Comparative Example 5

[0360] The eglS site in Example 1 was integrated into the plasmid pDG-eglS-P 43 -MTHase-Km-eglS was transferred into the recombinant bacterium B. subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43 -MTSase was used to obtain the positive amyE, lacA, and eglS three-site integration recombinant bacteria B. subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43 -MTSase / eglS::P 43 -MTHase.

[0361] The positive recombinant bacteria were fermented and expressed using the fermentation method of Example 9; and the trehalose conversion method of Example 10 was used to convert trehalose.

[0362] Comparative Example 6

[0363] Changing the insertion site of the MTHase ​​gene, inserting the MTHase ​​gene into the amyE site: constructing the corresponding site integration plasmid according to the method of Example 1, and constructing the corresponding recombinant bacteria according to Examples 2-6. When constructing the recombinant bacteria, the site insertion order of the integration plasmid is the amyE site, the lacA site, the lipA site, and the eglS site; the obtained recombinant bacteria is: B. subtilis WB800N / amyE::P 43 -MTHase / lacA::P 43 -MTSase / lipA::P 43 -MTSase / eglS::P 43 -MTSase;

[0364] The positive recombinant bacteria were fermented and expressed using the fermentation method of Example 9; and the trehalose conversion method of Example 10 was used to convert trehalose.

[0365] Comparative Example 7

[0366] Changing the insertion site of the MTHase ​​gene, inserting the MTHase ​​gene into the lacA site: constructing the corresponding site integration plasmid according to the method of Example 1, and constructing the corresponding recombinant bacteria according to Examples 2-6. When constructing the recombinant bacteria, the site insertion order of the integration plasmid is amyE site, lacA site, lipA site, and eglS site; the obtained recombinant bacteria is: B. subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43-MTHase / lipA::P 43 -MTSase / eglS::P 43 -MTSase;

[0367] The positive recombinant bacteria were fermented and expressed using the fermentation method of Example 9; and the trehalose conversion method of Example 10 was used to convert trehalose.

[0368] Comparative Example 8

[0369] Changing the insertion site of the MTHase ​​gene, inserting the MTHase ​​gene into the lipA site: constructing the corresponding site integration plasmid according to the method of Example 1, and constructing the corresponding recombinant bacteria according to Examples 2-6. When constructing the recombinant bacteria, the site insertion order of the integration plasmid is amyE site, lacA site, lipA site, and eglS site; the obtained recombinant bacteria is: B. subtilis WB800N / amyE::P 43 -MTSase / lacA::P 43 -MTSase / lipA::P 43 -MTHase / eglS::P 43 -MTSase.

[0370] The positive recombinant bacteria were fermented and expressed using the fermentation method of Example 9; and the trehalose conversion method of Example 10 was used to convert trehalose.

[0371] Results and analysis:

[0372] The conversion rates of the double enzymes of the positive recombinant bacteria in Example 10 and Comparative Examples 1-8 were detected.

[0373] Detection method:

[0374] The concentration of trehalose generated in the reaction solution (saccharification solution) was determined by high performance liquid chromatography. An amino column was used in the determination process. The column temperature was 40°C. The mobile phase was a mixed solution of acetonitrile and water with a volume ratio of 3:1. The flow rate was 1 mL / min. The detector was a differential detector. The detection time was 20 min.

[0375] The self-assembly models of the MTSase-MTHase ​​multi-enzyme complexes in different assembly forms and the proportions of assembly modules involved in Example 10 and Comparative Examples 1-8 are shown in Table 1.

[0376] Table 1. Assembly modes and trehalose conversion rates of Example 10 and Comparative Examples 1-9

[0377] Experimental Group MTSase and MTHase ​​expression forms MTSase / MTHase Conversion rate of trehalose / % Example 10 Heterologous four-site integration 3:1 79.7 Comparative Example 1 Heterologous single-site integration 1:1 49.5 Comparative Example 2 Heterologous single-site integration 2:1 71.2 Comparative Example 3 Heterologous single-site integration 3:1 80.3 Comparative Example 4 Heterologous dual-site integration 1:1 48.7 Comparative Example 5 Heterologous three-site integration 2:1 69.8 Comparative Example 6 Heterologous four-site integration 3:1 72.4 Comparative Example 7 Heterologous four-site integration 3:1 76.9 Comparative Example 8 Heterologous four-site integration 3:1 74.8

[0378] It can be seen from the trehalose conversion results of Example 10 and Comparative Examples 1-8 that, whether it is heterologous homology or heterologous heterologous site integration, when the ratio of MTSase and MTHase ​​is 3:1, the conversion rate of trehalose is relatively high. When MTSase and MTHase ​​are expressed heterologously, and the ratio of MTSase and MTHase ​​is 3:1 for trehalose conversion, the trehalose conversion rate is 80.3%; when MTSase and MTHase ​​are expressed heterologously, the integration site is different, the conversion rate of trehalose also changes accordingly, and the ratio of MTSase and MTHase ​​is 3:1 for trehalose conversion, and the trehalose conversion rate is 79.7%, 72.4%, 76.9%, and 74.8% respectively. Heterologous homology four-site integration, different MTHase ​​insertion sites, will affect the expression amount and enzyme activity of MTHase, and then affect the catalytic efficiency of trehalose. By expressing MTSase and MTHase ​​heterologously, the amount of fermentation broth can be reduced and the production cost can be reduced.

Claims

1. A method for constructing a recombinant Bacillus subtilis expressing MTSase and MTHase ​​in a heterologous manner, characterized in that: The steps include: Step 1: Construction of Bacillus subtilis amyE Site integration plasmid pDG-amyE-P 43 -MTSase-amyE, including the following steps: (1) Using the Bacillus subtilis genome as a template, PCR amplified the constitutive promoter P 43 Gene fragments; (2) Sulfolobus acidocaldarius Sulfolobus acidocaldarius ) ATCC 33909 genome was used as a template to amplify the gene fragment of maltooligosyltrehalose synthase MTSase by PCR; (3) Using pDG1730 plasmid as template, inverse PCR amplification was performed to obtain the pDGamyE linearized vector gene fragment; (4) Using seamless cloning technology, the promoter P in step (1) was cloned into 43 The gene fragment, the maltooligosaccharide trehalose synthase MTSase gene fragment in step (2), and the pDGamyE linearized vector gene fragment in step (3) are connected together to obtain Bacillus subtilis amyE Site integration plasmid pDG-amyE-P 43 -MTSase-amyE; Step 2: Construction of Bacillus subtilis lacA Site integration plasmid pDG-lacA-P 43 -MTSase-Cm-lacA, comprising the following steps: ①Using the Bacillus subtilis genome as a template, PCR amplified the lacA upstream homology arm gene fragment; ② Using the Bacillus subtilis genome as a template, PCR amplify the lacA downstream homology arm gene fragment; ③ pDG-amyE-P 43 -MTSase-amyE plasmid was used as template and PCR amplified P 43 -MTSase gene fragment; ④Using pHT01 plasmid as template, PCR amplification was performed to obtain the chloramphenicol Cm resistance gene fragment; ⑤Using pDG1730 plasmid as template, inverse PCR amplification was performed to obtain the pDGlacA linearized vector gene fragment; ⑥Use seamless cloning technology to clone the lacA upstream homology arm gene fragment in step ① and the P 43 -MTSase gene fragment, the chloramphenicol Cm resistance gene fragment in step ④, the lacA downstream homology arm gene fragment in step ②, and the pDGlacA linearized vector gene fragment in step ⑤ are connected together to obtain Bacillus subtilis lacA Site integration plasmid pDG-lacA-P 43 -MTSase-Cm-lacA; Step 3: Construction of Bacillus subtilis lipA Site integration plasmid pDG-lipA-P 43 -MTSase-Em-lipA, comprising the following steps: [1] PCR amplification using the Bacillus subtilis genome as template lipA Upstream homology arm gene fragment; [2] PCR amplification using the Bacillus subtilis genome as template lipA Downstream homology arm gene fragment; [3] Using pDG-lacA-P 43 -MTSase-Cm-lacA plasmid was used as template and PCR amplified P 43 -MTSase gene fragment; [4] Using the pMAD plasmid as a template, PCR amplification was performed to obtain the erythromycin Em resistance gene fragment; [5] Using pDG1730 plasmid as template, inverse PCR amplification was performed to obtain the linearized vector gene fragment of pDGlipA; [6] Using seamless cloning technology, the lipA Upstream homology arm gene fragment, P in step [3] 43 -MTSase gene fragment, the erythromycin Em resistance gene fragment in step [4], the lipA The downstream homology arm gene fragment and the pDGlipA linearized vector gene fragment in step [5] are connected together to obtain Bacillus subtilis lipA Site integration plasmid pDG-lipA-P 43 -MTSase-Em-lipA; Step 4: Construction of Bacillus subtilis eglS Site integration plasmid pDG-eglS-P 43 -MTHase-Km-eglS, comprising the following steps: A PCR amplification using the Bacillus subtilis genome as template eglS Upstream homology arm gene fragment; B. Using the Bacillus subtilis genome as template, PCR amplification eglS Downstream homology arm gene fragment; C pHT01-P 43 -MTHase ​​plasmid was used as template to amplify P 43 -MTHase ​​gene fragment; D. Using pMA5 plasmid as template, PCR amplification was performed to obtain the kanamycin Km resistance gene fragment; E Using pDG1730 plasmid as template, inverse PCR amplification was performed to obtain the linearized vector gene fragment of pDGeglS; F uses seamless cloning technology to clone the eglS Upstream homology arm gene fragment, P in step C 43 -MTHase ​​gene fragment, the kanamycin Km resistance gene fragment in step D, the eglS downstream homology arm gene fragment in step B, and the pDGeglS linearized vector gene fragment in step E are connected together to obtain Bacillus subtilis eglS Site integration plasmid pDG-eglS-P 43 -MTHase-Km-eglS; Step 5: Construction of Bacillus subtilis amyE Single-site integration strain Bacillus subtilis / amyE:: P 43 -MTSase: The pDG-amyE-P constructed in step 1 was 43 -MTSase-amyE plasmid transformation B. subtilis WB800N, made amyE Single-site integration strain B. subtilis WB800n / amyE:: P 43 -MTSase; Step 6: Construction of Bacillus subtilis amyE and lacA Double-site integration strain Bacillus subtilis / amyE:: P 43 -MTSase / lacA:: P 43 -MTSase: The pDG-lacA-P constructed in step 2 was 43 -MTSase-Cm-lacA plasmid transformation B. subtilis WB800n / amyE:: P 43 -MTSase, prepared amyE , lacA Double-site integration strain B. subtilis WB800n / amyE:: P 43 -MTSase / lacA:: P 43 -MTSase; Step 7: Construction of Bacillus subtilis amyE , lacA and lipA three-site integration strain Bacillus subtilis / amyE:: P 43 -MTSase / lacA:: P 43 -MTSase / lipA:: P 43 -MTSase: Step 3 to construct pDG-lipA-P 43 -MTSase-Em-lipA plasmid transformation B. subtilis WB800n / amyE:: P 43 -MTSase / lacA:: P 43 -MTSase, prepared amyE , lacA , lipA Three-site integration strain B. subtilis WB800n / amyE:: P 43 -MTSase / lacA:: P 43 -MTSase / lipA:: P 43 -MTSase; Step 8: Construction of Bacillus subtilis amyE , lacA, lipA and eglS Four-site integration strain Bacillus subtilis / amyE:: P 43 -MTSase / lacA:: P 43 -MTSase / lipA:: P 43 -MTSase / eglS:: P 43 -MTHase: The pDG-eglS-P constructed in step 4 was 43 -MTHase-Km-eglS plasmid transformation B. subtilis WB800n / amyE:: P 43 -MTSase / lacA:: P 43 -MTSase / lipA:: P 43 -MTSase, prepared amyE , lacA , lipA , eglS Four-site integration strain B. subtilis WB800n / amyE:: P 43 -MTSase / lacA:: P 43 -MTSase / lipA:: P 43 -MTSase / eglS:: P 43 -MTHase, namely, recombinant Bacillus subtilis expressing MTSase and MTHase ​​heterologously.

2. The construction method according to claim 1, characterized in that: In step (1), the promoter P 43 The nucleotide sequences of the PCR amplification primers for the gene fragment are as follows: P 43 -F:5’-GATCG GATCC AGCTTCGTGCATGCAGGC-3’; P 43 -MTSase-R:5’-CTGATATCATGTGTACATTCCTCTCTTACCTATAATGG-3’。 3. The construction method according to claim 1, characterized in that: The nucleotide sequence of the PCR amplification primer for the maltooligosaccharide-trehalose synthase MTSase gene fragment in step (2) is as follows: MTSase-P 43 -F:5’-GAATGTACACATGATATCAGCAACCTACAGATTACA-3’; MTSase-R:5’- GAATTC TTAGTGGTGGTGGTGGTGGTGCATTCTAACTAGTATCCTAGG-3’。 4. The construction method according to claim 1, characterized in that: The nucleotide sequence of the PCR amplification primer for the pDGamyE linearized vector gene fragment in step (3) is as follows: pDG-F:5’-CACCACCACCACCACCACTAA GGATTCC TGCAGCCCTGGC-3’; pDG-R:5'-GCACGAAGCT GGATCC GATCAGACCAGTTTTTAAT-3'.

5. The construction method according to claim 1, characterized in that: In step ① lacA The nucleotide sequences of the PCR primers for the upstream homology arm gene fragment are as follows: lacA-Front-F: 5'-TTCAAGAATTTGTGATGTCAAAGCTTGAAAAAAC-3'; lacA-Front-R: 5'-GCACGAAGCTGTTATGCCAATTGACCGCG-3'.

6. The construction method according to claim 1, characterized in that: In step ② lacA The nucleotide sequences of the PCR amplification primers for the downstream homology arm gene fragment are as follows: lacA-Back-F: 5'-AATAACTTAACGGACAGCGTTCTCTATTTCCAAT-3'; lacA-Back-R: 5'-GCAGACAATATAATGTGTGTTTACGACAATTCT-3'.

7. The construction method according to claim 1, characterized in that: In step ③, P 43 The nucleotide sequences of the PCR amplification primers for the -MTSase gene fragment are as follows: P 43 -MTSase-F1:5’-TTGGCATAACAGCTTCGTGCATGCAGGC-3’; MTSase-P 43 -R1:5’-TCACGACGTTTTAGTGGTGGTGGTGGTGGTGCATTCTAACTAGTATCCTAGG-3’。 8. The construction method according to claim 1, characterized in that: The nucleotide sequence of the PCR amplification primer for the chloramphenicol Cm resistance gene fragment in step ④ is as follows: Cm-F: 5'-CCACCACTAAAACGTCGTGACTGGGAAAACCCTGGC-3'; Cm-R: 5'-ACGCTGTCCGTTAAGTTATTGGTATGACTGGTTTTAAG-3'.

9. The construction method according to claim 1, characterized in that: The nucleotide sequence of the PCR amplification primer for the pDGlacA linearized vector gene fragment in step ⑤ is as follows: pDGlacA-F: 5'-ACACACATTAATTGTCTGCATTTGCGCCGG-3'; pDGlacA-R: 5'-TGACATCACAAATTCTTGAAGACGAAAGGGC-3'.

10. The construction method according to claim 1, characterized in that: In step [1] lipA The nucleotide sequences of the PCR primers for the upstream homology arm gene fragment are as follows: lipA-Front-F: 5'-TTCAAGAATTTTCATCTGTGCCATACGACAG-3'; lipA-Front-R: 5'-GCACGAAGCTCGCCATCTTTCTGATCGTC-3'.

11. The construction method according to claim 1, characterized in that: In step [2] lipA The nucleotide sequences of the PCR amplification primers for the downstream homology arm gene fragment are as follows: lipA-Back-F: 5'-TTTTTGTGAAGCGAACAACGTGGATATTATGGC-3'; lipA-Back-R: 5'-GCAGACAATATTTGAATAAGAATCATGATCTCACCT-3'.

12. The construction method according to claim 1, characterized in that: In step [3], P 43 The nucleotide sequences of the PCR amplification primers for the -MTSase gene fragment are as follows: P 43 -MTSase-F2:5'-AAAGATGGCGAGCTTCGTGCATGCAGGC-3':; MTSase-P 43 -R2:5’-TTTAACGACTTTAGTGGTGGTGGTGGTGGTGCATTCTAACTAGTATCCTAGG-3’。 13. The construction method according to claim 1, characterized in that: The nucleotide sequence of the PCR amplification primer for the erythromycin Em resistance gene fragment in step [4] is as follows: Em-F: 5'-CCACCACTAAAGTCGTTAAAACCGTGTGCTCT-3'; Em-R: 5'-CGTTGTTCGCTTCACAAAAAATAGGCACACGAAAA-3'.

14. The construction method according to claim 1, characterized in that: The nucleotide sequence of the PCR amplification primer for the pDGlipA linearized vector gene fragment in step [5] is as follows: pDGlipA-F: 5'-CTTATTCAAATATTGTCTGCATTTGCGCCGG-3'; pDGlipA-R: 5'-CACAGATGAAAATTCTTGAAGACGAAAGGGC-3'.

15. The construction method according to claim 1, characterized in that: In step A eglS The nucleotide sequences of the PCR primers for the upstream homology arm gene fragment are as follows: eglS-Front-F: 5'-TTCAAGAATTCTTTCATCGCAGTCGCAA-3'; eglS-Front-R: 5'-GCACGAAGCTCACGGACGGGTTGTCAATAT-3'.

16. The construction method according to claim 1, characterized in that: The nucleotide sequence of the PCR amplification primer for the eglS downstream homology arm gene fragment in step B is as follows: eglS-Back-F: 5'-GGGGATTTTAAAAGATAAACCCACACAGGAAAA-3'; eglS-Back-R: 5'-GCAGACAATAAAATCGCTTTTTTATTTTGTTGCTGA-3'.

17. The construction method according to claim 1, characterized in that: In step C, P 43 The nucleotide sequences of the PCR amplification primers for the -MTHase ​​gene fragment are as follows: P 43 -MTHase-F:5’-CCCGTCCGTGAGCTTCGTGCATGCAGGC-3’; MTHase-P 43 -R:5’-TTCAATCCTTTTATCAGTGGTGGTGGTGGTGGTGTTCTAATTGATATACC-3’。 18. The construction method according to claim 1, characterized in that: The nucleotide sequence of the PCR amplification primers for the kanamycin Km resistance gene fragment in step D is as follows: Km-F: 5'-ACCACTGATAAAAGGATTGAAGGATGCTTAGGA-3'; Km-R: 5'-GTTTATCTTTTAAAATCCCCTTTCATTTTCTAATGTAAATCT-3'.

19. The construction method according to claim 1, characterized in that: The nucleotide sequence of the PCR amplification primer for the pDGeglS linearized vector gene fragment in step E is as follows: pDGeglS-F: 5'-AAAGCGATTTTATTGTCTGCATTTGCGCCGG-3'; pDGeglS-R: 5'-GCGATGAAAGAATTCTTGAAGACGAAAGGGC-3'.

20. The construction method according to claim 1, characterized in that: The PCR amplification system in step 1 is as follows: 10 μmol / L upstream primer 2.5 μL, 10 μmol / L downstream primer 2.5 μL, gene template 2.5 μL, 2×PhantaMax Master Mix 25 μL, add ddH2O to 50 μL; The amplification procedure is as follows: Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; extension at 72°C for 5 min.

21. The construction method according to claim 1, characterized in that: The construction method of the integration plasmid in step 1 is as follows, with a total volume of 20 μL: 0.03 pmol of each gene fragment obtained by PCR amplification, 0.03 pmol of the linearized vector gene fragment obtained by reverse PCR amplification, 4 μL 5×CE MultiS Buffer, 2 μL Exnase MultiS, add ddH2O to 20 μL; place the reaction system at 37 ℃ for 30 min, transform the obtained recombinant product into Escherichia coli, and obtain the integrated plasmid after successful identification and correct sequencing.

22. The construction method according to claim 1, characterized in that: In step 5, the pDG-amyE-P constructed in step 1 is 43 -MTSase-amyE plasmid transfer B. subtilis In WB800N, the amyE Site, obtained after screening amyE Single-site integration recombinant strain B. subtilis WB800N / amyE:: P 43 -MTSase.

23. The construction method according to claim 22, characterized in that: The screening is as follows: the transformants are spread on an LB plate containing 100 μg / mL spectinomycin, cultured at 37°C for 12 h, the transformants on the LB plate containing spectinomycin are picked up with a toothpick, and are inoculated into LB liquid culture medium containing 100 μg / mL spectinomycin, respectively, and cultured at 37°C for 12 h, colony PCR amplification verification is performed using the bacterial liquid as a template, and the corresponding target bands are obtained by agarose gel electrophoresis to obtain positive transformants.

24. The construction method according to claim 1, characterized in that: The PCR amplification system in step 2 is as follows: 10 μmol / L upstream primer 2.5 μL, 10 μmol / L downstream primer 2.5 μL, gene template 2.5 μL, 2×PhantaMax Master Mix 25 μL, add ddH2O to 50 μL; The amplification procedure is as follows: Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; extension at 72°C for 5 min.

25. The construction method according to claim 1, characterized in that: The method for constructing the integration plasmid in step 2 is as follows, with a total volume of 20 μL: 0.03 pmol of each gene fragment obtained by PCR amplification, 0.03 pmol of the linearized vector gene fragment obtained by reverse PCR amplification, 4 μL 5×CE MultiS Buffer, 2 μL Exnase MultiS, add ddH2O to 20 μL; place the reaction system at 37 ℃ for 30 min; the obtained recombinant product was transformed into Escherichia coli, and after successful identification and correct sequencing, the integrated plasmid was obtained.

26. The construction method according to claim 1, characterized in that: In step 6, the pDG-lacA-P constructed in step 2 is 43 -MTSase-Cm-lacA plasmid transfer B. subtilis WB800N / amyE:: P 43 -MTSase, integrated into the genome lacA Site, obtained after screening amyE , lacA Double-site integration recombinant strain B. subtilis WB800N / amyE:: P 43 -MTSase / lacA:: P 43 -MTSase.

27. The construction method according to claim 26, characterized in that: The screening is performed by spreading the transformants on an LB plate containing 15 μg / mL chloramphenicol, culturing at 37°C for 12 h, picking the transformants on the LB plate with chloramphenicol with a toothpick, inoculating them into LB liquid culture medium containing 15 μg / mL chloramphenicol, culturing at 37°C for 12 h, performing colony PCR amplification verification using the bacterial liquid as a template, obtaining the corresponding target band through agarose gel electrophoresis, and obtaining positive transformants.

28. The construction method according to claim 1, characterized in that: The PCR amplification system in step 3 is as follows: 10 μmol / L upstream primer 2.5 μL, 10 μmol / L downstream primer 2.5 μL, gene template 2.5 μL, 2×PhantaMax Master Mix 25 μL, add ddH2O to 50 μL; The amplification procedure is as follows: Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; extension at 72°C for 5 min.

29. The construction method according to claim 1, characterized in that: The construction method of the integration plasmid in step 3 is as follows, with a total volume of 20 μL: 0.03 pmol of each gene fragment obtained by PCR amplification, 0.03 pmol of the linearized vector gene fragment obtained by reverse PCR amplification, 4 μL 5×CE MultiS Buffer, 2 μL Exnase MultiS, add ddH2O to 20 μL; place the reaction system at 37 ℃ for 30 min, transform the obtained recombinant product into Escherichia coli, and obtain the integrated plasmid after successful identification and correct sequencing.

30. The construction method according to claim 1, characterized in that: In step 7, the pDG-lipA-P constructed in step 3 is 43 -MTSase-Em-lipA plasmid transfer B. subtilis WB800N / amyE:: P 43 -MTSase / lacA:: P 43 -MTSase, integrated into the genome lipA Site, obtained after screening amyE , lacA、lipA Three-site integration recombinant strain B. subtilis WB800N / amyE:: P 43 -MTSase / lacA:: P 43 -MTSase / lipA:: P 43 -MTSase.

31. The construction method according to claim 30, characterized in that: The screening is performed by spreading the transformants on an LB plate containing 5 μg / mL erythromycin, culturing at 37°C for 12 h, picking the transformants on the LB plate with erythromycin with a toothpick, inoculating them into LB liquid culture medium containing 5 μg / mL erythromycin, culturing at 37°C for 12 h, performing colony PCR amplification verification using the bacterial liquid as a template, obtaining the corresponding target band through agarose gel electrophoresis, and obtaining the positive transformants.

32. The construction method according to claim 1, characterized in that: The PCR amplification system in step 4 is as follows: 10 μmol / L upstream primer 2.5 μL, 10 μmol / L downstream primer 2.5 μL, gene template 2.5 μL, 2×PhantaMax Master Mix 25 μL, add ddH2O to 50 μL; The amplification procedure is as follows: Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; extension at 72°C for 5 min.

33. The construction method according to claim 1, characterized in that: The method for constructing the integration plasmid in step 4 is as follows, with a total volume of 20 μL: 0.03 pmol of each gene fragment obtained by PCR amplification, 0.03 pmol of the linearized vector gene fragment obtained by reverse PCR amplification, 4 μL 5×CE MultiS Buffer, 2 μL Exnase MultiS, add ddH2O to 20 μL; place the reaction system at 37 ℃ for 30 min, transform the obtained recombinant product into Escherichia coli, and obtain the integrated plasmid after successful identification and correct sequencing.

34. The construction method according to claim 1, characterized in that: In step 8, the pDG-eglS-P constructed in step 4 is 43 -MTHase-Km-eglS plasmid transfer B. subtilis WB800N / amyE:: P 43 -MTSase / lacA:: P 43 -MTSase / lipA:: P 43 -MTSase, integrated into the genome eglS Site, obtained after screening amyE , lacA、lipA , eglS Four-site integration recombinant strain B. subtilis WB800N / amyE:: P 43 -MTSase / lacA:: P 43 -MTSase / lipA:: P 43 -MTSase / eglS:: P 43 -MTHase.

35. The construction method according to claim 34, characterized in that: The screening is performed by spreading the transformants on an LB plate containing 100 μg / mL kanamycin, culturing at 37°C for 12 h, picking the transformants on the LB plate with kanamycin with a toothpick, inoculating them into LB liquid culture medium containing 100 μg / mL kanamycin, culturing at 37°C for 12 h, performing colony PCR amplification verification using the bacterial liquid as a template, obtaining the corresponding target band through agarose gel electrophoresis, and obtaining positive transformants.

36. Use of the heterologous recombinant Bacillus subtilis expressing MTSase and MTHase ​​constructed according to the construction method of claim 1 in the fermentation production of trehalose.

Images