Glycosyl transferase UGT76G1 mutant and method for catalytically synthesizing rebaudioside M by using glycosyl transferase UGT76G1 mutant

Abstract

The invention discloses a glycosyl transferase UGT76G1 mutant and a method for catalytically synthesizing rebaudioside M by using the glycosyl transferase UGT76G1 mutant, and relates to the technical field of biological catalytic synthesis. The glycosyl transferase UGT76G1 mutant is any one of the following components (A)-(C): (A) a protein obtained by performing any one or more of the following mutations on the basis of an amino acid sequence as shown in SEQ ID NO.1: the 89th amino acid is mutated into H from M; the 380th amino acid is mutated from L to M; the 411th amino acid is mutated from A to Y; (B) a protein which has 95% or 98% or more of identity with the amino acid sequence defined by (A) and has the same function as the amino acid sequence defined by (A); and (C) a fusion protein obtained by connecting a tag to the terminal of the protein defined in (A) or (B). The glycosyl transferase UGT76G1 mutant disclosed by the invention is obtained by mutating and screening glycosyl transferase UGT76G1, has higher catalytic activity, and can be used for efficiently synthesizing rebaudioside M by taking rebaudioside D and UDPG as substrates.

Description

Technical Field

[0001] The invention relates to the technical field of biocatalytic synthesis, and in particular to a glycosyltransferase UGT76G1 mutant and a method for catalyzing the synthesis of rebaudioside M by the mutant. Background Art

[0002] Rebaudioside M is a natural sweetener extracted from stevia and belongs to the steviol glycoside family. Compared with other common steviol glycosides, such as rebaudioside A, rebaudioside M is also very sweet and has a relatively good taste, close to sucrose, and has a low calorie content, so it is often used as an additive in health and weight loss foods.

[0003] Rebaudioside M has undergone rigorous food safety assessments and is considered a safe food additive that can be used in the food and beverage industry to replace traditional sugars, reduce the calories of products without affecting sweetness, and help diabetics and people who control their weight reduce their sugar intake. In addition, Rebaudioside M can avoid some bitterness or aftertaste to a certain extent, so it is used to optimize taste and flavor in high-end food formulations.

[0004] However, the production of rebaudioside M in the prior art is relatively low and cannot meet the high demand of the market. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a glucosyltransferase UGT76G1 mutant and a method for catalyzing the synthesis of rebaudioside M by the mutant, so as to overcome the problem of low yield of rebaudioside M in the prior art.

[0006] In a first aspect, the present invention provides a glycosyltransferase UGT76G1 mutant, wherein the UGT76G1 mutant is any one of the following (A)-(C):

[0007] (A) A protein obtained by causing any one or more of the following mutations based on the amino acid sequence shown in SEQ ID NO.1:

[0008] The 89th amino acid mutated from M to H;

[0009] The amino acid at position 380 mutated from L to M;

[0010] The amino acid at position 411 mutated from A to Y;

[0011] (B) a protein having 95% or more identity with the amino acid sequence defined in (A) and having the same function;

[0012] (C) Fusion protein obtained by ligating a tag to the end of the protein defined in (A) or (B).

[0013] Compared with the prior art, the glycosyltransferase UGT76G1 mutant provided by the present invention is obtained by screening the glycosyltransferase UGT76G1 mutation, has higher catalytic activity, and can use rebaudioside D and UDPG as substrates to efficiently synthesize rebaudioside M.

[0014] Furthermore, the amino acid sequence of the UGT76G1 mutant is shown in SEQ ID NO.3.

[0015] In a second aspect, the present invention provides a biomaterial, comprising any one of the following:

[0016] (A) an expressed gene encoding the above-mentioned glycosyltransferase UGT76G1 mutant;

[0017] (B) a recombinant plasmid containing the expression gene described in (A);

[0018] (C) A recombinant cell comprising the recombinant plasmid described in (B) or the expression gene described in (A).

[0019] The above-mentioned expressed gene is obtained by one or more of the following mutations in SEQ ID NO.2:

[0020] Position 89 of SEQ ID NO.2 is replaced by ATG to CAT;

[0021] The 380th position of SEQ ID NO.2 is replaced by CTC to ATG;

[0022] The 411th position of SEQ ID NO.2 is replaced by GCA to TAT;

[0023] Preferably, the sequence of the above-mentioned expressed gene is as described in SEQ ID NO.4.

[0024] In a third aspect, the present invention provides an enzyme composition, comprising the above-mentioned glycosyltransferase UGT76G1 mutant and sucrose synthase AtSUS;

[0025] Sucrose synthase AtSUS is as follows (B1) or (B2):

[0026] The amino acid sequence of (B1) is shown in SEQ ID NO.5;

[0027] (B2) A protein having an amino acid sequence identity of 95% or 98% or more to that of (B1) and having the same function.

[0028] In a fourth aspect, the present invention provides a method for synthesizing rebaudioside M by using glycosyltransferase UGT76G1, characterized in that rebaudioside D, UDPG and sucrose are used as substrates and the above enzyme composition is used to catalyze the synthesis of rebaudioside M.

[0029] Furthermore, in the catalytic reaction system, the concentration of rebaudioside D is 5-100 mM, the concentration of UDPG is 0.1-5 mM, the concentration of sucrose is 40-800 mM, the amount of glycosyltransferase UGT76G1 mutant enzyme solution added is 0.1-50 mL, and the amount of sucrose synthase AtSUS enzyme solution added is 0.1-50 mL.

[0030] Furthermore, the preparation method of the glycosyltransferase UGT76G1 mutant enzyme solution comprises the following steps:

[0031] (1) constructing the coding gene of the glycosyltransferase UGT76G1 mutant into an expression vector to obtain a recombinant plasmid A, and transforming the recombinant plasmid A into a host bacterium to obtain a recombinant strain A;

[0032] (2) The seed solution of recombinant strain A was inoculated into a culture medium containing kanamycin sulfate for cultivation. 600 When the pH reaches 0.6-0.8, L-arabinose is added and the induction culture is continued at 25-40°C for 8-40 hours, centrifuged, the bacteria are collected and the cells are broken, centrifuged, and the supernatant is the glycosyltransferase UGT76G1 mutant enzyme solution; the inoculation amount is 1v / v%; the final concentration of kanamycin sulfate is 10-100μg / mL; the final concentration of L-arabinose is 0.1-15mM.

[0033] Furthermore, the preparation method of sucrose synthase AtSUS enzyme solution comprises the following steps:

[0034] (1) constructing a sucrose synthase AtSUS encoding gene into an expression vector to obtain a recombinant plasmid B, and transforming the recombinant plasmid B into a host bacterium to obtain a recombinant strain B; the AtSUS encoding gene is shown in SEQ ID NO.6;

[0035] (2) The seed solution of recombinant strain B was inoculated into a culture medium containing kanamycin sulfate for cultivation. 600 When it reaches 0.6-0.8, add L-arabinose and continue to induce culture at 25-40°C for 8-40 hours, centrifuge, collect the bacteria and break the cells, centrifuge, and the supernatant is the sucrose synthase AtSUS enzyme solution; the inoculation amount is 1v / v%; the final concentration of kanamycin sulfate is 10-100μg / mL; the final concentration of L-arabinose is 0.1-15mM.

[0036] Furthermore, the host bacteria include but are not limited to Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris or Corynebacterium glutamicum.

[0037] Furthermore, in the catalytic reaction system, the pH value is 5.0-8.0, the temperature is 25-60° C., and the reaction time is 5-30 hours.

[0038] Compared with the prior art, the present invention couples the glycosyltransferase UGT76G1 mutant with the sucrose synthase AtSUS enzyme, and uses sucrose, UDPG and rebaudioside D as substrates to catalyze the synthesis of rebaudioside M. In this process, the recycling of UDPG is achieved, the consumption of the substrate is reduced, and the fructose generated in the reaction can be quantitatively analyzed to indirectly measure the activity of the glycosyltransferase UGT76G1 mutant, and then the glycosyltransferase UGT76G1 is directed evolution modified according to this feature to improve its catalytic activity. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 The yield of rebaudioside M (RM) under the catalysis of different glycosyltransferase UGT76G1 mutants.

[0040] Figure 2 This is the changing trend of the yield of rebaudioside M (RM) with transformation time. DETAILED DESCRIPTION

[0041] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0042] It should be understood that the raw materials used in the following examples are all commercially available raw materials unless otherwise specified.

[0043] Example 1

[0044] Construction of recombinant Escherichia coli engineered strain AtSUS

[0045] Using Inf-pYB1k-atsus-F and Inf-pYB1k-atsus-R as primers and the cDNA of the sucrose synthase gene atsus from Arabidopsis thaliana as a template, PCR amplification was performed using a high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct atsus gene fragment. The atsus gene fragment sequence is shown in SEQ ID NO.6, and the amino acid sequence of the sucrose synthase atsus is shown in SEQ ID NO.5.

[0046] Inf-pYB1k-atsus-F:

[0047] GCTAACAGGAGGAATTAACCATGGAAAATAAAACGGAGACC(SEQ ID NO.7)

[0048] Inf-pYB1k-atsus-R:

[0049] CCAGATCTACCCTCGAGTTACAACGATGAAATGTAAGAAAC(SEQ ID NO.8)

[0050] Using pYB1k-F and pYB1k-R as primers and the pYB1k empty vector as a template, PCR amplification was performed using a high-fidelity DNA polymerase (Wuhan Abotek Biotechnology Co., Ltd.) to obtain the correct pYB1k expression vector fragment. (You R, Wang L, Shi C, Chen H, Zhang S, Hu M, Tao Y. Efficient production of myo-inositol in Escherichia coli through metabolic engineering. Microb. Cell Fact. 2020 May 24; 19(1): 109. The pYB1k vector has been published.)

[0051] pYB1k-F: CTCGAGGGTAGATCTGGTAC (SEQ ID NO.9)

[0052] pYB1k-R: GGTTAATTCCTCCTGTTAGC (SEQ ID NO.10)

[0053] The atsus gene was connected to the expression vector pYB1k using the Gibson assembly method to obtain the expression vector pYB1k-atsus.

[0054] E. coli DH5α competent cells were prepared by the CaCl2 method (Beijing Quanshijin Biotechnology Co., Ltd.). The Gibson ligation product was added to the DH5α competent cells, reacted on ice for 30 minutes, then reacted in a 42°C water bath for 90 seconds, and then placed on ice for 2 minutes, followed by adding 1 mL of LB medium, and placed on a 37°C shaker for 1 hour to recover, and finally spread on an LB plate containing kanamycin and cultured at 37°C overnight.

[0055] Multiple single clones were selected for culture, and PCR verification was performed using primers pBAD-F and atsus-F300-R. Positive clones with the correct target sequence size were selected for culture, and plasmids were extracted. The obtained positive clone plasmid was named pYB1k-atsus.

[0056] pBAD-F: GATTATTTGCACGGCGTCAC (SEQ ID NO.11)

[0057] atsus-F300-R:CTTGTGGGTCGTTGTCGAGGATG(SEQ ID NO.12)

[0058] E. coli BW25113 competent cells were prepared by the CaCl2 method, and the plasmid pYB1k-atsus1 was transferred into the competent cells of E. coli BW25113, and then spread on LB plates containing kanamycin and cultured at 37°C overnight. Positive clones containing pYB1k-atsus1 were selected to obtain the recombinant E. coli engineered strain AtSUS.

[0059] Example 2

[0060] Construction of a recombinant Escherichia coli strain expressing wild-type glycosyltransferase UGT76G1

[0061] According to the wild-type Stevia rebaudiana glycosyltransferase UGT76G1 nucleotide sequence provided by the NCBI database, Anhui General Biotechnology Co., Ltd. synthesized the entire sequence, and transferred the wild-type glycosyltransferase UGT76G1 nucleotide sequence into the vector pET28a to obtain the recombinant expression vector pET28a-ugt76g1. (PeiWang, Hai-YanZhou, Bo Li, Wen-Qing Ding, Zhi-Qiang Liu, Yu-Guo Zheng, Multiplex modification of Escherichia coli for enhanced β-alanine biosynthesis through metabolic engineering, Bioresource Technology, Volume 342, 2021, 126050. This expression vector has been disclosed).

[0062] Using Inf-pYB1k-ugt76g1-F and Inf-pYB1k-ugt76g1-R as primers and pET28a-ugt76g1 as template, PCR amplification was performed with high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct ugt76g1 gene fragment.

[0063] Inf-pYB1k-ugt76g1-F:

[0064] CTAACAGGAGGAATTAACCATATGGCCGAAAACAAGACCGA(SEQ ID NO.13)

[0065] Inf-pYB1k-ugt76g1-R:

[0066] GTACCAGATCTACCCTCGAGTTACAAAGAGGAAATGTAAG(SEQ ID

[0067] NO.14)

[0068] Using pYB1k-F and pYB1k-R as primers and the pYB1k empty vector as a template, PCR amplification was performed using a high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct expression vector fragment of pYB1k.

[0069] pYB1k-F: CTCGAGGGTAGATCTGGTAC (SEQ ID NO.9)

[0070] pYB1k-R: GGTTAATTCCTCCTGTTAGC (SEQ ID NO.10)

[0071] The ugt76g1 gene was connected to the empty vector pYB1k using the Gibson assembly method to obtain the expression vector pYB1k-ugt76g1.

[0072] E. coli DH5α competent cells were prepared by the CaCl2 method (Beijing Quanshijin Biotechnology Co., Ltd.). The Gibson ligation product was added to the DH5α competent cells, reacted on ice for 30 minutes, then reacted in a 42°C water bath for 90 seconds, and then placed on ice for 2 minutes, followed by adding 1 mL of LB medium, and placed on a 37°C shaker for 1 hour to recover, and finally spread on an LB plate containing kanamycin and cultured at 37°C overnight.

[0073] Multiple single clones were selected for culture, and PCR verification was performed using primers pBAD-F and ugt76g1-F300-R. Positive clones with the correct target sequence size were selected for culture, and plasmids were extracted. The obtained positive clone plasmid was named pYB1k-ugt76g1.

[0074] pBAD-F: GATTATTTGCACGGCGTCAC (SEQ ID NO.11)

[0075] ugt76g1-F300-R:CTGCAGTTCCAGTTCACGAC(SEQ ID NO.15)

[0076] E. coli BW25113 competent cells were prepared by the CaCl2 method, and the plasmid pYB1k-ugt76g1 was transferred into the competent cells of E. coli BW25113, and then spread on LB plates containing kanamycin and cultured at 37°C overnight. The positive clone containing pYB1k-ugt76g1 was selected, which was the recombinant E. coli expressing the wild-type glycosyltransferase UGT76G1.

[0077] Example 3

[0078] Construction of a mutant library of glycosyltransferase UGT76G1

[0079] The wild-type glycosyltransferase UGT76G1 was randomly mutated by error-prone PCR to construct a mutant library. ep-PCR amplification was performed using rTaq DNA polymerase (TAKARA) with low fidelity using ugt76g1-ATG-F and ugt76g1-TAA-R as primers and pYB1k-ugt76g1 plasmid as template. The amplification system and amplification procedure are shown in Tables 1 and 2.

[0080] ugt76g1-ATG-F:ATGGCCGAAAACAAGACCGA(SEQ ID NO.16)

[0081] ugt76g1-TAA-R:TTACAAAGAGGAAATGTAAG(SEQ ID NO.17)

[0082] Table 1 Error-prone PCR amplification system

[0083]

[0084] Table 2 Error-prone PCR amplification procedures

[0085]

[0086] After PCR product purification, the mutant gene fragments of UGT76G1 were obtained, and these fragments were connected to the vector pYB1k using the Gibson seamless ligation kit to obtain a complete plasmid mutant library containing the UGT76G1 mutant gene. The Gibson ligation reaction system is shown in Table 3.

[0087] Table 3 Gibson ligation reaction system

[0088]

[0089] React in a 50℃ water bath for 1h, transfer the obtained plasmid containing the UGT76G1 mutant gene to E. coli DH5α competent cells for culture, put them in a shaker for 1h, spread them on a plate and place them in a 37℃ incubator for 12h after recovery. After the colonies grow, randomly pick 5 monoclonal strains, culture the bacterial solution and extract their plasmids for sequencing. Subsequently, scrape the colonies on the plate with a glass rod, extract the plasmid library, and store it at -20℃ for subsequent high-throughput screening of mutant libraries.

[0090] Example 4

[0091] High-throughput screening

[0092] After the random mutation library was constructed, a monoclonal colony on the plate was picked with a high-temperature and high-pressure sterilized toothpick and inoculated into a 96-well deep-well plate containing 800 μL LB medium (containing kanamycin sulfate). The seed solution was obtained by shaking and culturing at 37°C and 900 rpm in a 96-well plate shaker for 24 hours.

[0093] Use an inoculation needle to dip the seed solution and transfer it to another new 96-well plate LB medium containing kanamycin sulfate (final concentration of 50 μg / mL), and culture at 37°C and 900 rpm until OD 600 When the value reaches 0.6-0.8, add L-arabinose with a final concentration of 1mM, and continue induction culture for 22h at 30℃ and 900rpm in a 96-well plate shaker. After the induction culture is completed, centrifuge at 3000×g for 20min to collect the bacteria. Add lysozyme solution to each well and mix thoroughly to allow lysozyme to fully act on the cells, break the cells and release the intracellular enzymes. After the breaking, centrifuge at 4℃ and 3000×g for 20min in a refrigerated centrifuge to obtain the glycosyltransferase UGT76G1 mutant enzyme solution for subsequent reactions.

[0094] Preparation of AtSUS enzyme solution: Use an inoculation needle to dip the seed solution of the recombinant E. coli engineered strain AtSUS and transfer it to a triangular flask containing 10 mL of LB medium, which also contains kanamycin sulfate (final concentration of 50 μg / mL). Cultivate in a shaking incubator at 37°C and 220 r / min. When the OD 600 When the pH value reached 0.6-0.8, L-arabinose was added to a final concentration of 1 mM, and the culture was continued at 30°C and 220 r / min for 22 h. After centrifugation, the cells were collected and ultrasonically disrupted, and then centrifuged at 5000×g for 5 min to obtain the sucrose synthase AtSUS enzyme solution.

[0095] Reaction system: 8 mM rebaudioside D, 48 mM sucrose, 1.6 mM UDPG, 0.16 mL AtSUS enzyme solution, 0.16 mL glycosyltransferase UGT76G1 mutant enzyme solution, 100 mM sodium phosphate buffer, mix, the pH of the reaction system is 8, react in a 37°C water bath for 6 hours, and terminate the reaction by heating for 5 minutes.

[0096] DNS detection process: The reaction product was centrifuged in a refrigerated centrifuge at 4°C and 3000×g for 20 minutes to obtain the reaction supernatant. 70μL of the reaction supernatant and 210μL of DNS were added to a clean 96-well plate, mixed, and heated for 5 minutes for DNS color reaction. After cooling to room temperature, centrifuged at 3000×g for 18 minutes, 200μL of the supernatant was taken to a 96-well ELISA plate, and the OD was detected using an ELISA reader. 540 Numerical value.OD 540 The UGT76G1 mutant used in the reaction solution with the higher value is the mutant with higher activity, and it is then repeated in the vial.

[0097] Vial validation: OD obtained by 96-well plate screening 540 After the mutants with high values ​​were selected, the glycosyltransferase UGT76G1 mutant, the wild-type glycosyltransferase UGT76G1 single colony and the recombinant Escherichia coli engineered strain AtSUS single colony were picked and inoculated into test tubes respectively, and placed in a shaker at 37°C and 220rpm for 12h to obtain seed liquid. The seed liquid was inoculated into 20mL LB medium (containing kanamycin sulfate with a final concentration of 50μg / mL) at a volume ratio of 1%, and continued to be shaken at 37°C and 220rpm until OD 600 When the pH value was 0.6-0.8, L-arabinose with a final concentration of 1 mM was added for induction, and cultured at 30°C and 200 rpm for 18 hours. After the culture was completed, the bacteria were collected by centrifugation (5000×g for 10 min), and the bacteria were resuspended in 0.51 mL of 100 mM pH 8.0 sodium phosphate buffer, and the cells were broken and centrifuged to obtain UGT76G1 mutant enzyme solution, wild-type UGT76G1 enzyme solution and sucrose synthase AtSUS enzyme solution.

[0098] Reaction system: 8mM rebaudioside D, 48mM sucrose, 1.6mM UDPG, 0.5mL UGT76G1 mutant enzyme solution or wild-type UGT76G1 enzyme solution, 0.2mL AtSUS enzyme solution, supplement the reaction system to 10mL with 100mM sodium phosphate buffer, the pH of the reaction system is 8. After placing in a water bath at 37℃ constant temperature water bath for 6h, the reaction was terminated by boiling water bath for 5min, centrifuged at 10000×g for 2min, and the supernatant was taken for DNS reaction, and the OD 540The reaction solution catalyzed by the mutant with a higher value than the wild-type UGT76G1 was tested by HPLC to verify the production of rebaudioside M.

[0099] Filter results:

[0100] After multiple initial screenings and vial rescreenings of the UGT76G1 mutant library, the inventors finally obtained four superior mutants from nearly 2,000 mutants, all of which had higher enzyme activities than the wild type, and their efficiency in catalyzing the synthesis of rebaudioside M from rebaudioside D was greatly improved. The yield of rebaudioside M of the superior mutants in the vial retest was as follows: Figure 1 As shown. Among them, the production of rebaudioside M of mutant 101H10 is nearly 10 times higher than that of the wild type. After sequencing, the amino acid sequence of mutant 2-12E is obtained by the following mutations based on the amino acid sequence shown in SEQ ID NO.1: the 89th amino acid mutates from M to H, the 380th amino acid mutates from L to M, and the 411th amino acid mutates from A to Y.

[0101] Example 5

[0102] Scale-up study on the synthesis of rebaudioside M by the best mutant 101H10

[0103] The seed liquid of mutant 101H10 and sucrose synthase AtSUS was inoculated into 400 ml LB medium (containing kanamycin sulfate with a final concentration of 50 μg / mL) at a volume ratio of 1%, and cultured at 37°C and 220 rpm. 600 When the pH value was 0.6-0.8, L-arabinose with a final concentration of 1 mM was added to the two culture media for induction, and the induction culture was carried out at 30°C and 220 rpm for 18 hours. After the culture was completed, the bacteria were collected by centrifugation (5000×g for 10 min), resuspended in 10.5 mL of 100 mM pH 8.0 sodium phosphate buffer, and the bacteria were crushed and centrifuged to obtain UGT76G1 mutant 68S enzyme solution and sucrose synthase AtSUS enzyme solution.

[0104] Reaction system: 20 mM rebaudioside D, 120 mM sucrose, 1 mM UDPG, 10 mL sucrose synthase AtSUS1 enzyme solution, 10 mL mutant 101H10 enzyme solution, the reaction system is supplemented to 100 mL with sodium phosphate buffer, and the pH of the reaction system is 8. Reaction conditions: 37°C for 16 h.

[0105] The reaction solution was sampled every 1 hour, and the yield of rebaudioside M was detected by HPLC to show the trend of the change of conversion time. Figure 2 As shown, the optimal mutant 101H10 could convert 20 mM rebaudioside D (RD) into 17.2 mM rebaudioside M (RM) within 16 h, and the RD conversion rate reached 86%.

[0106] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A glycosyltransferase UGT76G1 mutant, characterized in that: The UGT76G1 mutant is any one of the following (A)-(C): (A) A protein obtained by causing any one or more of the following mutations based on the amino acid sequence shown in SEQ ID NO.1: The 89th amino acid mutated from M to H; The amino acid at position 380 mutated from L to M; The amino acid at position 411 mutated from A to Y; (B) a protein having 95% or more identity with the amino acid sequence defined in (A) and having the same function; (C) Fusion protein obtained by ligating a tag to the end of the protein defined in (A) or (B).

2. The glycosyltransferase UGT76G1 mutant according to claim 1, characterized in that The amino acid sequence of the UGT76G1 mutant is shown in SEQ ID NO.

3.

3. A biomaterial, characterized in that: The biological material includes any one of the following: (A) an expressed gene encoding the glycosyltransferase UGT76G1 mutant according to claim 1 or 2; (B) a recombinant plasmid containing the expression gene described in (A); (C) A recombinant cell comprising the recombinant plasmid described in (B) or the expression gene described in (A).

4. An enzyme composition, characterized in that The enzyme composition comprises the glycosyltransferase UGT76G1 mutant and sucrose synthase AtSUS according to claim 1 or 2; The sucrose synthase AtSUS is as follows (B1) or (B2): The amino acid sequence of (B1) is shown in SEQ ID NO.5; (B2) A protein having an amino acid sequence identity of 95% or 98% or more to that of (B1) and having the same function.

5. A method for synthesizing rebaudioside M using glycosyltransferase UGT76G1, characterized in that: Rebaudioside D, UDPG and sucrose are used as substrates and the enzyme composition according to claim 4 is used to catalyze the synthesis of rebaudioside M.

6. The method according to claim 5, characterized in that In the catalytic reaction system, the concentration of rebaudioside D is 5-100 mM, the concentration of UDPG is 0.1-5 mM, the concentration of sucrose is 40-800 mM, the added amount of glycosyltransferase UGT76G1 mutant enzyme solution is 0.1-50 mL, and the added amount of sucrose synthase AtSUS enzyme solution is 0.1-50 mL.

7. The method according to claim 6, characterized in that The preparation method of the glycosyltransferase UGT76G1 mutant enzyme solution comprises the following steps: (1) constructing the coding gene of the glycosyltransferase UGT76G1 mutant into an expression vector to obtain a recombinant plasmid A, and transforming the recombinant plasmid A into a host bacterium to obtain a recombinant strain A; (2) The seed solution of recombinant strain A was inoculated into a culture medium containing kanamycin sulfate for cultivation. 600 When the pH reaches 0.6-0.8, L-arabinose is added and the induction culture is continued at 25-40°C for 8-40 hours, centrifuged, the bacteria are collected and the cells are broken, centrifuged, and the supernatant is the glycosyltransferase UGT76G1 mutant enzyme solution; the inoculation amount is 1v / v%; the final concentration of kanamycin sulfate is 10-100μg / mL; the final concentration of L-arabinose is 0.1-15mM.

8. The method according to claim 6, characterized in that The preparation method of the sucrose synthase AtSUS enzyme solution comprises the following steps: (1) constructing the sucrose synthase AtSUS encoding gene into an expression vector to obtain a recombinant plasmid B, and transforming the recombinant plasmid B into a host bacterium to obtain a recombinant strain B; (2) The seed solution of recombinant strain B was inoculated into a culture medium containing kanamycin sulfate for cultivation. 600 When it reaches 0.6-0.8, add L-arabinose and continue to induce culture at 25-40°C for 8-40 hours, centrifuge, collect the bacteria and break the cells, centrifuge, and the supernatant is the sucrose synthase AtSUS enzyme solution; the inoculation amount is 1v / v%; the final concentration of kanamycin sulfate is 10-100μg / mL; the final concentration of L-arabinose is 0.1-15mM.

9. The method according to claim 7 or 8, characterized in that: The host bacteria include but are not limited to Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris or Corynebacterium glutamicum.

10. The method according to claim 5 or 6, characterized in that: In the catalytic reaction system, the pH value is 5.0-8.0, the temperature is 25-60° C., and the reaction time is 5-30 hours.

Images