A ROPGEF gene for simultaneously improving cotton fiber length, strength and elongation and its application

Abstract

The present invention discloses a ROPGEF gene and its application for simultaneously improving the length, strength and elongation of cotton fibers. The genomic sequence of the gene is: SEQ ID NO.2; the genomic sequence of the gene GHLSF includes a deletion of a base C, located at the 1988-1990bp position of the genomic sequence, and the deletion of the original base at the site causes the corresponding protein to terminate prematurely. Among them, the fiber quality of the cotton variety (line) of haplotype TCA is significantly better than that of the cotton material of haplotype TCC. The gene has important research value and application prospects in efficiently identifying high-quality fiber upland cotton varieties, improving cotton fiber quality traits and cultivating new varieties of high-quality cotton fibers.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology application, and relates to a ROPGEF family gene related to cotton fiber length, fiber strength and fiber elongation and application thereof. Background Art

[0002] As the main source of natural fiber, cotton is an important cash crop. Cotton production not only has an important impact on the development of my country's agriculture and even the national economy, but also plays a vital role in the world cotton trade market. In addition, cotton fiber is an excellent and most widely used natural fiber, and it is also an important raw material for the textile industry, playing a vital role in the development of the national economy. With the improvement of people's living standards, the demand for natural pure cotton fabrics continues to increase, and the requirements for fiber quality are also getting higher and higher. Therefore, it is particularly important to deeply explore and utilize genetic variations related to cotton quality.

[0003] Genome-wide association study (GWAS) is a new strategy that uses millions of single nucleotide polymorphisms (SNPs) in the genome as molecular genetic markers to conduct correlation analysis at the genome level, and to discover genetic variations that affect complex traits through comparison. With the improvement of genome sequencing technology and the reduction of sequencing costs, combined with the high development of bioinformatics, GWAS has become one of the most effective methods for mining and analyzing genes and their related genetic mechanisms for human diseases and crop agronomic traits and resistance traits. Using genome-wide association analysis to mine and clone genes related to agronomic traits does not require the assumption of candidate genes in advance. It has strong detection capabilities and high accuracy, and is a hot topic in molecular breeding research. Belo et al. (2008) conducted a GWAS analysis on 8,950 SNPs in 553 excellent inbred lines and identified sites related to oleic acid content. This is the first true genome-wide association analysis of corn. Huang et al. (2011) used the second generation sequencing technology to resequence 517 rice local varieties and obtained millions of SNPs. They then conducted GWAS analysis on 14 agronomic traits of rice and successfully identified 80 trait-associated loci. In addition, they also resequenced up to 950 rice populations, conducted GWAS analysis on flowering period and 10 yield-related traits, and identified many known functional genes (Huang et al. 2012). Lin et al. (2014) conducted whole genome resequencing on 360 tomato germplasms from all over the world. Through population differentiation analysis, they first discovered the key variation site that determines the color of the pink fruit skin, namely the 603bp deletion in the promoter region of the SlMYB12 gene, which inhibited the expression of the gene, so that the mature pink fruit tomato skin could not accumulate flavonoids, resulting in the difference between fresh tomatoes and processing tomatoes. Zhou et al. (2015) resequenced 302 wild, local and improved varieties of soybeans, and combined with GWAS analysis technology, found that 96 GWAS association sites were associated with previously reported QTLs, and identified new association sites related to oil content, plant height and fuzz formation. Fang et al. (2017) identified 25 selection signals in the cotton improvement process by whole genome resequencing of 318 upland cotton materials. Through GWAS analysis, a total of 119 association sites were identified, including 71 yield-related association sites, 45 fiber quality-related sites, and 3 sites related to resistance to Verticillium wilt (Fang et al, 2017). Ma et al. (2018) resequenced and analyzed 419 core upland cotton materials and found that 7383 SNPs were significantly associated with these traits, located in or near 4820 genes.In addition, some candidate genes that control flowering, affect fiber length, and fiber strength were analyzed in detail (Ma et al., 2018). Liu et al. (2021) used a natural population of 290 upland cotton cultivars for years of field identification, combined with high-density SNP markers to conduct a genome-wide association analysis of cotton wilt resistance, identified the major resistance locus Fov7, and determined that the gene GhGLR4.8 is a new atypical major resistance gene in plants (Liu et al., 2021). The above results fully demonstrate that genome-wide association analysis has a high positioning accuracy, even reaching the level of a single gene. Using the obtained functional markers related to the target trait to screen the target trait can greatly accelerate the breeding process and efficiency.

[0004] The ROPGEF family is unique to plants and can specifically catalyze Rops, converting it from a GDP-bound inactive form to a GTP-bound active form, thereby regulating plant growth and development and stress resistance. The ROPGEF family contains a conserved PRONE domain and a variable N-terminus and C-terminus. Studies have shown that only the conserved PRONE domain has a catalytic effect on plant ROP proteins. Currently, a large number of studies in Arabidopsis have shown that genes in the ROPGEF family can regulate the polar growth of plant tissues, such as root hair protrusion and elongation, pollen tube elongation, etc. (Zhang Zhiwei, 2019). Summary of the invention

[0005] The purpose of the present invention is to provide a ROPGEF family gene Long Strong Fiber (GHLSF). The results of genome-wide association analysis show that the gene is closely related to the three important fiber quality traits of cotton fiber length, fiber strength and fiber elongation.

[0006] Another object of the present invention is to provide application of the gene.

[0007] The purpose of the present invention can be achieved through the following technical solutions:

[0008] A ROPGEF gene that improves the length, strength and elongation of cotton fibers at the same time. The gene is formed by the deletion of a base C in the ROPGEF family gene GHROPGEF5, which is located at the 1988bp-1990bp position of the gene coding region sequence. The original base deletion at this site causes the corresponding protein to terminate prematurely. The genomic sequence of the gene is: SEQ ID NO.2; and the fiber length, fiber strength, fiber elongation and other fiber quality traits of the cotton variety with the ROPGEF gene (genotype is TCA) are significantly higher than those of the cotton variety with the GHROPGEF5 gene (genotype is TCC). Interestingly, many varieties cultivated in Xinjiang have a haplotype of TCC, indicating that the ROPGEF gene provided by the present invention has great utilization value.

[0009] The application of the gene GHLSF of the present invention in identifying high-quality fiber quality upland cotton varieties. Specifically, by identifying the genotype of the aforementioned ROPGEF gene that simultaneously improves cotton fiber length, strength, and elongation in cotton, cotton with a base of TCA at the 1988bp-1990bp position of the genome sequence is identified as a high-quality fiber quality upland cotton variety.

[0010] The application of the gene GHLSF in improving cotton fiber quality traits of the present invention. Specifically, the gene containing the high-quality haplotype TCA can be transferred into cotton varieties by means of genetic engineering and hybrid design to improve cotton quality, and the sites in the haplotype TCC can also be subjected to site-directed mutation to transform into high-quality haplotypes to cultivate new varieties of high-quality fiber cotton.

[0011] The invention discloses an application of the transcription factor gene GHLSF in cultivating new varieties of high-quality cotton fibers by genetic engineering.

[0012] A method for screening high-quality cotton varieties, detecting the genotype of the A10:112656815-A10:112656817 site on chromosome A10 in cotton, and selecting cotton with the genotype of TCA as the high-quality fiber cotton variety.

[0013] Furthermore, the primers for detecting the genotype are as follows: the upstream primer is SEQ ID NO.5, and the downstream primer is SEQ ID NO.6.

[0014] Furthermore, cotton with the genotype TCA expresses the aforementioned ROPGEF gene that simultaneously improves cotton fiber length, strength, and elongation, and the base at the 1988bp-1990bp position of the genomic sequence in the gene is TCA. Cotton with the genotype TCC expresses the ROPGEF family gene GHROPGEF5, and the base at the 1988bp-1990bp position of the genomic sequence in the gene is TCC.

[0015] The advantages of the present invention are:

[0016] The present invention mines a ROPGEF family gene GHLSF that is closely associated with three important fiber quality traits, namely, fiber length, fiber strength and fiber elongation, through resequencing and genome-wide association analysis of cotton MAGIC (multi-parent high-generation recombinant self-pollination population). The gene GHLSF of the present invention is closely associated with cotton quality traits in genome-wide association analysis. The GHLSF cDNA and genomic sequence provided by the present invention are obtained by PCR technology, which has the advantages of small starting template amount, simple and easy experimental steps and high sensitivity.

[0017] The expression level of GHLSF in different tissues and developmental stages of cotton was analyzed by transcriptome sequencing. This gene is related to the components of fiber quality traits.

[0018] The base deletion genotypes of GHLSF in relatively high fiber quality and low fiber quality variety populations were verified by PCR technology, which is easy to operate, highly sensitive and accurate.

[0019] The MAGIC population can be divided into two major categories based on the different genotypes of GHLSF. Statistical analysis methods found that there were significant differences in fiber length, fiber strength and fiber elongation between the two groups, further proving the correlation between this gene and cotton quality traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 .Results of GWAS association analysis of different cotton yield traits.

[0021] The horizontal axis represents the chromosome A10 of upland cotton and its position (MB), and the vertical axis represents the significance of the association of SNP loci, expressed as -log 10 (Pvalue) indicates.

[0022] Figure 2 .Expression levels of GHROPGEF5 gene in different tissues and developmental stages of cotton.

[0023] The horizontal axis represents different tissues, including root, stem, leaf, torus, petal, pistil, psitil, calycle, ovule and fiber. Ovule tissue includes 3 and 1 days before flowering, the day of flowering (0 day), and 1 to 25 days after flowering. Fiber tissue includes 5 to 25 days after flowering.

[0024] Figure 3.Sequence information of GHLSF and identification of different haplotypes.

[0025] In the MAGIC population, a deletion of a base C was detected in the GHLSF sequence, located at the 1988bp-1990bp position of the gene coding region sequence. The loss of the original base at this site caused the corresponding protein to terminate prematurely. The left figure shows the genome sequence differences between the two haplotypes, and the right figure shows the protein structure changes caused by the two haplotypes.

[0026] Figure 4 .Comparative analysis of yield traits among different haplotypes of GHLSF.

[0027] The box plot represents the distribution of quality traits of the MAGIC population. The horizontal axis represents different haplotypes, and the vertical axis represents the corresponding quality trait values, which are fiber elongation, fiber strength, and fiber length in the quality traits. There are 36 and 720 varieties containing haplotypes TCC and TCA, respectively. White represents the distribution of quality traits of haplotype TCA, and black represents the distribution of quality traits of TCC. The horizontal line in the box represents the median of the trait distribution. ** indicates a difference at the 0.01 level; * indicates a difference at the 0.05 level. DETAILED DESCRIPTION

[0028] Example 1 Mining of Gene GHLSF Associated with Cotton Quality Traits:

[0029] For the multi-parent high-generation recombinant self-pollinated population (MAGIC population) constructed from 920 lines, three replicates of each line were planted in the field in Korla, Xinjiang, Shihezi, Xinjiang, and Dangtu County, Anhui from 2019 to 2020, respectively. A detailed investigation of fiber quality traits (fiber elongation, fiber strength, fiber length, micronaire value, and fiber uniformity) was carried out. At the same time, the whole genome of these 920 lines was resequenced to obtain 4.4Tb sequencing data with an average sequencing depth of 3.5×. These sequences were aligned to the genome sequence of cotton upland TM-1, and bioinformatics software was used to identify whole genome variations. A total of 4,774,181 high-quality variants (minimum gene frequency>0.05) were mined for subsequent analysis. First, a whole genome association analysis was performed, and then according to P<1×10 -6 Screening for associated signal sites. By analyzing these associated sites, we found a signal associated site (A10:112656815) on chromosome A10 that can simultaneously associate with three quality traits: fiber elongation, fiber strength, and fiber length ( Figure 1). This association site happens to be in the exon region of the gene, and causes changes in the amino acid sequence and premature termination of coding. The association site is located in the GHROPGEF5 gene of the ROPGEF family. In this experiment, RNA samples from different tissues and different developmental stages of the cotton TM-1 variety were collected for transcriptome sequencing. The sample materials include roots, stems, leaves, ovules and fibers. The ovule tissue includes 3 and 1 days before flowering, the day of flowering, and 1 to 25 days after flowering. The fiber tissue includes 5 to 25 days after flowering. The transcriptome sequencing used the Illumina HiSeq 2500 platform, and the average sequencing depth of each sample reached 6Gb. The gene expression level of the GHROPGEF5 gene was calculated by aligning the sequenced reads with the upland cotton genome, and the calculated expression level was expressed as the number of sequencing fragments contained in each thousand transcript sequencing bases per million sequencing bases (FPKM). The experimental results are shown in the following figure. Figure 2 As shown in the figure, the gene is dominantly expressed in ovules of TM-1 cotton at -3 and -1 days before flowering, ovule seeds at 1 day, 3 days, 5 days, 10 days and 20 days after flowering, and fibers at 5 days and 10 days, indicating that the gene is related to the fiber quality trait constituent factors and is a gene that simultaneously improves the length, strength and elongation of cotton fibers. The new gene formed by the gene deletion at the A10:112656815 site in the GHROPGEF5 gene is named GHLSF in the present invention. The cDNA and genomic sequences of the gene are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0030] Example 2 Obtaining the ROPGEF gene GHLSF:

[0031] According to the two ends of the cDNA of the GHLSF gene, the full-length primers were designed for PCR amplification. The primer sequences were F1 (SEQ ID NO.3): TTCTTCAACAATGGCTCCAT and R1 (SEQ ID NO.4): CCTCAAGCTTGCTCCATCTGG. The PCR reaction procedure was as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 60°C annealing for 1 min, 72°C extension for 1 min, 30 cycles; and finally 72°C extension for 10 min. The PCR amplification product was sequenced and further compared with the cDNA to determine the accuracy of the sequence.

[0032] Example 3 Application of ROPGEF gene GHLSF in identifying high-quality cotton varieties and improving quality traits:

[0033] Based on the location of the base deletion site (A10:112656815-A10:112656817) on chromosome A10, genomic amplification primers were designed at both ends of the site, and the primer sequences were F2 (SEQ ID NO.5): GCTAAAACGGCAAAAACAGGC; and R2 (SEQ ID NO.6): AATGCCATTACCAATCTCTGTGGT. Using this pair of primers, PCR amplification and sequencing were performed in the DNA of 920 varieties. The PCR reaction procedure was as follows: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30sec, 58℃ annealing for 1min, 72℃ extension for 45sec, 30 cycles; and finally 72℃ extension for 10min. The genotype of each strain at the base deletion site was analyzed based on the sequencing results. We confirmed that the GHLSF sequence contains a base deletion located at 1988bp-1990bp of the genome sequence. The deletion of this base causes the original TCC base in this range to become TCA, which causes the corresponding protein sequence to terminate prematurely at the 183rd amino acid. Based on the base deletion information, the upland cotton strains were divided into two haplotypes: TCC and TCA ( Figure 3 ).

[0034] Based on the base deletion genotype at the 1988bp-1990bp position of the GHLSF genome sequence, we identified 36 haplotype TCA materials and 720 haplotype TCC materials from the MAGIC population ( Figure 3 ). We searched for the distribution of excellent haplotypes in published public data. 108Ф and C1470, which have made outstanding contributions to the breeding of upland cotton varieties in my country, are all high-fiber quality haplotypes TCA. High-quality haplotypes are mainly distributed in cotton varieties in Xinjiang and Liaoning, reflecting the profound influence of varieties from Central Asian countries such as Uzbekistan on cotton variety improvement in Xinjiang, my country (Fang et al., 2017; Han et al., 2020). Most of the varieties bred in Xinjiang are TCC haplotypes, indicating that high-fiber quality haplotypes TCA still have important utilization value.

[0035] Using the t-test statistical method, we calculated the correlation between the quality traits of the two haplotypes ( Figure 4 ). The results showed that the fiber elongation, fiber strength, and fiber length of haplotype TCA showed extremely significant differences in all planting environments (P<0.01);

[0036] From the above results, it can be seen that the gene GHLSF has important research value in improving cotton quality traits and cultivating new cotton high-quality fiber varieties. On the one hand, molecular markers can be designed based on the haplotype of the gene GHLSF to effectively identify cotton quality traits, which has great application value in the research of high-quality fiber cotton variety selection. On the other hand, genes containing high-quality haplotype TCA can be transferred into cotton varieties through genetic engineering and hybrid design to improve cotton quality, and sites in haplotype TCC can also be subjected to site-directed mutation to transform into high-quality haplotypes to cultivate new high-quality fiber cotton varieties.

[0037] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the present invention.

Claims

1. An application of the ROPGEF gene in identifying high-quality fiber upland cotton varieties, characterized in that: The genomic sequence of the gene is shown in SEQ ID NO.2; the application is specifically: By identifying the genotype of the ROPGEF gene in cotton, cotton with the base at the 1988bp-1990bp position of the genome sequence being TCA was identified as a high-quality fiber quality upland cotton variety, and the high-quality fiber quality upland cotton variety is an upland cotton variety with better cotton fiber length, strength and elongation.

2. A method for screening high-quality cotton varieties, characterized in that: By identifying the genotype of the ROPGEF gene in cotton, the cotton with the base TCA at the position of 1988bp-1990bp in the genome sequence is identified as a high-quality fiber quality upland cotton variety, and the genome sequence of the ROPGEF gene is shown in SEQ ID NO.2; The high-quality fiber-quality upland cotton variety is an upland cotton variety with better cotton fiber length, strength and elongation.

3. The method according to claim 2, characterized in that The primers for identifying the genotype of the ROPGEF gene in cotton are specifically as follows: the upstream primer is shown in SEQ ID NO.5, and the downstream primer is shown in SEQ ID NO.6.

Images