A method for preparing single-stranded pendulous double-stranded nucleic acid donors and their applications
By introducing nucleotide-like structures into PCR primers to form single-stranded and double-stranded nucleic acid donors with pendant single-stranded structures, and linking them to gene editing proteins, the problem of low homologous recombination repair efficiency in CRISPR/Cas9 gene editing was solved, achieving an efficient and safe gene editing strategy.
Patent Information
- Application Number
- CN202211016761.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-24
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2042-08-24
AI Technical Summary
In existing CRISPR/Cas9 gene editing technologies, homologous recombination repair efficiency is low, especially in human cell systems where it is difficult for donors to enter the cell nucleus, resulting in low efficiency of long gene fragment knock-in. Existing methods are costly and involve many steps.
Nucleotide-like structures are introduced into the middle of PCR primers to form pendulous single-stranded structures, preparing single-stranded pendulous double-stranded nucleic acid donors, which are then directly or indirectly linked to gene editing proteins to improve homologous recombination repair efficiency.
It significantly improves the success rate of gene editing and the efficiency of homologous recombination repair, and the process is simple, safe, and cost-effective.
Smart Images

Figure HDA0003812829650000011 
Figure HDA0003812829650000012 
Figure HDA0003812829650000021
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to a method for preparing and applying single-stranded pendulous double-stranded nucleic acid donors to improve the efficiency of homologous recombination repair in gene editing. Background Technology
[0002] I. Gene Editing
[0003] The CRISPR / Cas9 system uses a single-stranded guide RNA to target gene sites and then cleaves them with the Cas9 endonuclease, inducing corresponding DNA double-strand breaks (DSBs). This enables precise genome editing, including gene substitution, point mutation, gene knockout, and gene knock-in. However, compared to gene knockout, deletion, or small fragment insertion efficiency, the knock-in efficiency for long gene fragments (greater than 500 bp) remains very low. Gene knock-in is mainly achieved through non-homologous end recombination (NHEJ) and homologous recombination (HDR) pathways. NHEJ involves inserting a donor template without homologous arms into the DSB, which can easily lead to base deletions or mismatches at the interface. HDR, on the other hand, inserts a foreign gene into the target gene site through sequence exchange between homologous arms, making it an effective method for precise gene insertion. However, the HDR process only works during cell division. In addition, the low transduction efficiency of the CRISPR system and the difficulty of donor entry into the cell nucleus further limit its editing efficiency in human cell systems.
[0004] Commonly used DNA templates in gene editing include single-stranded DNA, double-stranded DNA, and plasmids. Double-stranded DNA preparation is the most economical, especially for long fragments greater than 500 bp. Existing techniques for improving homologous recombination repair efficiency in CRISPR-Cas9 gene editing using different DNA templates mainly include:
[0005] (1) Increase the length of the template homology sequence. When the homology sequences at both ends of the template are more than 1000bp, the homology recombination efficiency can be improved by 2-4 times compared with a 100bp template. However, the disadvantage is that it is difficult, inefficient and costly to synthesize long template sequences.
[0006] (2) Chemical modification of the template can improve the stability of the template and improve the efficiency of homologous recombination, but the disadvantage is that chemically modified templates have toxic reactions after transfection into cells.
[0007] (3) Linking the nuclear localization sequence to the template can promote the transfer of the template to the cell nucleus, thereby improving the efficiency of homologous recombination. However, the disadvantage is that the nuclear localization sequence is an amino acid sequence, and the modification process is difficult, has great losses, and is costly.
[0008] To address the difficulty of donors entering the cell nucleus, current methods primarily involve linking with gene-editing proteins. These methods include: (1) modifying a functional molecule (such as biotin) onto the single-stranded DNA donor and fusing a functional protein (avidin and streptavidin) that binds to the functional molecule onto the gene-editing protein. Avidin or streptavidin interacts with biotin to link the single-stranded DNA donor to the gene-editing protein. (2) adding a sequence recognized and covalently linked by an endonuclease onto the single-stranded DNA donor and fusing the corresponding endonuclease, such as PCV2 (the Rep protein of porcine circovirus 2), and the corresponding DNA sequence onto the gene-editing protein. (3) linking the single-stranded DNA to the gene-editing protein or sgRNA via chemical means, such as a click reaction. These methods are not only numerous but also costly. Therefore, to broaden the application of gene editing in the field of biotechnology and promote the development of gene therapy for hereditary diseases, this invention aims to develop a more efficient, safe, and convenient CRISPR / Cas9-mediated gene editing strategy. Summary of the Invention
[0009] To address the problems existing in the prior art, the present invention provides the following technical solution:
[0010] On one hand, the present invention provides a method for preparing a single-stranded pendulous double-stranded nucleic acid donor, characterized in that the method includes the steps of introducing a nucleotide-like substance (e.g., 3-cyanovinylcarbazole phosphate nucleoside, 1,3-propanediol nucleoside, 1,4-dehydro-2-deoxy-D-ribitol nucleoside) into the middle of a primer, and then performing PCR amplification on the template.
[0011] In some implementations, the template is a homologous recombination template.
[0012] In some embodiments, the primer sequences are as shown in SEQ ID No. 4 and SEQ ID No. 5.
[0013] On the other hand, the present invention provides a single-stranded pendulous double-stranded nucleic acid donor prepared according to the above method.
[0014] In some implementations, the single-stranded pendulous double-stranded nucleic acid donor has a pendulous single strand at the 5' end.
[0015] In some implementations, the single-stranded pendulous double-stranded nucleic acid donor has a pendulous single strand at the 3' end.
[0016] In some implementations, the single-stranded pendulous double-stranded nucleic acid donor includes one or more pendulous strands.
[0017] On the other hand, the present invention provides a gene editing method, characterized in that the gene editing method utilizes the single-stranded dangling double-stranded nucleic acid donor as described above.
[0018] In some embodiments, the gene editing method includes the steps of converting the gene editing protein, the single-stranded overhanging double-stranded nucleic acid donor, and sgRNA together into cells and culturing the cells.
[0019] In some embodiments, the gene-editing protein is selected from Cas9 protein, Cas12a protein and variants thereof, including variants obtained by amino acid screening and alteration and fusion protein variants obtained by adding functional proteins.
[0020] In some implementations, the variants are selected from Cas9n and dCas9.
[0021] In some embodiments, the gene editing method includes the steps of first incubating the gene editing protein with sgRNA to obtain a complex of the gene editing protein and sgRNA, then transforming the complex together with the single-stranded overhanging double-stranded nucleic acid donor into cells, and culturing the cells.
[0022] In some embodiments, the conversion method is selected from electrotransduction, chemical transduction, liposome transfection, and microinjection.
[0023] In some embodiments, the gene editing method includes the steps of converting the gene editing protein, the single-stranded overhanging double-stranded nucleic acid donor, sgRNA, and single-stranded oligonucleotides together into cells and culturing the cells.
[0024] In some implementations, the single-stranded oligonucleotide includes RNA and DNA.
[0025] In some implementations, the single-stranded oligonucleotide is designed based on a single-stranded pendulous double-stranded nucleic acid donor, and the single-stranded oligonucleotide is complementary to the single-stranded pendulous double-stranded nucleic acid donor to form a region recognized by the gene-editing protein-sgRNA complex, so as to link with the gene-editing protein-sgRNA complex.
[0026] In some embodiments, the gene editing method includes the steps of first incubating the gene editing protein with sgRNA to obtain a complex of the gene editing protein and sgRNA, then transforming the complex of the gene editing protein and sgRNA together with the annealing product of the single-stranded overhanging double-stranded nucleic acid donor and the single-stranded oligonucleotide into cells, and culturing the cells.
[0027] In some embodiments, the gene editing method includes the step of modifying the sgRNA by inserting a complementary sequence into the stem-loop structure of the sgRNA.
[0028] In some implementations, the plasmid construction of the sgRNA is performed via Golden Gate assembly.
[0029] In some embodiments, the gene editing method includes the steps of converting the modified sgRNA together with the annealing product of the single-stranded overhanging double-stranded nucleic acid donor and the gene-editing protein into cells, and culturing the cells.
[0030] In some embodiments, the nucleotide sequence of the single-stranded overhanging double-stranded donor is shown in SEQ ID No. 3.
[0031] In some embodiments, the nucleotide sequence of the single-stranded oligonucleotide is shown in SEQ ID No. 7-16.
[0032] In some embodiments, a complementary sequence of the sgRNA is inserted as shown in SEQ ID No. 17-21.
[0033] In some embodiments, the DNA sequence of the modified sgRNA is shown in SEQ ID No. 22.
[0034] In some implementations, an NGG sequence is introduced into the primer of the single-stranded dangling double-stranded donor in order to enable the single-stranded oligonucleotide to form the region recognized by the gene-editing protein.
[0035] In some implementations, the DNA double-strand break of the single-stranded overhanging double-stranded donor has 50-60 bp of DNA sequence at each end.
[0036] On the other hand, the present invention provides the application of the single-stranded dangling double-stranded donor in gene editing.
[0037] definition
[0038] Single-stranded pendant double-stranded nucleic acid donor
[0039] Single-stranded overhanging double-stranded nucleic acid donors are nucleic acid donors with single-stranded ends, compared to double-stranded nucleic acids. The single strands constitute a smaller proportion of the double-stranded portion, and the overhangs are located at one or both ends of the double-stranded portion. They can be used for cell gene editing.
[0040] Cas9-N-NLS protein
[0041] The Cas9-N-NLS protein is a Cas9 protein with a nuclear localization sequence (NLS) fused to its N-terminus. The NLS carries the Cas9 protein into the cell nucleus. This protein can be used for in vitro cleavage and cellular gene editing, possessing all the activities of the Cas9 protein. In vitro, it can stably bind to sgRNA. Transfecting the Cas9 / sgRNA complex into cells via electroporation or transfection reagents allows for direct cleavage of the cellular genome. Alternatively, the Cas9-N-NLS protein can be transfected into cells along with sgRNA expression plasmids and recombinant templates to achieve site-specific genome editing.
[0042] Lamin A / C
[0043] Lamin A / C refers to lamin A / C, and mutations in it can lead to a range of diseases, such as cardiomyopathy.
[0044] Compared with the prior art, the present invention has the following technical effects:
[0045] This invention introduces nucleotide-like structures into the middle position of PCR primers to form pendulous single-stranded structures, and then directly or indirectly links the sequence of the pendulous single-stranded structure with gene editing proteins, thereby achieving higher knock-in efficiency.
[0046] This invention can significantly improve the efficiency of homologous recombination repair, thereby increasing the success rate of gene editing.
[0047] This invention is simple, easy to operate, and is an efficient, safe, and convenient gene editing strategy. Attached Figure Description
[0048] Figure 1 This is a flowchart and structural schematic diagram of the preparation of a 5' viscous-terminated single-chain dangling double-chain donor according to an embodiment of the present invention. Figure 1 Only a schematic diagram of the structure of the 5' sticky end single-stranded overhanging double-stranded donor is shown. Since DNA has two ends, the 5' sticky end single-stranded overhanging double-stranded donor can be one or two overhanging single strands.
[0049] Figure 2 These are fluorescence and flow cytometry images of single-stranded dangling double-stranded nucleic acid donors with 5' sticky ends knocked into HEK293T cells in this embodiment of the invention.
[0050] Figure 3 This is a schematic diagram of the DNA single-stranded dangling double-stranded donor and Cas9 / sgRNA ligation method mediated by DNA single-stranded in an embodiment of the present invention, as well as the final knock-in efficiency of different DNA single-stranded ligations.
[0051] Figure 4This diagram illustrates the complementary pairing of sgRNA with single-stranded dangling double-stranded donors and the Cas9 / sgRNA ligation method in embodiments of the present invention, as well as the final knock-in efficiency of different sgRNA structures. Detailed Implementation
[0052] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings.
[0053] This invention prepares single-stranded pendulous double-stranded donors based on PCR principles. The single-stranded pendulous double-stranded nucleic acid donors are directly or indirectly linked with gene editing proteins to form whole co-transfected cells, which can significantly improve the efficiency of homologous recombination repair and increase the success rate of gene editing.
[0054] To achieve the above objectives, this invention utilizes the CRISPR-Cas9 system and a single-stranded overhanging double-stranded donor to directly or indirectly form a gene editing system. This gene editing system includes a single-stranded overhanging double-stranded donor, a gene editing protein such as Cas9 protein, sgRNA, and single-stranded oligonucleotides with or without their addition. The improved homologous recombination repair efficiency of this gene editing system is achieved through three mechanisms: binding of the gene editing protein to the single-stranded overhanging double-stranded donor; linking the single-stranded overhanging double-stranded donor to the gene editing protein via a region recognized by the gene editing protein (CTS region) mediated by single-stranded oligonucleotides (RNA and DNA); and altering the structure of the sgRNA to link the single-stranded overhanging double-stranded donor to the gene editing protein through base complementarity pairing.
[0055] For ease of characterization, the green fluorescent protein (EGFP) sequence was used as the inserted gene, i.e., as the template for preparing single-stranded overhanging double-stranded donors.
[0056] To achieve the goal of gene editing, the inventors designed and constructed an sgRNA expression vector. The sgRNA was designed using GeneArt. TM The Precision gRNA Synthesis Kit (Thermo Fisher Scientific) provides a detailed primer design method. Using this kit, sgRNA sequences can be transcribed and purified. The transcribed sgRNA is then directly incubated with gene-editing proteins at 37°C for gene knock-in. sgRNA synthesis can also be performed through GenScript's synthesis service.
[0057] To achieve gene editing, the inventors introduced nucleotide-like substances (such as 3-cyanovinylcarbazole nucleoside, cnvK) into the middle of PCR primers to obtain donors with 5' sticky ends.
[0058] To achieve the purpose of gene editing, the inventors purchased Cas9-N-NLS protein (product number: Z03388-100) directly from the Genscript Biotech website. This protein is a nuclear localization sequence (NLS) fused to the N-terminus of the Cas9 protein. The NLS carries the Cas9 protein into the cell nucleus.
[0059] The Cas9-N-NLS protein, the donor with a 5' sticky end, and the corresponding sgRNA with or without single-stranded oligonucleotides (RNA and DNA) (the single-stranded oligonucleotides here act as a bridge to indirectly connect the donor and the gene editing protein) were electroporated into cells, and the expression of the reporter gene green fluorescent protein was detected after culturing for a certain period of time.
[0060] The following specific examples further illustrate the scheme for increasing gene editing efficiency using the present invention. Those skilled in the art should understand that the Cas9 protein is used as an example in the following examples. The CTS region recognized by the gene-editing protein is formed by the complementarity of single-stranded DNA with the single-stranded overhanging double-stranded donor, and by the complementary linkage of sgRNA with the single-stranded overhanging double-stranded donor to achieve linkage with the gene-editing protein. In practical applications, the linkage with the gene-editing protein in the examples is only a partial example. The gene-editing protein is only Cas9 protein as an example; it can also be replaced with Cas12a protein and its corresponding variants (including variants obtained through amino acid screening and modification and fusion proteins obtained by linking functional proteins). The linkage method with the gene-editing protein can also be changed to the binding of a gene-editing protein fusion protein to a single-stranded overhanging double-stranded donor. The present invention can be applied to all sites in all cells (bacteria, fungi, and any of plant and animal cells) that use DNA as genetic material. Accordingly, the sequences of sgRNA and the donor can also be adaptively modified.
[0061] Example 1: Preparation and application of 5' sticky-terminated single-chain dangling double-chain donors
[0062] The first step is the preparation of a single-chain dangling double-chain donor with a 5' sticky end.
[0063] To verify the feasibility of the design, this invention takes the Lamin A / C site (a protein encoded by the LMNA gene in the human body) as an example. It aims to insert a single-stranded overhanging double-stranded donor into the twelfth exon of the Lamin A / C site. The 50bp sequences at both ends of the donor are identical to the sequences at both ends of the DNA double-strand break at the Lamin A / C site, referred to as homologous arms. The 50bp homologous arm sequences at both ends of the donor are as follows:
[0064] Lamin A / C plus:5'to 3'ctttggtttttttcttctgtatttgtttttctaagagaagttattttcta(SEQ ID No.1)
[0065] Lamin A / C minus:5'to 3'cagtggttttatactgaaggaaaaacacaagcaaaaaaaaaaaaaaagca(SEQ ID No.2)
[0066] The 50bp DNA sequences from both ends were added to both sides of the EGFP sequence fragment via PCR (including the EGFP sequence itself, its promoter, and the tailing sequence, but excluding the 50bp homologous arm sequences at both ends), as shown below:
[0067]
[0068] To introduce single-stranded overhangs onto DNA donors, the following primers were synthesized:
[0069] LaminAC-50b-cnvk-F: 5'to 3'CCTAGGTCTTGAAAGGA / cnvK / gtgggctttggtttttttcttctgtatttgtttttc (SEQ ID No. 4)
[0070] LaminAC-50b-cnvk-R: 5' to 3' CCTAGGTCTTGAAAGGA / cnvK / gtgggtgcttttttttttttttgcttgtgttttt (SEQ ID No. 5) (The uppercase sequence is a dangling single-stranded sequence, / cnvK / represents 3-cyanovinylcarbazole nucleoside)
[0071] Through PCR, we can obtain, for example... Figure 1 The three types of single-stranded pendulous double-stranded donors are shown. For the control group blunt-ended double-stranded donor, it can be obtained by using the pendulous single-stranded donor from SEQ ID No. 4 and SEQ ID No. 5 and the primer after deleting / cnvK / as the primer pair module for PCR amplification.
[0072] The second step is the synthesis of sgRNA.
[0073] The sgRNA was designed using GeneArt. TM The Precision gRNA Synthesis Kit (ThermoFisherScientific) provides detailed primer design methods, and the kit is used to transcribe and purify sgRNA sequences to obtain the corresponding sequences, referred to as IVT sgRNA. Alternatively, sgRNA can be synthesized using GenScript's EasyEdit sgRNA Synthesis Service, referred to as SYN sgRNA. To insert a single-stranded dangling double-stranded donor into the twelfth exon of the Lamin A / C site in cells, the DNA sequence corresponding to the spacer region of the sgRNA is as follows:
[0074] Lamin A / C sgRNA:agagaagttatttctacag(SEQ ID NO.6)
[0075] The third step involves introducing RNP (sgRNA and Cas9 protein complex, prepared by incubating sgRNA and Cas9 protein at 37°C for 10 min) and single-stranded pendulous double-stranded donors into cells via electroporation.
[0076] The cells used in the experiment were HEK293T(ATCC) cells with a passage number of less than 10.
[0077] First, one day before electroporation, 8 million HEK293T cells (ATCC) were seeded into a 10cm culture plate in DMEM medium (Invitrogen) containing 10% FBS (Gibco). When the cells reached a density of 70%-90%, they were electroporated using the Amaxa Nucleofector II device (Lonza) with program D-032 and the Cell line Nucleofector kit V (Lonza, VVCA-1003). The specific procedure was as follows: the cells in the 10cm culture plate were digested with trypLE at room temperature for 3 minutes, the cells were counted with a counter, aliquoted into 1 million cells, centrifuged, and the culture medium was removed for later use. At the same time, 5 μg of Cas9-N-NLS and 3.3 μg of sgRNA were dissolved in 10 μL of electroporation buffer, mixed, and incubated at room temperature for 10 minutes. Then, the mixture was combined with 1 million HEK293T cells resuspended in 90 μL of electroporation buffer. Finally, 5 μg of the aforementioned 5' sticky-end single-stranded pendulous double-stranded donors (referred to as 5' donors, where donors with only a pendulous single strand at the left end are 5'-donors, donors with only a pendulous single strand at the right end are donor-5', and donors with pendulous single strands at both ends are 5'-donor-5') and blunt-end double-stranded donors are added to the above mixture before electroporation to complete the electroporation process. The electroporated cells are then quickly placed in a constant temperature incubator (37°C, 5% CO2) for culture. After 3 days, the medium is replaced with fresh DMEM containing 10% FBS and cultured in a constant temperature incubator.
[0078] The fourth step is the detection of EGFP fluorescence signals.
[0079] Fifteen days after electroporation, EGFP expression was detected using fluorescence microscopy and flow cytometry. The results showed that when using 5' donors for gene knock-in, the editing efficiency was better than the opposite direction when the 5' sticky end had a homologous arm (homologous arms mean the break ends have the same sequence) with the break end without the PAM region (the PAM region is the NGG region recognized by the Cas9 / sgRNA complex; Cas9 / sgRNA cleaves double-stranded DNA, forming a break, one end of which is the end without the PAM region). This increased the efficiency from 31.6% to 39.8%. When 5' overhanging single strands were added to both ends of the donor, i.e., the donor was 5'-donor-5', the gene knock-in efficiency was about twice as high as with blunt-end donors. The results are as follows: Figure 2 As shown.
[0080] Therefore, it can be seen that the single-stranded dangling double-stranded donor of the present invention can improve the efficiency of gene editing compared with the blunt-end donor (the blunt-end donor is a donor without a dangling single strand).
[0081] Example 2: DNA Single-Stranded Linguistic Double-Stranded Donor Ligation to Cas9 / sgRNA mediated by single-stranded DNA
[0082] Based on the sequence of the single-stranded dangling double-stranded donor with the 5' sticky end in Example 1, a set of DNA single strands was designed. These single strands (used to form the CTS region) were complementary to the dangling single strands of the 5'-donor, forming a CRISPR / Cas9-recognized region (CTS region) to achieve connection with the CRISPR / Cas9 complex. This method requires consideration of the binding capacity of the CTS region, which determines the stability of the binding between the single-stranded DNA and the 5'-donor. The CTS region binding capacity is determined based on the binding of CRISPR / Cas9 to the PAM region and the Tm value (Y value) of the complementary single-stranded DNA to the sticky end in this region (Tm is the melting point temperature, the temperature at which half of the DNA double strand denatures into a single strand). Therefore, we set two different Y values (60℃ and 37.5℃). The number of complementary bases between the DNA single strand and the spacer region of sgRNA is the X value, which is 20bp+AA (where AA consists of two extended A bases), 20bp, 18bp, 16bp, and 14bp, respectively. Based on the above conditions, the DNA single-stranded sequence is as follows:
[0083] Y60X20AA:5' to 3'CCCACCTCCTTTCAAGACCTCTGTAGAAAATAACTTCTCTAA(SEQ IDNo.7)
[0084] Y60X20:5' to 3' CCCACCTCCTTTCAAGACCTCTGTAGAAAATAACTTCTCT(SEQ ID No. 8)
[0085] Y60X18:5' to 3'CCCACCTCCTTTCAAGACCTCTGTAGAAAATAACTTCT(SEQ ID No.9)
[0086] Y60X16:5' to 3'CCCACCTCCTTTCAAGACCTCTGTAGAAAATAACTT(SEQ ID No.10)
[0087] Y60X14:5' to 3'CCCACCTCCTTTCAAGACCTCTGTAGAAAATAAC(SEQ ID No.11)
[0088] Y37.5X20AA:5' to 3'CCTTTTCAAGACCTCTGTAGAAAATAACTTCTCTAA(SEQ ID No.12)
[0089] Y37.5X20:5' to 3'CCTTTCAAGACCTCTGTAGAAAATAACTTCTCT(SEQ ID No. 13)
[0090] Y37.5X18:5' to 3'CCTTTCAAGACCTCTGTAGAAAATAACTTCT(SEQ ID No. 14)
[0091] Y37.5X16:5' to 3'CCTTTCAAGACCTCTGTAGAAAATAACTT(SEQ ID No.15)
[0092] Y37.5X14:5' to 3'CCTTTCAAGACCTCTGTAGAAAATAAC(SEQ ID No.16)
[0093] Since the system used here is partially the same as that used in Example 1, the first and second steps are the same as in Example 1, and will not be repeated here.
[0094] The third step involves chemically transfecting RNP (sgRNA and Cas9 protein complex), the complex of the single-stranded dangling double-stranded donor and single-stranded DNA from Example 1, and an electrotransduction buffer into cells. The chemical transfection reagent used is Lipofectamine. TM CRISPRMAX TM Cas9Reagent (Thermo Fisher Scientific). The specific experimental steps are as follows:
[0095] The cells used in the experiment were HEK293T cells with a passage number of less than 10.
[0096] First, one day before chemical transfection, 50,000 HEK293T cells were seeded into 24-well plates. When the cells reached a density of 30%-50%, 2.5 μg of 5'-donor and an equimolar amount of single-stranded DNA were annealed in electrotransduction buffer. The annealing program was 95°C for 5 min, followed by cooling to 25°C at a rate of 0.6°C / min, holding for 2 min, and then rapidly cooling to 4°C. Then, the above mixture, 320 ng of Cas9-N-NLS, and 240 ng of sgRNA were added to a solution containing 2.5 μL of Cas9 Plus. TM Reagent (is Lipofectamine) TM CRISPRMAXTM Mix the components of Cas9 Reagent with Opti-MEM (Gibco) medium; simultaneously, add 1.5 μL of CRISPRMAX. TM Reagent (is Lipofectamine) TM CRISPRMAX TM The components of Cas9 Reagent were diluted in 25 μL of opti-MEM medium. The two solutions were mixed and incubated for 10 min. The mixture was then added to a 24-well plate containing the inoculated cells. After 2 days, the medium was replaced with fresh DMEM medium containing 10% FBS and cultured in a constant temperature incubator.
[0097] The fourth step is the detection of EGFP fluorescence signals.
[0098] Fifteen days after transfection, EGFP expression was detected using fluorescence microscopy and flow cytometry. The experiment showed that a higher Y value correlated with higher gene knock-in efficiency (via...). Figure 3 As can be seen from the two curves, the number of complementary bases between the CRISPR / Cas9 sgRNA and the sticky ends also affects the gene knock-in efficiency. When the complementary bases are 20bp and 16bp, the gene knock-in efficiency is about 0.5 times higher than that of the system with only 5'-donor. The results are as follows. Figure 3 As shown.
[0099] Therefore, the single-stranded dangling double-stranded donor of the present invention can complement single-stranded DNA (single-stranded DNA is DNA in a single-stranded state, which can be designed to complement the donor to form a CTS region) to form a CTS region, thereby achieving connection with the CRISPR / Cas9 system and improving the efficiency of gene editing.
[0100] Example 3: Complementary pairing of sgRNA with single-stranded hangant double-stranded donor and cas9 / sgRNA ligation
[0101] Since the system used here is partially the same as that used in Example 1, the first and second steps are the same as in Example 1, and will not be described again here. The third step is to introduce Cas9-N-NLS, single-stranded pendulous double-stranded donor and corresponding sgRNA annealing solution into cells by chemical transfection, which is the same as in Example 2, and will not be described again here.
[0102] The inventors also utilized the characteristic of the stem-loop structure of sgRNA being exposed to the outside of CRISPR / Cas9 (i.e., sgRNA binds to Cas9 while the stem-loop structure of sgRNA is exposed outside the complex) to sequence modify the sgRNA. The complementary sequence of sgRNA and the 5'-donor was inserted into the stem-loop structure to achieve sticky end connection with the 5'-donor. We investigated the binding ability of sgRNA to the overhanging single strand of the double-stranded donor. Here, we used the Tm value of DNA double-strand complementarity (Tm is the melting point temperature, the temperature at which half of the DNA double strand denatures into a single strand) to indirectly represent the binding ability of sgRNA to the overhanging single strand of the double-stranded donor. A set of insertion sequences for modifying sgRNA is designed as follows:
[0103] Y46.7:5' to 3'CCTAGGTCTTGAAAGGAC (SEQ ID No. 17)
[0104] Y40.3:5' to 3' TAGGTCTTGAAAGGAC (SEQ ID No. 18)
[0105] Y37.4:5' to 3' GGTCTTGAAAGGAC (SEQ ID No. 19)
[0106] Y31.7:5' to 3'GTTCTTGAAAGGAC (SEQ ID No. 20)
[0107] Y26.4:5' to 3'TCTTGAAAGGAC (SEQ ID No. 21)
[0108] The above sequences were spliced into a plasmid using the Golden Gate assembly method (Golden Gate is a common plasmid construction method), amplified in DH5α bacteria, and the DNA fragment was obtained by PCR using designed primers and then processed according to GeneArt. TM The sgRNA was obtained by transcription and purification using the Precision gRNA Synthesis Kit (Thermo Fisher Scientific). Taking Y46.7 as an example, the DNA sequence of the sgRNA obtained by transcription is as follows:
[0109] agagaagttattttctacagGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGGCCAAAACCTAGGTCTTGAAAGGACAAAAGGCCAAGTGGCACCGAGTCGGTGC(SEQ ID No. 22, the first lowercase letter is the DNA sequence of the spacer region of the sgRNA, and the second uppercase letter is the DNA sequence of the scaffold sequence of the sgRNA)
[0110] Fifteen days after transfection, EGFP expression was detected using fluorescence microscopy and flow cytometry. The experiment showed that there was an optimal efficiency when the DNA double-strand Tm was between 30℃ and 40℃, approximately twice as high as the system with only 5'-donor. The results are as follows... Figure 4 As shown.
[0111] Therefore, the single-stranded dangling double-stranded donor of the present invention can be complementary to sgRNA to achieve ligation with the CRISPR / Cas9 system, thereby improving the efficiency of gene editing.
[0112] sequence
[0113] SEQ ID No.1 Lamin A / C plus (50bp homologous arm)
[0114] 5' to 3'ctttggtttttttcttctgtatttgttttttctaagagaagttattttcta
[0115] SEQ ID No. 2Lamin A / C minus (50bp homologous arm)
[0116] 5' to 3' cagtggttttatactgaaggaaaaacacaagcaaaaaaaaaaaaaaagca
[0117] SEQ ID No. 3 is an EGFP sequence including a promoter and a tailing sequence.
[0118]
[0119] SEQ ID No. 4: LaminAC-50b-cnvk-F primer sequence
[0120] 5' to 3'CCTAGGTCTTGAAAGGA / cnvK / gtgggctttggtttttttcttctgtatttgtttttc
[0121] SEQ ID No. 5: LaminAC-50b-cnvk-R primer sequence
[0122] 5' to 3'CCTAGGTCTTGAAAGGA / cnvK / gtgggtgctttttttttttttttgcttgtgttttt
[0123] SEQ ID No. 6: Lamin A / C sgRNA (DNA sequence corresponding to the spacer region)
[0124] agagaagttattttctacag
[0125] SEQ ID No. 7: Y60X20AA (single-chain oligonucleotide)
[0126] 5' to 3' CCCACCTCCTTTCAAGACCTCTGTAGAAAATAACTTCTCTAA
[0127] SEQ ID No. 8: Y60X20 (single-chain oligonucleotide)
[0128] 5' to 3' CCCACCTCCTTTCAAGACCTCTGTAGAAAATAACTTCTCT
[0129] SEQ ID No. 9: Y60X18 (single-chain oligonucleotide)
[0130] 5' to 3' CCCACCTCCTTTCAAGACCTCTGTAGAAAATAACTTCT
[0131] SEQ ID No. 10: Y60X16 (single-chain oligonucleotide)
[0132] 5' to 3'CCCACCTCCTTTCAAGACCTCTGTAGAAAATAACTT
[0133] SEQ ID No. 11: Y60X14 (single-chain oligonucleotide)
[0134] 5' to 3'CCCACCTCCTTTCAAGACCTCTGTAGAAAATAAC
[0135] SEQ ID No. 12: Y37.5X20AA (single-chain oligonucleotide)
[0136] 5' to 3' CCTTTCAAGACCTCTGTAGAAAATAACTTCTCTAA
[0137] SEQ ID No. 13: Y37.5X20 (single-chain oligonucleotide)
[0138] 5' to 3' CCTTTCAAGACCTCTGTAGAAAATAACTTCTCT
[0139] SEQ ID No. 14: Y37.5X18 (single-chain oligonucleotide)
[0140] 5' to 3' CCTTTCAAGACCTCTGTAGAAAATAACTTCT
[0141] SEQ ID No. 15: Y37.5X16 (single-chain oligonucleotide)
[0142] 5' to 3' CCTTTCAAGACCTCTGTAGAAAATAACTT
[0143] SEQ ID No. 16: Y37.5X14 (single-chain oligonucleotide)
[0144] 5' to 3' CCTTTCAAGACCTCTGTAGAAAATAAC
[0145] SEQ ID No. 17: Y46.7 (Insert sequence for modified sgRNA)
[0146] 5' to 3' CCTAGGTCTTGAAAGGAC
[0147] SEQ ID No. 18: Y40.3 (Insert sequence modified sgRNA)
[0148] 5' to 3' TAGGTCTTGAAAGGAC
[0149] SEQ ID No. 19: Y37.4 (Insert sequence modified sgRNA)
[0150] 5' to 3' GGTCTTGAAAGGAC
[0151] SEQ ID No. 20: Y31.7 (Insert sequence for modified sgRNA)
[0152] 5' to 3' GTTCTTGAAAGGAC
[0153] SEQ ID No. 21: Y26.4 (Insert sequence modified sgRNA)
[0154] 5' to 3' TCTTGAAAGGAC
[0155] The full DNA sequence of the modified sgRNA (SEQ ID No. 22)
[0156] agagaagttattttctacagGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGGCCAAAACCTAGGTCTTGAAAGGACAAAAGGCCAAGTGGCACCGAGTCGGTGC
[0157] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A gene editing method, characterized in that, The method utilizes a single-stranded pendulous double-stranded nucleic acid donor. The preparation of the single-stranded pendulous double-stranded nucleic acid donor includes the introduction of a nucleotide-like substance into the middle of a primer, followed by PCR amplification of the template. The nucleotide-like substance is 3-cyanovinylcarbazole nucleoside, 1,3-propanediol nucleoside, or 1,4-dehydro-2-deoxy-D-ribitol nucleoside. The template is a homologous recombination template. The method includes transforming the gene-editing protein, the single-stranded pendulous double-stranded nucleic acid donor, sgRNA, and a single-stranded oligonucleotide together into cells and culturing the cells. The single-stranded oligonucleotide is designed based on the single-stranded pendulous double-stranded nucleic acid donor, and the single-stranded oligonucleotide is complementary to the single-stranded pendulous double-stranded nucleic acid donor to form a region recognized by the gene-editing protein-sgRNA complex, thus linking to the gene-editing protein-sgRNA complex. The number of complementary bases between the single-stranded oligonucleotide and the spacer region of the sgRNA is 20 bp or 16 bp.
2. The method according to claim 1, characterized in that, The homologous recombination template is the green fluorescent protein gene.
3. The method according to claim 1, characterized in that, The sequences of the primers are shown in SEQ ID No. 4 and SEQ ID No.
5.
4. The method according to claim 1, characterized in that, The single-stranded pendant double-stranded nucleic acid donor has a pendant single strand at the 5' end.
5. The method according to claim 1, characterized in that, The single-stranded pendant double-stranded nucleic acid donor has a pendant single strand at the 3' end.
6. The method according to claim 1, characterized in that, The single-stranded dangling double-stranded nucleic acid donor includes one or more dangling strands.
7. The method according to claim 1, characterized in that, The gene-editing protein is selected from Cas9 protein, Cas12a protein and its variants, including variants obtained by amino acid screening and modification and fusion protein variants obtained by adding functional proteins.
8. The method according to claim 1, characterized in that, The single-stranded oligonucleotides include RNA and DNA.
9. The method according to claim 1, characterized in that, The nucleotide sequence of the single-stranded oligonucleotide is shown in SEQ ID No. 7-16.
10. The method according to claim 1, characterized in that, The method includes the steps of incubating the gene-editing protein with sgRNA to obtain a complex of the gene-editing protein and sgRNA, then transforming the complex of the gene-editing protein and sgRNA together with the annealing product of the single-stranded overhanging double-stranded nucleic acid donor and the single-stranded oligonucleotide into cells, and culturing the cells.
11. The method according to claim 1, characterized in that, The method includes the step of modifying the sgRNA by inserting the complementary sequence of the sgRNA and the single-stranded dangling double-stranded nucleic acid donor into the stem-loop structure of the sgRNA.
12. The method according to claim 11, characterized in that, The complementary sequence is shown in SEQ ID No. 17-21.
13. The method according to claim 11, characterized in that, The DNA sequence of the modified sgRNA is shown in SEQ ID No.
22.
14. The method according to claim 11, characterized in that, The gene editing method includes the steps of transforming the modified sgRNA together with the annealing product of the single-stranded pendulous double-stranded nucleic acid donor and the gene editing protein into cells, and culturing the cells.
Citation Information
Patent Citations
Gene editing methods with increased knock-in efficiency
CN111032867A
Nucleic acid sequences having single stranded ends
WO1994021820A1