An enzyme and its use

By modifying the amino acid sequence of nicotine dehydrogenase and optimizing its three-dimensional structure, the problem of low catalytic rate was solved, enabling efficient nicotine degradation and the development of drugs for the treatment of nicotine addiction.

CN115806947BActive Publication Date: 2026-02-27SHANGHAI JIAOTONG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211173866.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2016-04-01
Publication Date
2026-02-27
Estimated Expiration
2036-04-01

AI Technical Summary

Technical Problem

The low catalytic rate of existing nicotine dehydrogenases limits their application in biocatalysis and protein drug development.

Method used

Nicotine dehydrogenase was modified by protein engineering, replacing the amino acids that hinder product release with amino acids with smaller side chains, and optimizing its three-dimensional structure to improve the catalytic rate.

Benefits of technology

The catalytic rate of nicotine dehydrogenase was increased, and the mutant enzyme catalyzed the substrate nicotine at a rate 3.67 times that of the wild type, making it suitable for biocatalysis, metabolic engineering, and protein drug development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115806947B_ABST
    Figure CN115806947B_ABST
Patent Text Reader

Abstract

The present application discloses an artificial enzyme, which is prepared based on sequence modification of a natural enzyme having the activity of catalyzing the reaction of converting compound I (nicotine) into compound II (N-methyl-4-hydroxy-3-methylnicotinamide) shown as follows, and compound II (N-methyl-4-hydroxy-3-methylnicotinamide) can spontaneously hydrate to generate compound III (pseudo-oxidized nicotine), or the natural enzyme is nicotine dehydrogenase; the modification includes replacing at least one of the amino acids that hinder the release of the product with an amino acid with a smaller side chain. The artificial enzyme has a higher catalytic rate on the substrate than the natural enzyme, and is very promising in the preparation of drugs for treating nicotine addiction.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of protein engineering, and relates to a protein mutant, in particular to a nicotine dehydrogenase mutant, and application thereof in developing protein drugs for treating nicotine addiction and the like. BACKGROUND

[0002] Nicotine (1-methyl-2-[3-pyridine]-pyrrolidine) is one of the main harmful components in tobacco leaves, cigarette smoke and tobacco waste, which is not only directly harmful to health, but also an important precursor of tobacco-specific nitrosamines (TSNA), the main carcinogenic component in tobacco. A large amount of high-nicotine tobacco is produced in China's tobacco production every year, which not only seriously affects the quality of tobacco for smoking, but also increases the harmfulness of tobacco leaves. Reducing the content of nicotine in tobacco and the environment is of great significance for maintaining human health and protecting the ecological environment.

[0003] Using microorganisms to degrade nicotine is a new way to reduce the content and harmfulness of nicotine in tobacco and the environment, especially Pseudomonas and Arthrobacter can metabolize and decompose nicotine to produce carbon sources, nitrogen sources and energy necessary for their growth. Bacteria that can metabolize nicotine have been found, including Pseudomonas (such as Pseudomonas sp. No. 41, P. convexa PC1, P. putida), Arthrobacter (such as Arthobacter oxidans P-34, which was later re-identified as A. ureafaciens; A. oxidans pAO1, which was later re-identified as Arthrobacter nicotinoborans), Cellulomonas sp., and Ochrobactrum intermedium. Fungi mainly include Cunninghamella echinulata, Microsporum gypseum, Streptomyces griseus, S. platenses, and Pellicularia filamentosa.

[0004] It has been found that microorganisms metabolize nicotine mainly through three pathways: the pyridine pathway, mainly with Arthrobacter sp.; the pyrrolidine pathway, mainly with Pseudomonas sp.; and the me pathway, mainly in fungi. In the pyrrolidine pathway, the pyrrolidine ring of nicotine is oxidized to form methylmyosmine, which, when water is added, ring-opens to form pseudooxynicotine, which is then demethylated to form 3-carboxylic acid pyridine salt, the 6' position of the pyridine ring is hydroxylated to form 6-hydroxy-3-carboxylic acid pyridine salt, and the side chain is removed to form 2,5-dihydroxy-pyridine salt and succinate. This metabolic pathway can also start from 6-hydroxy-pseudooxynicotine, and ultimately still form 2,5-dihydroxy-pyridine salt and succinate.

[0005] Nicotine dehydrogenase NicA2 is an enzyme that can degrade nicotine recently isolated from Pseudomonas putida S16. For reports on nicotine dehydrogenase NicA2, see: PLoS Genet. 2013 Oct; 9(10): e1003923. doi: 10.1371 / journal.pgen.1003923. Epub 2013 Oct 24. Systematic unraveling of the unsolved pathway of nicotine degradation in Pseudomonas. Tang H, Wang L, Wang W, Yu H, Zhang K, Yao Y, Xu P.

[0006] Nicotine dehydrogenase NicA2 catalyzes the first step of nicotine degradation, a dehydrogenation reaction, converting nicotine (I) to N-methymyosmine (II), which can further spontaneously hydrate to form pseudooxynicotine (III).

[0007]

[0008] NicA2 is encoded by the nicA2 gene, which plays a crucial role in the degradation pathway of nicotine metabolism in Pseudomonas putida S16. Knocking out the nicA2 gene, Pseudomonas putida S16 cannot grow with nicotine as the sole carbon and nitrogen source (PLoS Genet. 10.1371 / journal.pgen.1003923).

[0009] NicA2 belongs to the monoamine oxidase (MAO) family. MAO mainly exists on the outer membrane of mitochondria, and its main role in the body is to catalyze the metabolism of endogenous and exogenous monoamine substances. Under the action of MAO, monoamine substances are oxidized to produce deamination. According to the action of MAO, the distribution position and selective inhibitors are different, MAO can be divided into two types, namely MAO-A and MAO-B. MAO-A has high affinity for 5-hydroxytryptamine (5-HT), norepinephrine (NE), and dopamine (DA) (J. Mol. Biol. 338, 103-114); while MAO-B has high affinity for phenethylamine (PEA), benzylamine, etc. (Proc. Natl. Acad. Sci. USA 100, 9750-9755).

[0010] NicA2 initiates the degradation of nicotine by Pseudomonas putida, and catalyzes nicotine to generate pseudo-oxidized nicotine, which provides the initial driving force for the smooth operation of the entire metabolic pathway. The research on the nicotine metabolic pathway by Xu Ping's research group has confirmed that the subsequent 6-hydroxy-3-succinylpyridine monooxygenase (HspB) and 2,5-dihydroxypyridine dioxygenase (HPO) can further catalyze nicotine deacidification and ring opening, and then form a simple structure, and finally enter the tricarboxylic acid cycle (J. Biol. Chem. 42:29158-29170; Sci. Rep. / 3-3235 / DOI:10.1038 / srep03235). Therefore, the first step of processing nicotine by NicA2 opens up the subsequent enzyme catalysis and even the efficient operation of the entire metabolic pathway. The catalytic efficiency of NicA2 is the key point to determine the efficiency of the entire nicotine metabolism, and is also an important place for the construction of the subsequent metabolic pathway. In 2015, the article "A new strategy for smoking cessation: characterization of a bacterial enzyme for the degradation of nicotine" published in JACS first reported the possibility of NicA2 for treating cigarette addiction. The article points out that NicA2 has high efficiency and stability in catalyzing the substrate nicotine, and can maintain high activity at 37°C even in mouse serum. At the same time, NicA2 has high affinity for the substrate nicotine, and its Km value for catalyzing nicotine degradation is 91.9 nM, while the highest content of nicotine in the blood is between 162-370 nM. Therefore, in theory, if NicA2 can successfully play a role in degrading nicotine in the human body, the content of nicotine in the human body will be in a saturated state for NicA2. The key to developing protein drugs with nicotine dehydrogenase is high-efficiency nicotine dehydrogenase. The higher the activity of the enzyme, the lower the dosage of the developed drug, and the better the effect. The wild type has limitations in catalytic rate, and if its efficiency can be improved by protein engineering, it will bring great convenience for the development and utilization of nicotine dehydrogenase.

[0011] Therefore, the skilled person in the art is committed to developing a nicotine dehydrogenase with high catalytic rate, and its application in biological catalysis, metabolic engineering and protein drug development. SUMMARY

[0012] In view of the above defects of the prior art, the technical problem to be solved by the present application is to improve nicotine dehydrogenase to obtain nicotine dehydrogenase with high catalytic rate and its application.

[0013] To achieve the above-mentioned purpose, one aspect of the present application provides an artificial enzyme.

[0014] In one embodiment of the present application, the artificial enzyme is produced based on a modification of a sequence of a natural enzyme having an activity of catalyzing a reaction of converting Compound I into Compound II shown below,

[0015]

[0016] or the natural enzyme is nicotine dehydrogenase;

[0017] The modification includes replacing at least one of the amino acids that hinder the release of the product with an amino acid having a smaller side chain.

[0018] Further, the natural enzyme has one or more of the following characteristics:

[0019] 1) the amino acid sequence of the natural enzyme includes an amino acid sequence that is 85% or more, or 90% or more, or 95% or more, or 98% or more, or 99% or more homologous to the amino acid sequence shown in SEQ ID NO: 1; or the amino acid sequence of the natural enzyme includes the amino acid sequence shown in SEQ ID NO: 1; or the amino acid sequence of the natural enzyme is shown in SEQ ID NO: 1;

[0020] 2) the natural enzyme is encoded by a nucleic acid that hybridizes under high stringency conditions with the complementary strand of a nucleic acid encoding a protein having the amino acid sequence shown in SEQ ID NO: 1;

[0021] 3) the natural enzyme is present in a microorganism of the genus Pseudomonas.

[0022] Further, the natural enzyme is present in Pseudomonas putida S16.

[0023] Further, the natural enzyme has a product release channel for the release of the product, and the amino acid having a side chain located in the product release channel of the natural enzyme includes at least one of tryptophan, tyrosine, phenylalanine, glutamic acid, and methionine; and the modification includes replacing at least one of the above-mentioned tryptophan, tyrosine, phenylalanine, glutamic acid, and methionine having a side chain located in the product release channel of the natural enzyme with an amino acid having a smaller side chain.

[0024] Further, the amino acid having a side chain located in the product release channel of the natural enzyme includes at least 9 amino acids selected from tryptophan, tyrosine, phenylalanine, glutamic acid, and methionine.

[0025] Further, the three-dimensional structure of the natural enzyme includes at least one beta sheet and one alpha helix at the release channel, three of the nine amino acids are located in the beta sheet, and are phenylalanine at position 353, phenylalanine at position 355, and tryptophan at position 364 in terms of relative position; six of the nine amino acids are located in the alpha helix, and are phenylalanine at position 163, tyrosine at position 214, tyrosine at position 218, tyrosine at position 242, methionine at position 246, and glutamic acid at position 249 in terms of relative position.

[0026] Further, the above-mentioned replacement is in the following manner: if the amino acid to be replaced is located in the beta sheet, it is replaced by valine; if the amino acid to be replaced is located in the alpha helix, it is replaced by alanine.

[0027] Preferably, the above-mentioned improvement includes: all of the amino acids with a molecular weight of 120 or above that hinder the release of the product are replaced by amino acids with smaller side chains.

[0028] Another aspect of the present application provides an enzyme, which, in one specific embodiment, has one or more of the following characteristics:

[0029] 1) the amino acid sequence of the enzyme includes an amino acid sequence that is 85% or more, or 90% or more, or 95% or more, or 98% or more, or 99% or more homologous to the amino acid sequence shown in SEQ ID NO: 2; or the amino acid sequence of the enzyme includes the amino acid sequence shown in SEQ ID NO: 2; or the amino acid sequence of the enzyme is shown in SEQ ID NO: 2;

[0030] 2) the enzyme is encoded by a nucleic acid that hybridizes under high stringency conditions to the complementary strand of a nucleic acid encoding a protein whose amino acid sequence is shown in SEQ ID NO: 2;

[0031] 3) the amino acid sequence of the enzyme includes an amino acid sequence that is a conservative substitution of the amino acid sequence shown in SEQ ID NO: 2;

[0032] wherein, in terms of relative position, at least one of the amino acid at position 353, the amino acid at position 355, and the amino acid at position 364 of the enzyme is a first small molecular weight amino acid; at least one of the amino acid at position 163, the amino acid at position 214, the amino acid at position 218, the amino acid at position 242, the amino acid at position 246, and the amino acid at position 249 of the enzyme is a second small molecular weight amino acid, the molecular weight of the first small molecular weight amino acid is 140 or less, and the molecular weight of the second small molecular weight amino acid is 110 or less.

[0033] Further, the enzyme has the activity of catalyzing the reaction shown below that converts compound I into compound II:

[0034]

[0035] Alternatively, the enzyme is nicotine dehydrogenase.

[0036] Further, the amino acid at position 353, the amino acid at position 355, and the amino acid at position 364 are located in a β sheet; the amino acid at position 163, the amino acid at position 214, the amino acid at position 218, the amino acid at position 242, the amino acid at position 246, and the amino acid at position 249 are located in an α helix.

[0037] Further, the first small molecular weight amino acid is valine, and the second small molecular weight amino acid is alanine.

[0038] Preferably, the amino acid at position 353, the amino acid at position 355, and the amino acid at position 364 are all the first small molecular weight amino acid; and the amino acid at position 163, the amino acid at position 214, the amino acid at position 218, the amino acid at position 242, the amino acid at position 246, and the amino acid at position 249 are all the second small molecular weight amino acid.

[0039] Another aspect of the present application provides an enzyme, which in one embodiment has an activity of catalyzing the reaction from compound I to compound II as shown below,

[0040]

[0041] Alternatively, the enzyme is nicotine dehydrogenase.

[0042] The enzyme has a product release channel for product release, and the molecular weight of the amino acid whose side chain is located at the narrowest part of the product release channel is below 140.

[0043] Preferably, the molecular weight of the amino acid whose side chain is located at the narrowest part of the product release channel is below 120.

[0044] Preferably, the amino acid whose side chain is located at the narrowest part of the product release channel is valine or alanine.

[0045] Another aspect of the present application provides a nucleotide sequence encoding the above-mentioned artificial enzyme or enzyme.

[0046] Further, the above-mentioned nucleotide sequence has one or more of the following characteristics:

[0047] 1) the nucleotide sequence comprises a nucleotide sequence having 85% or more, or 90% or more, or 95% or more, or 98% or more, or 99% or more homology with the nucleotide sequence shown in SEQ ID NO: 3; or the nucleotide sequence comprises the nucleotide sequence shown in SEQ ID NO: 3; or the nucleotide sequence is as shown in SEQ ID NO: 3;

[0048] 2) the nucleotide sequence hybridizes under high stringency conditions with the complement of the nucleotide sequence set forth in SEQ ID NO: 3.

[0049] Yet another aspect of the present application provides an expression vector or a host cell containing the above-mentioned nucleotide sequence.

[0050] Still another aspect of the present application provides the use of the above-mentioned artificial enzyme or enzyme for degrading nicotine.

[0051] The present application also provides the use of the above-mentioned artificial enzyme or enzyme in the preparation of a medicament for treating nicotine addiction.

[0052] The present application also provides the use of the above-mentioned artificial enzyme or enzyme in the preparation of an enzyme preparation for biocatalytic conversion.

[0053] The present application also provides the use of the above-mentioned artificial enzyme or enzyme in metabolic engineering and synthetic biology.

[0054] Still another aspect of the present application provides a method for improving an enzyme of the monoamine oxidase family, the method comprising: replacing at least one amino acid that hinders product release with an amino acid having a smaller side chain.

[0055] The present application improves the catalytic rate of the mutant enzyme by protein engineering, starting from the wild-type nicotine dehydrogenase, obtaining the relevant structure affecting product release through crystal structure analysis, and eliminating the influence of the relevant amino acid on product release through amino acid substitution, thereby improving the catalytic rate of the mutant enzyme. The nicotine dehydrogenase mutant of the preferred embodiment of the present application has a slightly weaker affinity than the wild-type nicotine dehydrogenase, but its catalytic rate of the substrate nicotine is much greater than that of the wild-type nicotine dehydrogenase, which is 3.67 times greater.

[0056] The present application first analyzes the structure of nicotine dehydrogenase and obtains the structure of nicotine dehydrogenase and substrate nicotine binding. Through analysis of the above-mentioned structure and related experiments, nine large amino acid residues that hinder product release are obtained, thereby laying a good foundation for subsequent mutation to obtain nicotine dehydrogenase with high catalytic efficiency. In addition, the nine large amino acid residues that hinder product release have a certain degree of conservation in other members of the monoamine oxidase family, which also provides a good foundation for improving the members of the monoamine oxidase family.

[0057] The nicotine dehydrogenase mutant of the present application can be applied at least in biocatalysis, metabolic engineering, synthetic biology, and the development of protein drugs, and has great commercial application prospects:

[0058] (a) Biocatalysis: The nicotine dehydrogenase mutant obtained by the present application has superior catalytic properties than the natural nicotine dehydrogenase, and can be used to obtain higher catalytic properties of catalyzing nicotine into products, and thus can be used to develop enzyme preparations for biocatalytic conversion;

[0059] (b) Metabolic engineering and synthetic biology: The mutant obtained above has the same catalyzed reaction as the natural nicotine dehydrogenase, but has higher catalytic efficiency, and thus can be used for metabolic engineering and synthetic biology to develop efficient metabolic pathways and improve the nicotine conversion capacity of strains;

[0060] (c) Development of protein drugs: The mutant obtained above can be used to convert nicotine into pseudo-oxidized nicotine, and has better catalytic conversion capacity than the natural protein, and thus can be used for efficient conversion of nicotine in blood, and thus for the development of drugs related to the treatment of nicotine addiction.

[0061] The concept, specific steps and technical effects of the present application will be further described below with reference to the accompanying drawings, so as to fully understand the purpose, features and effects of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0062] Figure 1 is a polyacrylamide gel electrophoresis diagram of the purified NicA2 protein of a preferred embodiment of the present application. Among them, lane 1: supernatant after breaking the bacteria; lane 2: precipitate after breaking the bacteria; lane 3: column effluent; lane 4: 20 mM imidazole washing liquid; lane 5: 50 mM imidazole washing liquid; lane 6: 80 mM imidazole eluent; lane 7: 170 mM imidazole eluent; lane 8: 300 mM imidazole eluent; M: protein molecular weight marker.

[0063] Figure 2 is a crystal after a series of optimizations such as crystal primary screening, precipitant optimization, addition of crystal seeds, truncation of amino acid sequence, and adjustment of the ratio of protein to crystallization reagent, of the NicA2 protein of a preferred embodiment of the present application. The presence of FAD makes the crystal present a bright yellow color.

[0064] Figure 3 is a structure diagram of NicA2Δ20-nicotine crystal of a preferred embodiment of the present application. a: looking down at the product release channel, the product cannot be observed from the outer surface of the crystal structure, indicating that the product is completely embedded in NicA2; b: adjusting the gray scale to transparent, looking down at the product release channel, the product release channel is blocked by 9 large amino acids; c: cross section of the product release channel.

[0065] Figure 4A polyacrylamide gel electrophoresis chart of purified NicA2-M9 protein of a preferred embodiment of the present application. Wherein, lane 1: supernatant after cell disruption; lane 2: precipitate after cell disruption; lane 3: flow-through of column; lane 4: 20 mM imidazole rinse; lane 5: 50 mM imidazole impurity removal; lane 6: 170 mM imidazole elution of target protein; M: protein molecular weight marker.

[0066] Figure 5 A Michaelis-Menten plot of NicA2 wild type catalyzing nicotine to form N-methyl-4-hydroxy-3-methylnicotine of a preferred embodiment of the present application.

[0067] Figure 6 A Michaelis-Menten plot of NicA2 wild type catalyzing nicotine to form pseudo-oxidized nicotine of a preferred embodiment of the present application.

[0068] Figure 7 A Michaelis-Menten plot of NicA2-M9 catalyzing nicotine to form N-methyl-4-hydroxy-3-methylnicotine of a preferred embodiment of the present application.

[0069] Figure 8 A Michaelis-Menten plot of NicA2-M9 catalyzing nicotine to form pseudo-oxidized nicotine of a preferred embodiment of the present application.

[0070] Figure 9 A graph of GC detection of pseudo-oxidized nicotine release of a preferred embodiment of the present application.

[0071] Figure 10 A comparison of the cross-sectional view of product release channels of five NicA2 mutants and NicA2 wild type generated in the detailed description of the present application. Wherein, A: NicA2 wild type; B: NicA2-M3V mutant; C: NicA2-M3A mutant; D: NicA2-M5 mutant; E: NicA2-M7 mutant; F: NicA2-M9 mutant.

[0072] Figure 11 A result of alignment of NicA2 amino acid sequence with proteins in the monoamine oxidase family. DETAILED DESCRIPTION

[0073] One aspect of the present application is to provide an artificial enzyme, which is based on the sequence modification of a natural enzyme.

[0074] The artificial enzyme as used herein should be understood as any enzyme that is modified from a natural enzyme, including genetic engineering modification, such as enzyme mutants.

[0075] The natural enzyme has the activity of catalyzing the reaction of converting compound I to compound II as shown below.

[0076]

[0077] Alternatively, the natural enzyme is nicotine dehydrogenase.

[0078] The enzyme having an activity of catalyzing the above reaction described herein should be understood as not only referring to an enzyme that specifically catalyzes the above reaction, but also to an enzyme that does not specifically catalyze the above reaction, for example, an enzyme that can catalyze a dehydrogenation reaction of 6-hydroxynicotine (including D-form and L-form) in addition to the above reaction.

[0079] The "nicotine dehydrogenase" described herein refers to an enzyme that can catalyze a dehydrogenation reaction of a pyrrole ring of nicotine or a nicotine analog (e.g., 6-hydroxynicotine).

[0080] The improvement includes replacing at least one of the amino acids that hinder the release of the product with an amino acid having a smaller side chain.

[0081] The "amino acid that hinders the release of the product" described herein should be understood as any amino acid that can improve the efficiency of the release of the product or the catalytic efficiency of the enzyme by being replaced with another amino acid. For example, if the side chain of an amino acid is located in a channel or path of the release of the product, and if the efficiency of the release of the product or the catalytic efficiency of the enzyme can be improved by replacing the amino acid with an amino acid having a smaller side chain, the amino acid is the "amino acid that hinders the release of the product".

[0082] As a preferred embodiment, the natural enzyme further has one or more of the following characteristics:

[0083] 1) the amino acid sequence of the natural enzyme includes an amino acid sequence that is 85% or more, or 90% or more, or 95% or more, or 98% or more, or 99% or more homologous to the amino acid sequence shown in SEQ ID NO: 1; or the amino acid sequence of the natural enzyme includes the amino acid sequence shown in SEQ ID NO: 1; or the amino acid sequence of the natural enzyme is as shown in SEQ ID NO: 1;

[0084] 2) the natural enzyme is encoded by a nucleic acid that hybridizes under high stringency conditions with the complementary strand of a nucleic acid encoding a protein having the amino acid sequence shown in SEQ ID NO: 1;

[0085] 3) the natural enzyme is present in a microorganism of the genus Pseudomonas.

[0086] As used herein, "homology" can refer to the optimal alignment of sequences (nucleotides or amino acids) which can be performed using computerized implementation of algorithms. For example, "homology" with respect to polynucleotides can be determined using BLASTN version 2.0 with default parameters. "Homology" with respect to polypeptides (i.e., amino acids) can be determined using programs such as BLASTP version 2.2.2 with default parameters, which align the polypeptides or fragments being compared (nucleotide fragments can also be aligned) and then determine the degree of amino acid identity or similarity of the comparison.

[0087] As used herein, "hybridization under conditions of low, medium, high, or very high stringency" describes conditions for hybridization and washing. Guidance for performing hybridization reactions can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. Both aqueous and nonaqueous methods are described in this reference, either of which can be used. Specific hybridization conditions herein are as follows: 1) low stringency hybridization conditions are hybridization in 6X sodium chloride / sodium citrate (SSC) at about 45°C, followed by a wash in 0.2X SSC, 0.1% SDS at 50°C; 2) medium stringency hybridization conditions are hybridization in 6X SSC at about 45°C, followed by a wash in 0.2X SSC, 0.1% SDS at 60°C; 3) high stringency hybridization conditions are hybridization in 6X SSC at about 45°C, followed by a wash in 0.2X SSC, 0.1% SDS at 65°C; 4) very high stringency hybridization conditions are hybridization in 0.5 M sodium phosphate, 7% SDS at 65°C, followed by a wash in 0.2X SSC, 1% SDS at 65°C. High stringency conditions (3) are preferred, and should be used unless otherwise specified.

[0088] As a more preferred embodiment, the native enzyme is present in Pseudomonas putida S16. Pseudomonas putida S16 has the accession number CCTCC NO. M205038, deposited at the China Center Type Culture Collection on April 18, 2005; in addition, the strain is also deposited at the German National Culture Collection (DSMZ) with the accession number DSM 28022.

[0089] As a preferred embodiment, the natural enzyme has a product release channel, and the amino acid having a side chain located in the product release channel of the natural enzyme includes at least one of tryptophan, tyrosine, phenylalanine, glutamic acid and methionine; and the improvement includes replacing the at least one of tryptophan, tyrosine, phenylalanine, glutamic acid and methionine having a side chain located in the release channel of the natural enzyme with an amino acid having a smaller side chain.

[0090] As used herein, "product release channel" shall be understood as the path that a product needs to pass through from the beginning of leaving the reaction active center of an enzyme to a position where it does not affect the catalytic reaction of the enzyme at all. Generally, the reaction active center of an enzyme is located in a cavity of the three-dimensional structure of the enzyme, and the same is true for the artificial enzyme or enzyme disclosed in the present application. The path that a product needs to pass through from the beginning of leaving the reaction active center of an enzyme to a position where it does not affect the catalytic reaction of the enzyme at all is at least partially wrapped by some structures, and the degree of wrapping varies from enzyme to enzyme. Therefore, the path that a product needs to pass through from the beginning of leaving the reaction active center of an enzyme to a position where it does not affect the catalytic reaction of the enzyme at all can be understood as being in the form of a "channel".

[0091] As used herein, "the side chain of an amino acid is located in the product release channel" shall be understood as that, from the perspective of the three-dimensional structure of an enzyme, the side chain of the amino acid more or less affects the product release efficiency or the catalytic efficiency of the enzyme. For example, if the product release efficiency or the catalytic efficiency of the enzyme can be improved by replacing the amino acid with an amino acid having a smaller side chain, the side chain of the amino acid can be considered to be located in the product release channel.

[0092] As a more preferred embodiment, the amino acid having a side chain located in the product release channel of the natural enzyme includes at least 9 amino acids selected from tryptophan, tyrosine, phenylalanine, glutamic acid and methionine.

[0093] As a more preferred embodiment, the three-dimensional structure of the natural enzyme includes at least one β sheet and one α helix located in the release channel, and 3 of the 9 amino acids are located in the β sheet, which are phenylalanine at position 353, phenylalanine at position 355 and tryptophan at position 364 in terms of relative position; and 3 of the 9 amino acids are located in the α helix, which are phenylalanine at position 163, tyrosine at position 214, tyrosine at position 218, tyrosine at position 242, methionine at position 246 and glutamic acid at position 249 in terms of relative position.

[0094] The "in terms of relative position" in the amino acid sequence as used herein shall be understood as that the position number of an amino acid in a sequence only represents the relative position of the amino acid. For example, for the phenylalanine at position 353 and the phenylalanine at position 355 as mentioned above, only represents that the position of the former and the latter is 2 apart; if a sequence of x amino acids is added to the N-terminus of the whole protein sequence, the position number of the former is 353+x and the position number of the latter is 355+x in terms of absolute position; if a sequence of x amino acids is removed from the N-terminus of the whole protein sequence, the position number of the former is 353-x and the position number of the latter is 355-x in terms of absolute position; if in terms of relative position, the "phenylalanine at position 353" and the "phenylalanine at position 355" shall also be understood as including the two cases.

[0095] Another aspect of the present application is to provide an enzyme having one or more of the following characteristics:

[0096] 1) the amino acid sequence of the enzyme comprises an amino acid sequence having 85% or more, or 90% or more, or 95% or more, or 98% or more, or 99% or more homology with the amino acid sequence shown in SEQ ID NO: 2; or the amino acid sequence of the enzyme comprises the amino acid sequence shown in SEQ ID NO: 2; or the amino acid sequence of the enzyme is shown in SEQ ID NO: 2;

[0097] 2) the enzyme is encoded by a nucleic acid which, under high stringency conditions, hybridizes with the complementary strand of a nucleic acid encoding a protein whose amino acid sequence is shown in SEQ ID NO: 2;

[0098] 3) the amino acid sequence of the enzyme comprises an amino acid sequence in which the amino acid sequence shown in SEQ ID NO: 2 is conservatively substituted;

[0099] wherein, in terms of relative position, at least one of the amino acid at position 353, the amino acid at position 355 and the amino acid at position 364 of the enzyme is a first small molecular weight amino acid; and at least one of the amino acid at position 163, the amino acid at position 214, the amino acid at position 218, the amino acid at position 242, the amino acid at position 246 and the amino acid at position 249 of the enzyme is a second small molecular weight amino acid, the molecular weight of the first small molecular weight amino acid being below 140, and the molecular weight of the second small molecular weight amino acid being below 110.

[0100] "Conservative substitutions" as used herein are understood to be those substitutions of a given amino acid in a polypeptide with another amino acid of similar properties. Typically, the following substitutions are considered conservative: replacement of aliphatic amino acids such as Ala, Val, Leu and He with another aliphatic amino acid; replacement of Ser with Thr and vice versa; replacement of acidic residues such as Asp or Glu with another acidic residue; replacement of amide-containing residues such as Asn or Gin with another amide-containing residue; replacement of basic residues such as Lys or Arg with another basic residue; replacement of aromatic residues such as Phe or Tyr with another aromatic residue.

[0101] Functionally equivalent amino acids are generally similar in size and / or character (e.g., charge or hydrophobicity) to the amino acids they replace. Amino acids of similar character can be grouped as follows:

[0102] (1) Hydrophobic: His, Trp, Trp, Tyr, Phe, Met, Leu, He, Val, Ala;

[0103] (2) Neutral Hydrophobic: Cys, Ser, Thr;

[0104] (3) Polar: Ser, Thr, Asn, Gin;

[0105] (4) Acidic / Negatively Charged: Asp, Glu;

[0106] (5) Charged: Asp, Glu, Asn, Lys, His;

[0107] (6) Basic / Positively Charged: Asn, Lys, His;

[0108] (7) Basic: Asn, Gin, His, Lys, Arg;

[0109] (8) Residues that influence chain orientation: Gly, Pro; and

[0110] (9) Aromatic: Trp, Tyr, Phe, His.

[0111] Another aspect of the present application is to provide an enzyme having an activity to catalyze the reaction from compound I to compound II as shown below,

[0112]

[0113] or the enzyme is nicotine dehydrogenase;

[0114] The enzyme has a product release channel, characterized in that the molecular weight of the amino acid whose side chain is located at the narrowest part of the product release channel is below 140.

[0115] The "amino acid whose side chain is located at the narrowest part of the product release channel" as used herein should be understood as the amino acid that is most hindered in the path that the product needs to take from the beginning of its exit from the active center of the enzyme to a position where it does not affect the catalytic reaction of the enzyme any more.

[0116] The present application is further described in detail below with reference to specific examples.

[0117] The materials used in the present application, if not specifically stated, can be obtained by direct purchase. The experimental methods used in the present application, if not specifically stated, are the conventional methods in the art.

[0118] Example 1: Cloning, expression and purification of wild-type nicotine dehydrogenase (NicA2) and NicA2 N-terminal truncation (NicA2Δ20)

[0119] 1. Cloning of NicA2: The full-length gene sequence of NicA2 protein was obtained by the Xuping research group in advance, as shown in SEQ ID NO: 4. The full-length sequence of NicA2 was amplified from Pseudomonas putida S16 (CCTCC No. M205038) bacterial solution by PCR method using primers NicA2-F1 and NicA2-R1, and then ligated into pET28a vector after NcoI and XhoI digestion, and the vector has a 6-histidine tag at the carbon terminal. The primer sequences are:

[0120] NicA2-F1: 5'-ATACCATGGTGAGTGATAAAACAAAAACAAATGAAG-3';

[0121] NicA2-R1: 5'-GTGCTCGAGGCTTAAGAGCTGCTTAACCTCCCTA-3'.

[0122] 2. Expression of NicA2: After the recombinant plasmid pET28a-NicA2 was sequenced correctly, it was transformed into the expression vector Escherichia coli BL21 (DE3), and single colonies were picked for expression detection. The colonies determined to have protein expression were cultured at 37°C, 220 rpm, and when the OD 600 of the bacterial solution was 0.6-0.8, 0.2 mM isopropyl thiogalactoside was used for induction at 16°C for 16 hours.

[0123] 3. Purification of NicA2: After centrifugation of the induced bacterial solution, the bacterial pellet was collected and resuspended. The bacteria were broken by 1500 bar pressure and then centrifuged at high speed. The protein in the supernatant was collected by a pre-packed and equilibrated Ni-NTA gravity column (purchased from Qiagen, Cat. No. 30430). The non-specifically bound impurities were removed by 20 mM and 50 mM imidazole. The target protein was eluted by 80 mM, 170 mM and 300 mM imidazole. The target protein was de-imidazolized by a superdex 200 column (purchased from GE, Cat. No. 28-9909-44) and then concentrated to 12 mg / mL by using a 30 KD ultrafiltration tube (Millipore) at a speed of no more than 5000 rpm for the purpose of crystal seeding. The purified protein was verified by performing a polyacrylamide gel electrophoresis, as shown in Figure 1, and the purity of the protein reached more than 90%. Figure 1

[0124] 4. Cloning, expression and purification of NicA2Δ20: The NicA2 N-terminal truncated protein (NicA2Δ20) was obtained by cloning, expression and purification according to the above method.

[0125] The primers used for cloning were NicA2-F2 and NicA2-R1, and the obtained recombinant plasmid was pET28a-NicA2Δ20.

[0126] NicA2-F2: ATACCATGGCAGTCGTAACAGCAGGTGTTGCGGGA;

[0127] NicA2-R1: GTGCTCGAGGCTTAAGAGCTGCTTAACCTCCCTA

[0128] Example 2: Crystallization and crystal diffraction of wild-type nicotine dehydrogenase (NicA2), NicA2 N-terminal truncated protein (NicA2Δ20) and NicA2Δ20-nicotine co-crystal

[0129] ​1. Crystallization of NicA2: The full-length NicA2 protein was crystallized by sitting-drop method at 14°C. Hampton Research (Cat. No. HR2-109) protein crystallization kit was used to set up the crystallization experiment in a 48-well plate. 1 μL protein and 1 μL crystallization reagent (reservoir solution) were mixed to set up the crystallization. After about one week, the growth of crystals was observed under microscope. After two weeks, the growth of crystals was stopped. The conditions for the growth of crystals were: Index-65: 0.1 M Ammonium acetate, 0.1 M BIS-TRIS pH 5.5, 17% w / v Polyethylene glycol 10,000; Salt RX2-36: 1.4 M Ammonium tartrate dibasic, 0.1 M Tris pH 8.5.

[0130] 2. Crystal diffraction of NicA2: The crystals grown under Index-65 condition were subjected to X-ray diffraction. There were almost no diffraction spots, and the repeated experiments did not grow crystals, so this condition was abandoned. The crystals grown under Salt RX2-36 condition were subjected to X-ray diffraction. The resolution was about 2.5-3.0 A, and the diffraction spots were tailing, indicating that the crystals grown under this condition were irregularly stacked inside.

[0131] The optimization of the full-length NicA2 protein crystals after the initial screening experienced the optimization of the concentration of the precipitant and the optimization of the addition of seeds, but the diffraction of the obtained crystals was still poor.

[0132] 3. Crystallization and crystal diffraction of NicA2Δ20: After sequence alignment, 20 amino acids at the N-terminus were truncated, which were not conserved. The sequence alignment was performed in NCBI, and the proteins such as nicotine amine oxidase HZN6 (NCBI Accession No. AGH68979.1), (S)-6-hydroxynicotin-oxidase (NCBI Accession No. AGS16700.1), and amine oxidase (NCBI Accession No. AEJ14619.1) were aligned.

[0133] According to the cloning, expression, and purification method in Example 1, the purified NicA2Δ20 protein was obtained, and the crystal initial screening was performed according to the above method. The crystals with improved appearance still appeared in the crystallization reagent of Salt RX2-36: 1.4 M Ammonium tartrate dibasic, 0.1 M Tris pH 8.5. The crystals of NicA2Δ20 were then subjected to the optimization steps such as the exploration of the concentration of the precipitant, micro-seeding, and the change of the ratio of the protein and the crystallization reagent, and the X-ray diffraction resolution of 2.2 A was obtained. ​crystals. The concentration of the precipitant is best at 1.4 M Ammonium tartrate dibasic. The microscope observation of the crystals is shown in Fig. 1. Figure 2

[0134] 4. Selenium labeling of NicA2Δ20 and crystal diffraction:

[0135] NicA2Δ20 has only 28% identity with the published protein amino acid sequences in Protein Data Bank (PDB), so simple molecular replacement cannot solve the structure of NicA2. Therefore, only by purifying the selenium-labeled protein, the phase can be determined by the anomalous scattering of selenium atom in the amino acid, and then the structure can be solved.

[0136] The recombinant plasmid pET28a-NicA2Δ20 was transformed into the host Escherichia coli B834 (DE3). The selenium-labeled protein was purified by the method in Example 1. The host is a methionine-deficient strain. In the inorganic salt medium, glucose and yeast inorganic nitrogen source are used as nutritional ingredients, and selenium-labeled methionine is added to replace normal methionine, so that selenium-labeled NicA2, i.e. SeMet-NicA2Δ20, can be expressed. The specific expression and purification steps of SeMet-NicA2Δ20 are described in Example 1. SeMet-NicA2Δ20 was subjected to crystal primary screening, and under the condition of Salt RX2-36: 1.4 M Ammonium tartrate dibasic, 0.1 M Tris pH 8.5, crystals with better appearance were obtained. After optimization of the ratio of crystal protein and precipitant, crystals with an X-ray diffraction resolution of 1.8 A were obtained.

[0137] 5. Crystallization and crystal diffraction of NicA2Δ20-nicotine co-crystal: NicA2Δ20 protein crystals were used to soak in a high-concentration nicotine solution to obtain NicA2Δ20-nicotine co-crystals. Pure nicotine was diluted with the crystal growth buffer (the composition of the buffer is described above) to form a nicotine stock solution with a concentration of 1 M and a pH of 8.5; sodium dithionite (sodium hydrosulfite) was dissolved in the crystal growth buffer to form a sodium dithionite stock solution with a concentration of 100 mM and a pH of 7.0. In the mixed buffer for soaking the crystals, the final concentration of nicotine was 10 mM, and the final concentration of sodium dithionite was 20 mM. The sodium dithionite solution creates an oxygen-free environment. The best crystal was quickly soaked in the nicotine + sodium dithionite mixed solution for 30 seconds to maximize the capture of the moment when NicA2 binds to the substrate nicotine. The nicotine-soaked crystals were quickly frozen in liquid nitrogen. Finally, NicA2Δ20-nicotine crystals with an X-ray diffraction resolution of 2.0 A were obtained. ​​​

[0138] Example 3: Structure analysis of nicotine dehydrogenase NicA2

[0139] 1. Structure analysis of NicAΔ20: The X-ray diffraction data of SeMet-NicA2Δ20 crystal obtained in Example 2 was processed by HKL2000 software, and the structure of SeMet-NicA2Δ20 was initially analyzed by using phenix program. The structure of NicAΔ20 was finally analyzed by using the selenium structure as a template, through isomorphous replacement, and the crystal structure was refined by using programs coot and ccp4.

[0140] 2. Structure analysis of NicA2Δ20-nicotine crystal: The NicA2Δ20-nicotine crystal obtained in Example 2 was used as a model, and the structure of NicA2Δ20 and the substrate nicotine co-crystal was finally analyzed by using molecular replacement method, as shown in Figure 3 .

[0141] 3. Structure analysis:

[0142] Crystallographic snapshots of the complete reaction cycle of nicotine degradation by an amine oxidase of the monoamine oxidase (MAO) family, published in PNAS in 2011, analyzed the structure of 6-hydroxy-l-nicotine dehydrogenase (6HLNO), the first dehydrogenase in the metabolic pathway of nicotine in another strain capable of efficiently degrading nicotine, and analyzed the channel for the substrate 6-hydroxy-nicotine to enter the catalytic site and the product 6-hydroxy-N-methylvanillylamine, 6-hydroxy-pseudo-oxidized nicotine to be released.

[0143] Based on this finding, the similarity of the amino acid sequences of NicA2 and 6HLNO (NCBI accession number: YP_007988777.1) was compared. Even with only a 28% similarity in amino acid sequences, the crystal structure of NicA2Δ20 showed some similarity to the previously reported 6HLNO structure in the Arthrobacterium nicotine degradation pathway, while also exhibiting significant differences. The most obvious difference is that diacylglycerol phospholipids are bound in 6HLNO, a phenomenon absent in NicA2Δ20. The α3a and α3b helices of NicA2Δ20 have a 45-degree rotation compared to their corresponding helices in 6HLNO. These two α-helices are aligned with the nicotine-binding region, resulting in a more tighter encapsulation of the nicotine substrate by NicA2Δ20 compared to 6HLNO, while 6HLNO encapsulates the substrate 6-hydroxy-l-nicotine (6HLN). In other words, the absence of lipid molecules causes NicA2Δ20 to form a more compact structure, confining its nicotine degradation products, N-methylmethoxamine and pseudo-oxidized nicotine, to a narrow active site pocket within NicA2Δ20.

[0144] Based on the report on pseudo-oxidized nicotine in PNAS (Galina Kachalova et al., Crystallographic snapshots of the complete reaction cycle of nicotine degradation by an amine oxidase of the monoamine oxidase (MAO) family, [J] PNAS, 108(12): 4800-4805), a corresponding product release channel was also found in the NicA2Δ20 structure. Interestingly, the substrate nicotine is completely embedded inside NicA2Δ20, and no trace of nicotine can be found whether looking inward from the substrate entry channel or the product release channel (e.g., Figure 3 As shown in a), only by adjusting the surface grayscale of NicA2Δ20 to transparent can one see that nicotine is deeply embedded in the pocket of the active site (as shown in a diagram). Figure 3 (As shown in b). Careful analysis of the product release pathway revealed that this pathway is blocked by nine large amino acids: W364 (tryptophan), Y214 (tyrosine), Y218 (tyrosine), F355 (phenylalanine), F353 (phenylalanine), E249 (glutamate), F163 (phenylalanine), M246 (methionine), and Y242 (tyrosine) (as shown in b). Figure 3 (As shown in b and c). Therefore, it is speculated that this extremely confined channel likely strongly prevents the release of the product pseudo-oxidized nicotine from NicA2Δ20.

[0145] In addition, the full wavelength scanning experiment and gas chromatography (GC) experiment also proved that the characteristics of NicA2 being "completely embedded" and "extremely bound" on the structure greatly hindered the release of the product pseudooxynicotine. Among them, the full wavelength scanning experiment proved that NicA2 catalyzed the dehydrogenation of nicotine quickly, and the gas chromatography (GC) experiment proved that the release of the product pseudooxynicotine from NicA2 was very slow. Specifically as follows:

[0146] Previous experiments observed that when an equimolar amount of substrate nicotine was added to a 1 mL 10 mg / mL NicA2 protein solution, the bright yellow color of the NicA2 protein solution instantly turned colorless and transparent. Considering that the prosthetic group of NicA2 is FAD and the function of NicA2 is to catalyze the dehydrogenation of nicotine, it can be considered that the process of NicA2 catalyzing the dehydrogenation of nicotine and transferring hydrogen to FAD to oxidize it to FADH2 is instantaneous. That is, the reaction of nicotine dehydrogenation to pseudooxynicotine is quickly catalyzed by NicA2. UV-Scan experiment detected that when nicotine was added to the NicA2 solution, the characteristic ultraviolet absorption peak of FAD (375 mm, 450 mm) quickly disappeared.

[0147] Subsequently, gas chromatography was used to detect the total amount of pseudooxynicotine and the amount of pseudooxynicotine released outside the protein after 1.5 hours of reaction in a 1 mL 10 mg / mL NicA2 solution after an equimolar amount of nicotine was added.

[0148] Among them, the sample after 1.5 hours of reaction was extracted with chloroform-benzyl alcohol for pseudooxynicotine, and the total amount of pseudooxynicotine generated by the reaction was quantitatively detected by GC. Repeat the Ni-NTA column until the effluent is detected to have a NicA2 concentration of less than 0.1 mg / mL, and it is considered that NicA2 has been completely combined on the nickel column. The effluent was extracted with chloroform-benzyl alcohol for pseudooxynicotine, and the amount of pseudooxynicotine released from NicA2 into the solution was quantitatively detected by GC. The results showed that about 75% of the pseudooxynicotine remained in the NicA2 protein.

[0149] Example 4: Construction of Nicotine Dehydrogenase Mutant

[0150] The positions of the nine large amino acids obtained in Example 3 on the crystal structure of NicA2Δ20 were analyzed, and the amino acids located on the β-pleated sheet were replaced with valine (V), and the amino acids located on the α-helix were replaced with alanine (A). The basic principle of the amino acid replacement was to replace the amino acids with large side chain groups with the amino acids with small side chain groups, while considering that alanine is the simplest amino acid in structure and is a strong α-helix former; valine is also simple in structure and is a relatively strong β-former. Finally, F163, Y214, Y218, Y242, M246, and E249 were mutated to alanine, and F353, F355V, and W364V were mutated to valine, and the mutant was named NicA2-M9. The above-mentioned mutations were achieved by designing the DNA sequence after mutation, and the DNA sequence after mutation is shown in SEQ ID NO: 3.

[0151] The gene sequence of the above-mentioned nicotine dehydrogenase mutant NicA2-M9 was synthesized by Jinweizhi Company. The synthesized sequence was amplified by PCR method, and the primers used for amplification were: NicA2-F1 and NicA2-R1. The mutant gene fragment obtained by amplification and the vector pET28a were digested with NcoI and XhoI, and the two were connected by T4 ligase to obtain the recombinant plasmid pET28a-NicA2-M9. After the recombinant plasmid was sequenced correctly, it was transformed into the expression host Escherichia coli BL21 (DE3) for expression. The purification method of the expressed nicotine dehydrogenase mutant NicA2-M9 refers to the purification method of NicA2 wild-type protein in Example 1.

[0152] The supernatant, precipitate after cell disruption, and the column effluent, 20 mM imidazole rinse, 50 mM imidazole impurity removal protein, and 170 mM imidazole elution target protein during purification were sampled and detected by polyacrylamide gel electrophoresis. The results are shown in FIG. 2. Figure 4 As shown in FIG. 2, the NicA2-M9 protein has good abundance, and the purity is more than 90%, which meets the requirements of subsequent enzyme activity experiments.

[0153] Example 5: Enzyme activity determination and comparison of wild-type nicotine dehydrogenase and nicotine dehydrogenase mutant

[0154] The enzyme activity of NicA2 wild-type and NicA2 mutant NicA2-M9 was marked by detecting the amount of product N-methylvanillylamine and pseudo-oxidized nicotine using liquid chromatography-mass spectrometry (LC-MS). The LC-MS parameters are as follows: Agilent 1290 liquid chromatograph, EC-C8 column (4.6×100 mm, 1.8 μm), 0.2 mL / min. In positive ion mode, the mass-to-charge ratio (m / z) of N-methylvanillylamine is 161, and the mass-to-charge ratio (m / z) of pseudo-oxidized nicotine is 179.

[0155] The concentrations of N-methylformiminium and pseudonictoine were diluted from the highest concentration of 2 μΜ to the lowest concentration of 31.25 nM, and loaded into the LC-MS instrument. The peaks with the mass-to-charge ratios of 161 and 179 were selected, and the peak areas automatically annotated by the instrument were recorded. The standard curves of the two products were plotted using OriginPro 8.

[0156] 1. Wild-type nicotine dehydrogenase enzyme activity assay:

[0157] The final concentration of the immobilized NicA2 wild-type protein was 10 nM, and the concentration of the substrate nicotine was diluted from the highest concentration of 2 μΜ to the lowest concentration of 12.5 nM. The protein and the substrate were incubated at 30 °C for 20 min, and the reaction was inactivated by adding 2.5 times the volume of acetonitrile. The protein precipitate was removed by centrifugation at 12,000 rpm for 2 min. The sample was loaded into the LC-MS instrument, and the peaks with the mass-to-charge ratios of 161 and 179 were selected. The peak areas automatically annotated by the instrument were recorded. The Michaelis-Menten equation curve was plotted using OriginPro 8, as shown in Figure 5 and Figure 6 .

[0158] The standard curve of the product was combined to calculate the K m and k cat values of the NicA2 wild-type nicotine reaction to generate N-methylformiminium and pseudonictoine. The K m = 24.24 nM, and the k cat = 6.17 x 10 -3 / s for the NicA2 wild-type catalyzed nicotine reaction to generate N-methylformiminium. The K m = 19.71 nM, and the k cat = 13.75 x 10 -3 / s for the reaction to generate pseudonictoine.

[0159] 2. Nicotine dehydrogenase mutant enzyme activity assay:

[0160] The NicA2-M9 mutant nicotine dehydrogenase enzyme activity was determined in the same way as the NicA2 wild-type enzyme activity assay. The final concentration of the immobilized NicA2-M9 protein was 10 nM, and the concentration of the substrate nicotine was diluted from the highest concentration of 2 μΜ to the lowest concentration of 12.5 nM. The protein and the substrate were incubated at 30 °C for 20 min, and the reaction was inactivated by adding 2.5 times the volume of acetonitrile. The protein precipitate was removed by centrifugation at 12,000 rpm for 2 min. The sample was loaded into the LC-MS instrument, and the peaks with the mass-to-charge ratios of 161 and 179 were selected. The peak areas automatically annotated by the instrument were recorded. The Michaelis-Menten equation curve was plotted using OriginPro 8, as shown in Figure 7 andFigure 8 Place.

[0161] Based on the standard curve of the products, the Kc of the NicA2-M9 catalyzed nicotine reaction to produce N-methylmacrosine and pseudo-oxidized nicotine was calculated. m and k cat Value. The K-value of NicA-M9 catalyzing the reaction of nicotine to N-methylmacrosine. m =46.61nM,k cat =23.20×10 -3 / s.

[0162] 3. Comparison

[0163] Table 1 shows the K values ​​of wild-type NicA2 and NicA2-M9 for the substrate-catalyzed production of N-methylmacrosine and pseudonicotine oxide. m and k cat Value. A comparison shows that the K-value for the N-methylmacrosine catalyzed by NicA2-M9 is... m It is 1.96 times that of wild-type NicA2, and it catalyzes the pseudo-oxidation of nicotine by K. m It is 2.5 times that of the wild-type NicA2; however, NicA2-M9 catalyzes the formation of N-methylmacrosine with kJ. cat It is 3.76 times that of wild-type NicA2, and catalyzes the pseudo-oxidation of nicotine. cat It is 3.67 times that of wild-type NicA2. This further demonstrates that replacing bulky amino acids with amino acids with simple side chains can effectively accelerate the release of the product pseudo-oxidized nicotine and improve reaction efficiency.

[0164] Table 1 Rate constants for the nicotine reaction catalyzed by wild-type and mutant NicA2.

[0165]

[0166] Example 6: Comparative Analysis of the Properties of Nicotine Dehydrogenase Mutants and Nicotine Blood Concentration

[0167] The results of Example 5 showed that NicA2-M9 catalyzes nicotine at a much higher rate than the wild-type NicA2 protein, while NicA2-M9 has a slightly weaker affinity for nicotine than the wild-type NicA2 protein. Subsequently, the affinity (K) of NicA2-M9 for nicotine was further investigated. m The results, as shown in Table 2, compared the concentration of nicotine in the blood with that of NicA2-M9. The results revealed that even though NicA2-M9 has a slightly weaker affinity for nicotine than the wild-type NicA2 protein, NicA2-M9 catalyzes the K+ kinase of nicotine. m It is also below most concentration ranges of nicotine in the blood.

[0168] Table 2 Comparison of affinity of NicA2 mutants to nicotine and the highest nicotine concentration in blood

[0169]

[0170] Example 7: Nicotine dehydrogenase mutant reengineering of original metabolic pathway

[0171] The NicA2 wild type and NicA2-M9 gene sequences were linked to the shuttle plasmid pME6032 to obtain the pME6032-NicA2 plasmid and the pME6032-NicA2-M9 plasmid. The pME6032 plasmid can respond well to isopropyl thiogalactoside induction. The recombinant plasmid was electroporated into Pseudomonas putida S16, and the pME6032 empty plasmid, the recombinant fragment of pME6032-NicA2-M9+pNAO plasmid with the NicA2-M9 gene sequence and the downstream catalytic pseudooxynicotine protein pseudooxynicotine AO gene sequence (pseudooxynicotine AO can efficiently catalyze pseudooxynicotine) were also electroporated, which were used as two groups of controls, respectively.

[0172] The Pseudomonas putida S16 transformed with the above four plasmids was cultured in an inorganic salt medium with nicotine as the sole carbon and nitrogen source. When the OD 600 value was 0.6, 3 mg / mL nicotine and 0.8 mM isopropyl thiogalactoside were added to induce protein expression. 2 mL of supernatant of the bacterial solution collected at 0-5 hours after induction was freeze-dried, and pseudooxynicotine was extracted with benzyl alcohol-chloroform and then loaded onto a gas chromatograph. The amount of pseudooxynicotine was detected by the standard curve of pseudooxynicotine drawn in advance.

[0173] As shown in Figure 9 , the experimental results prove that, compared with the pME6032 empty plasmid and the pME6032-NicA2 plasmid (i.e. the legend s16(NicA2-WT) of Figure 9 ), the pME6032-NicA2-M9 plasmid (i.e. the legend s16(NicA2-9MT) of Figure 9 ) significantly improves the release amount of pseudooxynicotine. When the NicA2-M9 is recombined with the pseudooxynicotine AO (i.e. the legend s16(NicA2-9MT+pNAO) of Figure 9 ), the pseudooxynicotine AO degrades the pseudooxynicotine, which can significantly reduce the release amount of pseudooxynicotine. This further confirms that the increase in the release amount of pseudooxynicotine is caused by the reengineering of the NicA2 protein.

[0174] Example 8:

[0175] Similar to Example 4, the positions of the nine bulky amino acids obtained in Example 3 on the crystal structure of NicA2Δ20 were analyzed, and the following mutations were made:

[0176] (1) F353, F355 and W364 were mutated to valine, and the mutant was named NicA2-M3V;

[0177] (2) F353, F355 and W364 were mutated to alanine, and the mutant was named NicA2-M3A;

[0178] (3) F353, F355 and W364 were mutated to valine, and Y214 and Y218 were mutated to alanine, and the mutant was named NicA2-M5;

[0179] (4) F353, F355 and W364 were mutated to valine, and Y214, Y218, F163 and E249 were mutated to alanine, and the mutant was named NicA2-M7.

[0180] As can be seen from Figure 1A, the product release channel of wild-type NicA2 is blocked by the nine bulky amino acids described above. By mutating various combinations of the nine bulky amino acids, it can be seen from Figure 1B that the product release channels of NicA2-M3V mutant (B), NicA2-M3A mutant (C), NicA2-M5 mutant (D), NicA2-M7 mutant (E) and NicA2-M9 mutant (F) are widened to varying degrees. In combination with the above-mentioned activity experiments for the NicA2-M9 mutant, one skilled in the art can understand that replacing the bulky amino acids that block product release with smaller amino acids can have the good effect of accelerating product release and improving reaction efficiency. Figure 10 Figure 10 One skilled in the art can also know that as long as some or all of the bulky amino acids that block product release are replaced with smaller amino acids, the product release rate of NicA2 can be improved. The mutations listed in the examples are only illustrative.

[0181] One skilled in the art can also know that as long as some or all of the bulky amino acids that block product release are replaced with smaller amino acids, the product release rate of NicA2 can be improved. The mutations listed in the examples are only illustrative.

[0182] Example 9: Commonality of the phenomenon that nicotine dehydrogenase contains nine bulky amino acids that block substrate release among members of the monoamine oxidase family

[0183] The amino acid sequence of NicA2 was aligned with the amino acid sequences of a total of 10 proteins in the monoamine oxidase family, including monoamine oxidase A (MAO-A) and monoamine oxidase B (MAO-B), using the sequence alignment software Vector NTI, and the results are shown in Figure 2. Figure 11 ​The nine large amino acids found to hinder substrate release by NicA2 were found to be somewhat conserved among family members (see Figure 2). Figure 11 The alignment of the amino acids found that the nine large amino acids found to hinder substrate release by NicA2 were also almost all bulky side chains in the corresponding amino acids of the family members.

[0184] The structures of monoamine oxidase A and B have been reported, and structural analysis suggests that their substrates are also buried in an "aromatic tunnel" of aromatic amino acids, which is very similar to NicA2 (J. Mol. Biol. 338, 103-114; Proc. Natl. Acad. Sci. USA 100, 9750-9755), which makes us reasonably explain the phenomenon that the product channel of monoamine oxidase A and B is blocked by large amino acids. Monoamine oxidases are mitochondrial transmembrane proteins that are mainly responsible for the transmission of neurotransmitters. An important substrate of monoamine oxidase A is serotonin, which catalyzes the further conversion of serotonin into melatonin. It is worth noting that serotonin is highly contained in the cerebral cortex and synapses, which can make the body excited, while melatonin is a tranquilizer and sleep-inducing substance; an important substrate of monoamine oxidase B is tetrahydropteridine, and its catalytic product is a neurotoxin that causes Parkinson's disease.

[0185] Similar to NicA2, the substrates of monoamine oxidase A and B, especially the products, are trace but functionally significant small molecules, and it can be imagined that the protein buries the product release channel with large amino acids, which is actually a controlled release mechanism for the product.

[0186] The foregoing detailed description of the preferred embodiments of the application has been presented for the purposes of illustration and description. It is understood that the application in its broadest aspects is not limited to the preferred embodiments disclosed, but is capable of many modifications and variations and is only limited by the claims. It is intended that the specification be considered as exemplary only with the true scope of the application being indicated by the following claims.

Claims

1. An enzyme mutant derived from a sequence modification of a natural enzyme, said enzyme mutant possessing catalytic activity for the reaction of conversion of compound I to compound II as shown below. , It also has a product release channel for product release. Its features are, The improvement includes replacing at least one of the amino acids that hinder product release in the product release channel with an amino acid with a smaller side chain, specifically by mutating phenylalanine at position 353, phenylalanine at position 355, and tryptophan at position 364 of the amino acid sequence shown in SEQ ID NO: 1 to alanine. The improvement also includes removing the first 20 amino acids of the amino acid sequence shown in SEQ ID NO: 1; The enzyme mutant was prepared based on the sequence modification of natural nicotine dehydrogenase, which is present in *Pseudomonas putida* S16 (…). Pseudomonas putida In S16).

2. The nucleotide sequence encoding the enzyme mutant according to claim 1.

3. An expression vector or host cell containing the nucleotide sequence according to claim 2.

4. The application of the enzyme mutant according to claim 1 in the degradation of nicotine in tobacco or the environment.

5. The use of the enzyme mutant according to claim 1 in the preparation of a medicament for treating nicotine addiction.

6. The application of the enzyme mutant according to claim 1 in the preparation of enzyme preparations for biocatalytic transformation; in, The enzyme preparation used for biocatalytic transformation catalyzes the conversion of compound I into compound II as shown below: 。

Citation Information

Patent Citations

  • Pseudomonas sp.HZN6 and application thereof to nicotine degradation

    CN102796681A

  • Reducing levels of nicotinic alkaloids in plants

    EP1861501A2