Promoter suitable for Corynebacterium stagnans and its application

Abstract

The present invention provides a promoter suitable for Corynebacterium stagnans and its application. The promoter suitable for Corynebacterium stagnans has a nucleotide sequence as shown in SEQ ID NO: 7, SEQ ID NO: 5 and / or SEQ ID NO: 6. The present invention achieves high-level expression of a target protein of Corynebacterium stagnans by introducing the promoter into Corynebacterium, thereby overcoming the problems of low strength of existing promoters, difficulty in expressing metabolites and proteins in coryneform bacteria, and low expression efficiency, thereby achieving the purpose of further improving the synthesis of the target protein, and achieving GFP protein and α-amylase expression levels 2.63 times and 2.36 times higher than those of the existing Corynebacterium Psod promoter.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a promoter suitable for Corynebacterium stagnans and its application. Background Art

[0002] Gene expression refers to the process by which genes produce biologically active RNA or protein through transcription and translation, expressing the genetic information they store, and is regulated by multiple factors at different levels. Whether in eukaryotic organisms or prokaryotes, most regulatory events occur at the transcription level. Transcription is not only the first step in gene expression, but also a key step in controlling gene activity; and promoters are important participants in transcriptional level regulation.

[0003] Promoters are a DNA sequence that RNA polymerase recognizes and binds to start transcription. They contain conserved sequences required for RNA polymerase specific binding and transcription initiation, and most are located upstream of the transcription start site of the structural gene. Such promoters themselves are not transcribed, but some promoters (such as tRNA promoters) are located downstream of the transcription start site, and these DNA sequences can also be transcribed. The activity of promoters is affected by many factors, and in heterologous gene expression, it is often necessary to select promoters with different activities according to actual needs.

[0004] Corynebacterium microorganisms are an important genus of bacteria. Many rod-shaped bacteria are used as model strains for industrial production, and many are used as hosts for the production of proteins and high-quality metabolites. Currently, efficient production of a variety of proteins, amino acids, metabolites, etc. has been achieved. However, there are still problems in the difficulty of expressing metabolites and proteins in Corynebacterium and the low expression efficiency. Summary of the invention

[0005] In order to overcome the deficiencies of the prior art, the present invention provides a promoter suitable for Corynebacterium stagnans to solve the problems of difficulty in expressing metabolites and proteins and low expression efficiency in Corynebacterium in the prior art.

[0006] The purpose of the present invention is to provide a promoter suitable for Corynebacterium stagnantum, wherein the promoter sequence is any one of SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7.

[0007] The promoter suitable for Corynebacterium stagnantum is used in the efficient expression of target protein. The promoter of the present invention is introduced into Corynebacterium stagnantum to improve the ability of Corynebacterium stagnantum to produce target protein.

[0008] In order to achieve the above object, the present invention adopts the following technical measures:

[0009] In order to obtain a promoter suitable for Corynebacterium stagnans, a promoter library was constructed. The core regions -35 and -10 of the promoter library template were derived from the pyruvate carboxylase (Pyc) promoter sequence of Corynebacterium glutamicum ATCC13032, and the promoter core sequence is shown below:

[0010] NNNNNNTTGATTNNNNNNNNNNNNNNNTANNATNNNNNN

[0011] A promoter suitable for Corynebacterium stagnans, wherein the promoter sequence is shown in SEQ ID NO: 5; or SEQ ID N: 6; or SEQ ID NO: 7:

[0012] SEQ ID NO.5:

[0013] AACCGGTTGATTTAAAGATCCTTAGGATATCATTCAATT;

[0014] SEQ ID NO.6:

[0015] TGAAAATTGATTTAAACTTGGGCATGTTAAGATAAGTGG;

[0016] SEQ ID NO.7:

[0017] AGATTATTGATTTTCCGTGTTAGCCGTTATCATAGTAGC;

[0018] The promoter suitable for Corynebacterium stagnantum is used to increase the expression of the target protein of Corynebacterium stagnantum. The promoter provided by the present invention is introduced into Bacillus licheniformis to increase the protein expression; the promoter is used to start the expression of the target gene to increase the protein expression.

[0019] In the above application, preferably, the target protein is green fluorescent protein and α-amylase;

[0020] In the above application, preferably, the stagnant bacterium is stagnant bacterium ATCC6872.

[0021] The promoters suitable for Corynebacterium stagnans provided in the above embodiments and their application in highly efficient expression of target products have the following beneficial effects:

[0022] 1. The present invention achieves high-level expression of the target protein of Corynebacterium by introducing a promoter into Corynebacterium, thereby overcoming the problems of low strength of the existing promoter, difficulty in expressing metabolites and proteins in Corynebacterium, and low expression efficiency, thereby achieving the purpose of further improving the synthesis of the target protein, and achieving GFP protein and α-amylase expression levels 2.63 times and 2.36 times higher than those of the existing Corynebacterium Psod promoter.

[0023] 2. By determining the -35 region (6 bp), -10 region (6 bp), and core spacer region (15-18 bp) of the core region of the promoter, a new promoter with expression function is selected and applied to the gene expression and target protein production of Corynebacterium stagnantum, so that the gene mediated by the promoter expression can be effectively expressed throughout the fermentation cycle. Moreover, the core region of the promoter used is derived from the pyruvate carboxylase (Pyc) promoter sequence of Corynebacterium glutamicum ATCC13032, so the promoter can be recognized by the domain of the σ factor in Corynebacterium glutamicum, thereby realizing that the introduced promoter can increase the yield of the target protein of Corynebacterium stagnantum.

[0024] 3. In constructing the promoter library, BsaⅠ restriction sites and extended protection sequences are artificially designed and added to both ends of the promoter to form a promoter template while ensuring that the core region of the promoter is fixed. Designing and adding BsaⅠ restriction sites at both ends of the promoter is not only flexible and practical, suitable for constructing all simple and complex expression vectors, but also makes the subsequent vector construction work fast and efficient, which accelerates the study on the effect of the promoter of the present invention on the production level of the target protein of Corynebacterium stagnantum. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the structures shown in these drawings without paying creative work.

[0026] Figure 1 It is a schematic diagram showing the effect on the secretory expression of GFP under the regulation of the promoter of SEQ ID NO: 5-7;

[0027] Figure 2 It is a schematic diagram showing the effect on the secretory expression of α-amylase under the regulation of the promoter of SEQ ID NO: 5-7. DETAILED DESCRIPTION

[0028] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0029] It should be noted that if the embodiments of the present invention involve directional indications (such as up, down, left, right, front, back, etc.), the directional indications are only used to explain the relative position relationship, movement status, etc. between the components in a certain specific posture. If the specific posture changes, the directional indication will also change accordingly.

[0030] In addition, if there are descriptions involving "first", "second", etc. in the embodiments of the present invention, the descriptions of "first", "second", etc. are only used for descriptive purposes and cannot be understood as indicating or implying their relative importance or implicitly indicating the number of technical features indicated. Therefore, the features limited to "first" and "second" may explicitly or implicitly include at least one of the features. In addition, if "and / or" or "and / or" appears in the full text, its meaning includes three parallel solutions. Taking "A and / or B" as an example, it includes solution A, solution B, or solutions that satisfy both A and B. In addition, the technical solutions between the various embodiments can be combined with each other, but it must be based on the ability of ordinary technicians in this field to implement. When the combination of technical solutions is contradictory or cannot be implemented, it should be deemed that such combination of technical solutions does not exist and is not within the scope of protection required by the present invention.

[0031] The coryneform bacteria of the present invention is Corynebacterium stagnans ATCC6872.

[0032] LB medium (g / l): tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.

[0033] LBB medium (g / l): tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, BHI 10 g / L.

[0034] LBHis medium (g / l): peptone 5 g / L, yeast extract 2.5 g / L, NaCl 5 g / L, BHI 18.5 g / L, sorbitol 91 g / L, agar 16 g / L.

[0035] GFP expression level detection method:

[0036] 0.2 mL of the strain fermentation liquid was added to the EP tube, and then 1.8 mL of deionized water was added to the EP tube. After mixing evenly, the biomass was measured using a visible light spectrophotometer, and the fluorescence intensity was detected using an ELISA instrument and the corresponding fluorescence values ​​were recorded 3 times.

[0037] α-Amylase (amyE) expression level detection method:

[0038] The strain was inoculated into 2 ml of LBB medium (kanamycin with a final concentration of 20 μg / mL was added to the resistant strain) and cultured overnight, and then transferred to 10 ml of LBB medium and cultured at 30°C and 220 rpm for 24 hours to obtain cell fermentation broth. The amylase activity was determined using EnzChek TM Amylase Detection Kit (Cat. No. E33651). The reaction substrate is the supernatant after cell disruption, which is obtained by centrifugation of cell disruption fermentation broth at 6000rpm. One unit of enzyme activity (U / ml) is defined as the amount of enzyme required to release 1 mg of maltose from starch within 3 minutes at 20°C and pH 6.9. Three biological replicates were performed for each strain.

[0039] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0040] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all from commercial channels.

[0041] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor is it a separate or selective embodiment that is mutually exclusive with other embodiments.

[0042] Example 1

[0043] Acquisition of promoter suitable for Corynebacterium stagnans

[0044] The promoter of the present invention is derived from the promoter sequence of pyruvate carboxylase (Pyc) from Corynebacterium glutamicum ATCC13032, and its core region -35, -10 region is determined to generate a promoter library, and its library sequence is:

[0045] TAGCTNNNNNNATNNTANNNNNNNNNNNNNNNAATCAANNNNNNNCAGGT

[0046] Furthermore, a BsaⅠ restriction site and an extension protection sequence were designed and added to both ends of the promoter to form a template (the promoter library was synthesized by GENEWIZ Biotechnology Co., Ltd.). The promoter nucleotide sequence library is as follows:

[0047] AAAGGTCTCTAGCTNNNNNNATNNTANNNNNNNNNNNNNNNAATCAANNNNNNNCAGGTGAGACCCGTGAGCTA

[0048] S1: Use primer Promoter-F (SEQ ID NO.1) to anneal and amplify the obtained promoter library to obtain the promoter double-stranded fragment. Use NanoDrop Spectrophotometer to detect the nucleic acid concentration, 70ng / μL for standby use.

[0049] S2: The obtained double-stranded fragment of the promoter was subjected to GoldenGate reaction with the P19_PTP_KanR_BsaI plasmid vector (SEQ ID NO.2) using T4 ligase and BsaⅠ restriction endonuclease to obtain the recombinant plasmid P19_Promoter_GFP containing the promoter.

[0050] S3: The obtained recombinant plasmid P19_Promoter_GFP was transformed into Escherichia coli DH5α, spread on LB solid culture medium containing 40μL / mL kanamycin and cultured overnight, then the colonies grown on the plate were washed with 2mL LB liquid culture medium containing 40μL / mL kanamycin and placed in a test tube for another overnight culture. The plasmid was extracted and the concentration was detected using NanoDrop Spectrophotometer and stored at 201ng / μL, -20℃.

[0051] S4: The promoter plasmid obtained from S3 is used to introduce P19_Promoter_GFP into Corynebacterium ATCC6872 by electroporation, and the plating is carried out on LBHis solid culture medium, and kanamycin is used as a selection marker to obtain a recombinant strain that fluoresces under blue light.

[0052] S5: A total of 101 recombinant strains obtained from S4 were selected, inoculated into a well plate containing LBB liquid culture medium, cultured at 800rpm / min for 22 hours, and the fermentation liquid was diluted 20 times with water, and OD600 and fluorescence intensity (excitation wavelength 485nm, emission wavelength 515nm) were measured respectively. The standardized GFP expression level was expressed as the ratio of fluorescence intensity to OD600. Finally, three recombinant strains were named C.Sta_P1_GFP, C.Sta_P2_GFP, and C.Sta_P3_GFP, respectively. Colony PCR was performed with primers PF (SEQ ID NO.3) PR (SEQ ID NO.4), and promoters P1, P2, and P3 were obtained by sequencing. The nucleotide sequences are shown in SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7.

[0053] Example 2: Expression of GFP exogenous protein expressed by promoters P1-P3 in Corynebacterium stagnans

[0054] SS1: The nucleotide fragment containing the promoter Psod coding sequence of superoxide dismutase of Corynebacterium glutamicum was amplified using primers Psod-F (SEQ ID NO.8) and Psod-R (SEQ ID NO.9), as shown in SEQ ID NO.10.

[0055] SS2: The obtained double-stranded fragment of the promoter was subjected to GoldenGate with the P19_PTP_KanR_BsaI plasmid vector using T4 ligase and BsaⅠ restriction endonuclease to obtain the recombinant plasmid P19_Psod_GFP containing the Psod promoter.

[0056] SS3: The recombinant plasmid P19_Psod_GFP obtained in SS2 was transferred into Corynebacterium Stagnantum ATCC6872, spread on LBHis solid culture medium, and used kanamycin as a selection marker to obtain the recombinant strain C.Sta-GFP-Psod that fluoresces under blue light.

[0057] SS4: Activation of recombinant strain seeds: Using the stagnant bacillus C.Sta_P0_GFP carrying an empty plasmid as a negative control, the recombinant strains C.Sta-GFP-Psod, C.Sta_P1_GFP, C.Sta_P2_GFP, and C.Sta_P3_GFP were inoculated into 2mL LBB liquid culture medium (20μL / mL kanamycin) and cultured at 30°C and 220rpm for 12 hours to obtain seed culture solution.

[0058] The fermentation medium is LBB medium.

[0059] SS5: The seed culture solution in SS4 was inoculated into a 50 mL Erlenmeyer flask containing 10 mL of LBB fermentation medium at the same initial OD, and the mixture was fermented in a shaker at 30°C and 220 rpm for 24 hours to obtain a fermentation solution.

[0060] SS6: GFP expression level detection: 0.2 mL of the fermentation liquid of the strain was added to the EP tube, and then 1.8 mL of deionized water was added to the EP tube. After mixing evenly, the biomass (OD600) was measured using a visible light spectrophotometer, and then the fluorescence intensity was detected using a microplate reader and the corresponding fluorescence values ​​were recorded 3 times. The standardized GFP expression level was expressed as the fluorescence intensity ratio of OD600.

[0061] SS7: See Figure 1 The experiment proved that: using the stagnant Corynebacterium C.Sta_P0_GFP with an empty plasmid as a negative control, the relative fluorescence intensity was 1.19×10 3 The relative fluorescence intensity of GFP expressed by promoter P1 was 1.30×10 4 The relative fluorescence intensity of GFP expressed by promoter P2 was 2.09×10 4 The relative fluorescence intensity of GFP expressed by promoter P3 was 3.92×10 4 The relative fluorescence intensity of GFP mediated by promoter Psod was 1.66×10 4 The promoter P3 had the best effect, and the GFP fluorescence intensity mediated by the promoter Psod increased by 2.63 times.

[0062] Example 3: Promoters P1-P3 in increasing the expression of α-amylase protein in Corynebacterium stagnans

[0063] S101: Primers amy-F (SEQ ID NO.11) and amy-R (SEQ ID NO.12) were used to amplify the gene sequence containing α-amylase (α-amylase EC3.2.1.1) using the Bacillus subtilis genome as a template as shown in SEQ ID NO.13.

[0064] S102: Use P19-fra1-R (SEQ ID NO.14) and P19-fra1-F (SEQ ID NO.15) to PCR on P19_PTP_KanR_BsaI to obtain fragment 1, and use P19-fra2-F (SEQ ID NO.16) and P19-fra2-R (SEQ ID NO.17) to PCR on P19_PTP_KanR_BsaI to obtain fragment 2. The obtained fragments 1 and 2 and the gene fragment of SEQ ID NO.13 are subjected to Gibson assembly to obtain P19-PTP-amy-kanR_BsaI, and then the promoters psod, P1, P2, P3 and P19_PTP_amy_kanR_BsaI are subjected to GoldenGate to obtain plasmids P19_psod_amy, P19_P1_amy, P19_P2_amy, and P19_P3_amy, respectively.

[0065] S103: The recombinant plasmid obtained in S102 was transferred into Corynebacterium stagnantum ATCC6872, spread on LBHis solid culture medium, and kanamycin was used as a screening marker to obtain recombinant strains C.Sta_Psod_Amy, C.Sta_P1_Amy, C.Sta_P2_Amy, and C.Sta_P3_Amy by sequencing.

[0066] S104: Activation of recombinant strain seeds: Using the C.sta_P0_amy strain carrying an empty plasmid as a negative control, the recombinant strains C.Sta_Psod_Amy, C.Sta_P1_Amy, C.Sta_P2_Amy, and C.Sta_P3_Amy were inoculated into 2mL LBB liquid culture medium (20μL / mL kanamycin) and cultured at 30°C and 220rpm for 12 hours to obtain seed culture solution.

[0067] The fermentation medium is LBB medium.

[0068] S105: The seed culture solution in S103 was inoculated into a 50 mL Erlenmeyer flask containing 10 mL of LBB fermentation medium at the same initial OD, and fermented in a shaker at 30° C. and 220 rpm for 24 hours to obtain a fermentation solution.

[0069] S106: Detection of α-amylase (amyE) expression level: The amylase activity was determined using the EnzChekTM amylase detection kit (Cat. No. E33651). The fermented bacterial broth was centrifuged after cell disruption and the supernatant was obtained at 6000 rpm. One unit of enzyme activity (U / ml) was defined as the amount of enzyme required to release 1 mg of maltose from starch within 3 minutes at 20°C and pH 6.9. Three biological replicates were performed for each strain.

[0070] S107: Please refer to Figure 2 The experiment proved that the enzyme activity of the α-amylase of Corynebacterium stagnantum carrying an empty plasmid was 4.3U / mL; the enzyme activity of the recombinant strain α-amylase mediated by promoter P1 was 6.99U / mL; the enzyme activity of the recombinant strain α-amylase mediated by promoter P2 was 8.7U / mL; the enzyme activity of the recombinant strain α-amylase mediated by promoter P3 was 17.91U / mL; the enzyme activity of the recombinant strain α-amylase mediated by promoter Psod was 7.59U / mL. Promoter P3 had the best effect, which was 2.36 times higher than that of the α-amylase mediated by promoter Psod.

[0071] The above description is only a preferred embodiment of the present invention, and does not limit the patent scope of the present invention. All equivalent structural changes made by using the contents of the present invention specification and drawings under the inventive concept of the present invention, or directly / indirectly applied in other related technical fields are included in the patent protection scope of the present invention.

Claims

1. A promoter suitable for Corynebacterium stagnans, characterized in that The nucleotide sequence thereof is shown in SEQ ID NO:

7.

2. The promoter suitable for Corynebacterium stagnans according to claim 1, characterized in that The nucleotide sequence thereof is also shown in SEQ ID NO:5 and / or SEQ ID NO:

6.

3. Use of the promoter according to any one of claims 1 to 2 in increasing the expression of a target protein in Corynebacterium stagnantum.

4. The use according to claim 3, characterized in that The target protein is any one of fluorescent protein and amylase.

5. The use according to claim 4, characterized in that The target protein is enhanced green fluorescent protein or alpha-amylase.

6. The use according to claim 3, characterized in that The stagnant bacterium is stagnant bacterium ATCC6872.

Images