A method for preparing corn male sterile material and related genes

Abstract

The present invention relates to the field of biotechnology, and in particular to a method for preparing male sterile corn materials and related genes. The method for preparing male sterile corn provided comprises: reducing the activity of protein in corn, reducing the content of protein in corn, inhibiting the expression of the coding gene of the protein in corn or knocking out the coding gene of the protein in corn, so as to obtain male sterile corn; the protein is as follows (A1) or (A2): (A1) a protein having an amino acid sequence as shown in SEQ ID NO: 3 or 6; (A2) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acids to the amino acid sequence shown in SEQ ID NO: 3 or 6. The present invention obtains male sterile corn materials by controlling the expression of the corn ZmGMS1 gene and its coding protein, and provides new germplasm resources for corn hybrid breeding.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for preparing corn male sterile material and related genes. Background Art

[0002] Corn is an important food crop. Its planting area and yield in my country have surpassed rice and ranked first. Corn kernels contain 78% starch, 10% protein, 4.8% oil, 8.5% fiber and 3.1% sugar, which helps reduce fat in human blood (Subhan et al, 2020) and is recognized as a healthy food. In addition, corn is widely used in livestock feed, industrial raw materials and biofuels. Corn production mainly utilizes hybrid vigor, but hybrid seed production relies on traditional manual or mechanical emasculation seed production methods, which often require a lot of labor, not only high cost and high resource consumption, but also difficult to guarantee seed purity. Therefore, the development of male sterile lines is the key to future corn hybrid seed production.

[0003] Male sterility includes cytoplasmic male sterility (CMS) and nuclear male sterility (GMS). Maize CMS is divided into three categories: T-type, S-type and C-type. CMS is mainly caused by mutation and recombination of mitochondrial genes (Chen et al., 2017), which belongs to cytoplasmic inheritance. The restorer gene (Rf) in the nucleus can restore CMS fertility. The "three-line" matching consisting of sterile lines, maintenance lines and restorer lines is the technical prerequisite for the application of maize CMS in production. In 1950, the United States applied T-type CMS to maize hybrid production, but with the expansion of planting area, the T sub-species of corn leaf blight broke out, causing huge economic losses, and the use of T-type cytoplasm was stopped (Ullstrup, 1972). my country has successively cultivated sterile cytoplasmic hybrids such as Yuyu No. 22 and Nongda 3138 using C-type and S-type CMS, but the proportion of CMS maize hybrids is less than 15%, and it is impossible to promote them on a large scale. The main reason is that the diversity of CMS genetic resources is low, which makes sterile cytoplasmic hybrids susceptible to pathogens. On the other hand, the production of CMS sterile lines requires a maintainer line with a special genotype, and fertility restoration also requires a strong restoration gene. Production is strictly restricted by the restoration and protection relationship, and breeding resources are relatively scarce.

[0004] With the development of genomics and molecular biology, only about 26 GMS-related genes have been cloned in maize, including the discovery of the resources of the photosensitive male sterility (PGMS) gene tms5 and the temperature-sensitive male sterility (TGMS) gene tvt1-R in maize, which provide guidance for the use of hybrid advantages in the "two-line method" of maize. The "two-line method" is easily affected by changes in external light and temperature conditions, causing fertility fluctuations in the photosensitive and temperature-sensitive nuclear male sterile lines, which seriously affects the purity of hybrid seeds. Other types of GMS genes mediate lipid metabolism, sugar metabolism, transcription factors and sRNA regulation during development, causing male organ development defects, and eventually the plants show complete male sterility. GMS is controlled by nuclear genes and can overcome the defects of CMS seed production. GMS can only be separated from sterile plants in the hybrid offspring separation population, and conventional breeding methods are difficult to reproduce homozygous sterile lines in large quantities. With the rapid development of modern biotechnology, the use of crop molecular design technology combined with conventional breeding methods is expected to effectively utilize recessive nuclear sterile genes. Through genetic engineering and molecular manipulation, the seed production technology (SPT), corn multi-control sterility technology (MCS) and dominant nuclear sterility technology (DGMS) developed have successfully overcome the difficulties encountered in the reproduction of corn GMS itself, laying the foundation for the application of GMS. Therefore, the discovery of more new corn GMS genes and corresponding male sterile materials is an important prerequisite for the application of the above technologies.

[0005] The existing genetic resources of GMS-related genes in maize are still not rich enough, and the cloned gene-mediated sterility traits are manifested in anther development abnormalities, pollen grains that cannot develop or abort, while there are few reports on male sterility caused by dehydration of mature pollen grains, and there are no related male sterility materials. Gene editing technology and EMS mutagenesis technology provide a technical basis for obtaining male sterile materials. The former can directly edit candidate genes to obtain male sterile materials, and the latter can obtain gene function loss mutants by screening EMS mutagenesis populations. Summary of the invention

[0006] The technical problem to be solved by the present invention is how to prepare male sterile corn. In order to solve the technical problem, the present invention provides a method for preparing male sterile corn.

[0007] The method for preparing male sterile corn provided by the present invention comprises: reducing the activity of protein in corn, reducing the content of protein in corn, inhibiting the expression of protein coding gene in corn or knocking out protein coding gene in corn to obtain male sterile corn;

[0008] The protein is named ZmGMS1 protein and is as follows (A1) or (A2):

[0009] (A1) a protein with an amino acid sequence as shown in SEQ ID NO: 3 or 6;

[0010] (A2) A protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO: 3 or 6.

[0011] In the above method, the gene encoding the ZmGMS1 protein comprises any one of the following nucleotide sequences (b1)-(b4):

[0012] (b1) the nucleotide sequence shown in SEQ ID NO: 1 or 2;

[0013] (b2) the nucleotide sequence shown in SEQ ID NO: 4 or 5;

[0014] (b3) a nucleotide sequence having 75% or more identity with the nucleotide sequence defined in (b1) or (b2) and encoding a ZmGMS1 protein;

[0015] (b4) Nucleotide sequence encoding ZmGMS1 protein.

[0016] The term "identity" used herein refers to sequence similarity with a natural nucleic acid sequence. The above 75% identity may be 80%, 85%, 90% or 95% identity.

[0017] The above method can be achieved by performing site-specific editing of the gene encoding the ZmGMS1 protein through the CRISPR gene editing system.

[0018] The CRISPR gene editing system may be a CRISPR-Cas9 system; the target sequence of the gene encoding the ZmGMS1 protein used in the CRISPR-Cas9 system may be target sequence 1 or target sequence 2;

[0019] The target sequence 1 is as follows (c1), (c2) or (c3):

[0020] (c1) the nucleotide sequence of positions 110 to 129 of SEQ ID NO: 4;

[0021] (c2) a nucleotide sequence derived from (c1) that has 75% or more identity with the nucleotide sequence defined in (c1);

[0022] (c3) a nucleotide sequence derived from (c1) that hybridizes with the nucleotide sequence defined in (c1) under stringent conditions;

[0023] The target sequence 2 is as follows (d1), (d2) or (d3):

[0024] (d1) the nucleotide sequence of positions 6143 to 6162 of SEQ ID NO: 4;

[0025] (d2) a nucleotide sequence derived from (d1) that has 75% or more identity with the nucleotide sequence defined in (d1);

[0026] (d3) A nucleotide sequence derived from (d1) that hybridizes with the nucleotide sequence defined by (d1) under stringent conditions.

[0027] The stringent conditions may be hybridization and washing the membrane twice at 68°C in a solution of 2×SSC, 0.1% SDS, each for 5 min, and hybridization and washing the membrane twice at 68°C in a solution of 0.5×SSC, 0.1% SDS, each for 15 min.

[0028] The method can obtain male sterile corn by introducing the coding gene of the sgRNA targeting the target sequence 1 or the target sequence 2 and the coding gene of Cas9 into corn.

[0029] In the above method, the coding gene of the sgRNA can be achieved by introducing a recombinant vector containing the coding gene of the sgRNA into corn.

[0030] The vector may contain a DNA fragment encoding other sequences in the sgRNA except the spacer sequence. The DNA encoding the spacer sequence may be the target sequence 1 or the target sequence 2.

[0031] The vector may be an Em-SFR / Cas9 expression vector.

[0032] The recombinant vectors may be Em-SFR / Cas9-ZmGMS1-spacer1 and Em-SFR / Cas9-ZmGMS1-spacer2, which are recombinant vectors obtained by inserting the target sequence 1 and the target sequence 2 into the HindIII restriction site of the Em-SFR / Cas9 expression vector, respectively. Em-SFR / Cas9-ZmGMS1-spacer1 expresses Cas9 and sgRNA1, and sgRNA1 contains an RNA sequence encoded by target sequence 1. Em-SFR / Cas9-ZmGMS1-spacer2 expresses Cas9 and sgRNA2, and sgRNA2 contains an RNA sequence encoded by target sequence 2.

[0033] In the above method, the water loss rate of the pollen of the male sterile corn is higher than the water loss rate of the pollen of the wild-type corn.

[0034] The water loss rate may be a water loss rate under a humidity condition of 60%≥RH≥30%.

[0035] The present invention also provides a product for regulating corn fertility, which is used to reduce the activity of ZmGMS1 protein in corn, reduce the content of ZmGMS1 protein in corn, inhibit the expression of the gene encoding ZmGMS1 protein in corn, or knock out the gene encoding ZmGMS1 protein in corn.

[0036] The product may be a reagent and / or instrument required for site-directed editing of the gene encoding the ZmGMS1 protein using the CRISPR / Cas9 system.

[0037] The reagent may be reagent 1, reagent 2, reagent 3, reagent 4 or reagent 5;

[0038] The reagent 1 is R1) or R2):

[0039] R1) sgRNA targeting the target sequence 1;

[0040] R2) sgRNA targeting the target sequence 2;

[0041] The reagent 2 is a combination of the reagent 1 and Cas9;

[0042] The reagent 3 is a recombinant vector containing the coding gene of R1) or R2);

[0043] The reagent 4 is a composition consisting of the reagent 3 and a recombinant vector containing a gene encoding Cas9;

[0044] The reagent 5 is a recombinant vector containing the coding gene of R1) or R2) and the coding gene of Cas9.

[0045] The recombinant vector of the reagent 5 may be the Em-SFR / Cas9-ZmGMS1-spacer1 or Em-SFR / Cas9-ZmGMS1-spacer2.

[0046] The application of ZmGMS1 protein or the gene encoding ZmGMS1 protein in regulating corn fertility also falls within the protection scope of the present invention.

[0047] The invention obtains maize male sterile material by controlling the expression of maize ZmGMS1 gene and its encoded protein. The maize ZmGMS1 gene CRISPR homozygous mutants zmgms1-crispr1 and zmgms1-crispr5 obtained by the invention have pollen grains that rapidly lose water and shrivel in the air under natural conditions, so that the seed setting rate of the mutants is less than 2%. The maize male sterile material can be used as a new male sterile germplasm resource for maize hybrid seed production. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1The structure of the ZmGMS1 gene and the mutation sites of the ZmGMS1 gene in maize EMS-induced mutants and CRISPR / Cas9-edited mutants are shown. Black boxes represent exons, and line segments represent introns. The top of the schematic diagram shows the EMS-induced mutants zmgms1-b5, zmgms1-d3, and zmgms1-de of maize B73 line, and the brackets indicate the base mutation positions of the ZmGMS1 gene in the mutants and the amino acid changes caused by the sites, with the ZmGMS1 gene sequence of maize B73 line as a reference. The bottom of the schematic diagram shows the target site of CRISPR / Cas9 editing, zmgms1-crispr1 and zmgms1-crispr5 are CRISPR homozygous mutants of the ZmGMS1 gene, and the target site deletion sequence is based on the ZmGMS1 gene sequence of maize KN5585 line.

[0049] Figure 2 The morphological observation results of pollen grains of wild type and ZmGMS1 gene mutants of maize are shown. A shows the morphological characteristics of wild type and zmgms1-de, zmgms1-b5, zmgms1-d3 mutants of maize B73 line when pollen grains are just separated in vitro (0s) and 90s after separation; B shows the morphological characteristics of wild type and zmgms1-crispr1, zmgms1-crispr5 mutants of maize KN5585 line when pollen grains are just separated in vitro (0s) and 90s after separation.

[0050] Figure 3 The results of the seed setting rate analysis of wild-type and ZmGMS1 gene mutants of corn are shown. A: The upper layer shows the seed setting ear type of the wild-type and zmgms1-b5, zmgms1-d3, and zmgms1-de mutants of corn B73; the lower layer shows the seed setting ear type of the wild-type and zmgms1-crispr1 and zmgms1-crispr5 mutants of corn KN5585; the scale is 2.5 cm. B: Seed setting statistics of wild-type and zmgms1-b5, zmgms1-d3, and zmgms1-de mutants of corn B73; seed setting statistics of wild-type and zmgms1-crispr1 and zmgms1-crispr5 mutants of corn KN5585; at least 9 plants were selected for statistics for each line. DETAILED DESCRIPTION

[0051] The present invention is further described below in conjunction with examples. It should be understood that the following examples are only used as explanations and illustrations of the present invention and do not limit the scope of the present invention in any way.

[0052] If not otherwise specified, the reagents used in the following examples are all conventional reagents in the art, which can be obtained commercially or prepared according to conventional methods in the art; the experimental methods and conditions used are conventional experimental methods and conditions in the art, and reference can be made to relevant experimental manuals, known documents or manufacturer specifications. If not otherwise specified, the quantitative tests in the following examples are set up for three repeated experiments, and the results are averaged. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by ordinary technicians in the field to which the present invention belongs.

[0053] The seeds of maize B73 inbred line mutants zmgms1-b5, zmgms1-d3, and zmgms1-de used in the following examples were purchased from the Maize Molecular Breeding Research Institute of Qilu Normal University.

[0054] The maize inbred line KN5585 used in the following examples was purchased from Weimi Biotechnology (Jiangsu) Co., Ltd.

[0055] The gene editing vector Em-SFR / Cas9 used in the following examples is the Em-SFR / Cas9 vector in the literature (Yan, Y., Zhu, J., Qi, X., Cheng, B., Liu, C., and Xie, C. (2021). Establishment of an efficient seedfluorescence reporter-assisted CRISPR / Cas9 gene editing inmaize. J. Integr. Plant Biol. 63: 1671–1680.), which was donated by the research group of Xie Chuanxiao of the Chinese Academy of Agricultural Sciences. With the consent of the research group of Xie Chuanxiao, the public can obtain the biological material from the applicant. The biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0056] Example 1: Obtaining male sterile maize material

[0057] The inventors of the present application have discovered a gene related to maize male sterility, the ZmGMS1 gene. In the maize inbred line B73, the genomic sequence of the ZmGMS1 gene is shown in SEQ ID NO: 1, the coding sequence of the ZmGMS1 gene is shown in SEQ ID NO: 2, and the amino acid sequence of the protein encoded by the ZmGMS1 gene (i.e., the ZmGMS1 protein) is shown in SEQ ID NO: 3. In the maize inbred line KN5585, the genomic sequence of the ZmGMS1 gene is shown in SEQ ID NO: 4, the coding sequence of the ZmGMS1 gene is shown in SEQ ID NO: 5, and the amino acid sequence of the ZmGMS1 protein is shown in SEQ ID NO: 6.

[0058] 1. Screening of EMS-induced mutants of maize ZmGMS1 gene

[0059] Three point mutation mutants with nucleotide changes in the coding region of the ZmGMS1 gene were screened from the EMS-induced maize B73 whole genome mutant library (http: / / elabcaas.cn / memd / public / index.html# / ). The names of the mutants and the mutation sites of the ZmGMS1 gene in the mutants are as follows:

[0060] zmgms1-b5: The codon 263 of the ZmGMS1 gene changes from Cca to Tca, and the amino acid it encodes changes from proline to serine (P / S);

[0061] zmgms1-d3: The 415th codon of the ZmGMS1 gene was changed from Gat to Aat, and the amino acid it encoded was changed from aspartic acid to asparagine (D / N);

[0062] zmgms1-de: The 710th codon of the ZmGMS1 gene changes from cCa to cTa, and the amino acid it encodes changes from proline to leucine (P / L).

[0063] Seeds of mutants zmgms1-b5, zmgms1-d3, and zmgms1-de were sown separately, and DNA was extracted from each plant when they grew to the three-leaf stage. The CTAB method was used to extract DNA from maize leaves. The method was as follows: 2-3 cm long leaves were cut, placed in a 2 ml centrifuge tube filled with steel beads, frozen in liquid nitrogen until the leaves became hard, and then placed in a grinder to break the leaves into powder; 800 μL of CTAB buffer, mix well and place in a 65℃ water bath for 45-60min, take out and shake gently every 15 minutes to ensure that the sample is fully lysed; place the completely lysed sample in a centrifuge, centrifuge at 12000rpm for 10min at room temperature, take 700ml of supernatant into a new centrifuge tube, and add the corresponding volume of extraction solution (chloroform: isoamyl alcohol = 24:1), and shake gently for 10min to completely remove impurities such as protein and sugar; centrifuge at 12000rpm for 10min at room temperature, use a pipette to draw 600ml of supernatant and place it into a 1.5ml new centrifuge tube, add 400ml of pre-cooled isopropanol (-20℃), gently turn upside down three times, wait for white flocculent precipitate to appear (if there is no white flocculent precipitate, centrifuge at 12000rpm for 3min), discard the supernatant, and wash twice with 500ml 70% ethanol solution, and finally place the sample to dry naturally at room temperature; after the DNA is air-dried, add an appropriate amount of sterile water to dissolve, and vortex until the DNA is completely dissolved. The DNA solution was stored at -80°C.

[0064] PCR amplification and Sanger sequencing were used to verify the authenticity of the ZmGMS1 gene mutation site in the mutant and screen out the homozygous mutant. PCR amplification was performed using 2×Taq Master Mix Dye (Kangwei Reagent, CW0682L) with the extracted corn leaf DNA as the template. The detection primers of the mutation site are shown in the following table.

[0065]

[0066]

[0067] PCR system (30 μL): 2×Taq Master Mix Dye 15 μL, forward primer (10 mM) 0.8 μL, reverse primer (10 mM) 0.8 μL, DNA 1 μL, ddH2O 12.4 μL.

[0068] PCR program: 94℃ pre-denaturation for 2min; 94℃ denaturation for 30s, Tm-5℃ annealing for 30s, 72℃ extension for 30s, 34 cycles; 72℃ extension for 2min. The annealing temperature of zmgms1-d3 was set to 53℃; the annealing temperature of zmgms1-b5 was set to 56℃; and the annealing temperature of zmgms1-de was set to 52℃.

[0069] The PCR products were sent to Shanghai Biotech Co., Ltd. for first-generation sequencing. The Sanger sequencing results showed that zmgms1-b5, zmgms1-de, and zmgms1-d3 were all true single-base mutations ( Figure 1 ). The homozygous site mutant lines were self-pollinated to preserve seeds.

[0070] 2. Creation of CRISPR mutants of maize ZmGMS1 gene

[0071] The ZmGMS1 gene was knocked out using CRISPR / Cas9 gene editing technology to obtain a maize male sterile mutant.

[0072] (1) Target sequence

[0073] The target sequences used were target sequence 1 and target sequence 2.

[0074] Target sequence 1 is 5′-GGGAGGCCGTCGACTCCGCG-3′ (positions 110-129 of SEQ ID NO: 4);

[0075] Target sequence 2 is 5'-AGTTGCAGATCAGGGGTGGC-3' (positions 6143-6162 of SEQ ID NO: 4).

[0076] (2) Preparation of u6:sgRNA overlapping fragments

[0077] According to the sequence information of target sequence 1, the following target sequence 1 primers were synthesized:

[0078] ZmGMS1-sgRNA1-F:

[0079] CAGCTGCGACCACCGCTCC GGGAGGCCGTCGACTCCGCG GTTTTAGAGCTAGAAATAG;

[0080] ZmGMS1-sgRNA1-R:

[0081] CGACGGCCAGTGCCAAGCTTAAAAAAAGCACCGACTCGGTGCCACTTT.

[0082] According to the sequence information of target sequence 2, the following target sequence 2 primers were synthesized:

[0083] ZmGMS1-sgRNA2-F:

[0084] CAGCTGCGACCACCGCTCC AGTTGCAGATCAGGGGTGGC GTTTTAGAGCTAGAAATAG;

[0085] ZmGMS1-sgRNA2-R:

[0086] CGACGGCCAGTGCCAAGCTTAAAAAAAGCACCGACTCGGTGCCACTTT.

[0087] Using target sequence 1 primers and target sequence 2 primers, respectively, with the Em-SFR / Cas9 vector as a template, and using the high-fidelity enzyme KOD FX (KFX-101, Beijing Bailingke Biotechnology Co., Ltd.) according to the following PCR system and PCR program, a DNA fragment containing target sequence 1 and a DNA fragment containing target sequence 2 were amplified, and the fragment length was 135 bp.

[0088] PCR system: 2×PCR buffer for KOD FX 25μL, 2mM dNTPs 10μL, forward primer (10mM) 1.5μL, reverse primer (10mM) 1.5μL, Em-SFR / Cas9 plasmid (10ng) 1μL, ddH2O 10μL, KOD FX 1μL.

[0089] PCR program: 94°C pre-denaturation for 2 min; 98°C denaturation for 10 s, 68°C extension for 10 s, 28 cycles.

[0090] Using the Em-SFR / Cas9 vector as a template, the following primers Zmu6-F and Zmu6-R were used to amplify the Zmu6-2 promoter fragment with a sequence length of 414 bp.

[0091] Zmu6-F: cgacggccagtgccaagctAATTGGCCCTTACAAAATAG;

[0092] Zmu6-R: GGACGGTGGTCGCAGCTG.

[0093] The amplified DNA fragments containing target sequence 1, target sequence 2, and Zmu6-2 promoter fragments were excised and recovered using the M5 gel recovery kit with centrifugal adsorption columns and collection tubes (MF711-01, Beijing Polymer Biotechnology Co., Ltd.). The steps are as follows: First, separate and cut the gel blocks according to the size of the target fragments by agarose gel electrophoresis, adjust the weight to 0.5g, and place them in 1.5ml centrifuge tubes respectively; add 500ml membrane binding solution (MB), place in a 60℃ water bath, and shake up and down every 2-3min until the gel is completely dissolved; during this period, prepare the adsorption column for column balance, add 400μL of balance solution BL to the adsorption column (the adsorption column is placed in the collection tube), centrifuge at 12000rpm (about 13400g) for 1min, pour out the filtrate in the collection tube, put the adsorption column back into the collection tube, and add the column after the gel is completely dissolved and cooled. In the balanced adsorption column, stand at room temperature for 2 minutes to allow the DNA fragments to fully combine with the silica gel membrane in the adsorption column, then centrifuge at 12000rpm for 1 minute, and pour out the waste liquid in the collection tube; add 600μL of membrane rinse solution (MW) to the adsorption column, centrifuge at 12000rpm for 1 minute, and pour out the waste liquid in the collection tube; centrifuge the adsorption column at 12000rpm for 2 minutes again to dry the residual rinse solution; place the centrifugal adsorption column in a new 1.5ml centrifuge tube, add 50μL of elution rinse solution (EB), stand at room temperature for 2 minutes, and centrifuge at 12000rpm for 1 minute to collect DNA fragments.

[0094] The recovered DNA fragments containing target sequence 1 and target sequence 2 were subjected to overlap extension PCR with the recovered Zmu6-2 promoter fragment, respectively, so that the DNA fragment containing target sequence 1 and the Zmu6-2 promoter fragment were spliced ​​into one fragment (named u6-2:sgRNA1), and the DNA fragment containing target sequence 2 and the Zmu6-2 promoter fragment were spliced ​​into one fragment (named u6-2:sgRNA2).

[0095] Overlap extension PCR system: Zmu6 promoter fragment 5.0 μL, DNA fragment containing target sequence 1 (or DNA fragment containing target sequence 2) 5.0 μL, 2×PCR buffer for KOD FX 25.0 μL, 2 mM dNTPs 10.0 μL, KOD FX 1.0 μL, ddH2O 2.0 μL.

[0096] The first round of PCR program: 94°C for 4 min; 98°C for 15 s, 68°C for 10 min, 3 cycles. After the reaction, 2.0 μL of primers Zmu6-F and ZmGMS1-sgRNA1-R (or ZmGMS1-sgRNA2-R) were added respectively for the second round of PCR.

[0097] The second round of PCR program: 94°C for 2 min; 98°C for 10 s, 58°C for 30 s, 68°C for 2 min, 35 cycles; 68°C for 10 min.

[0098] The obtained u6-2:sgRNA1 and u6-2:sgRNA2 were excised and recovered using the centrifugal adsorption column and collection tube of the M5 gel recovery kit, using the same method as above.

[0099] (3) Construction of gene editing expression vector

[0100] First, the Em-SFR / Cas9 vector was linearized by restriction endonuclease Hind III (NEB#R0104V, New England Biolabs). The enzyme digestion system and steps were as follows: 1.0 μL Hind III enzyme, 1 μg Em-SFR / Cas9 plasmid, 5.0 μL buffer 2.1 were added to a 250 μL PCR tube, and ddH2O was added to 50 μL. After mixing with a pipette, the mixture was placed in a 37°C water bath for 3 h, and then the Em-SFR / Cas9 linearized vector was excised and recovered. The recovered u6-2:sgRNA1 and u6-2:sgRNA2 were connected to the recovered Em-SFR / Cas9 linearized vector using In-Fusion recombinase (Cat. No. 639649, Beijing Liuhetong Economic and Trade Co., Ltd.), and the target sequence 1 and target sequence 2 were inserted into the Hind III restriction enzyme site of the Em-SFR / Cas9 expression vector by homologous recombination. The ligation reaction system is as follows: 1.0 μL of Em-SFR / Cas9 linearized vector, 1.5 μL of u6-2:sgRNA1 (or u6-2:sgRNA2), and 1.0 μL of In-Fusion recombinase. The reaction conditions are 50°C water bath for 30 min.

[0101] The name of the recombinant vector containing target sequence 1 is Em-SFR / Cas9-ZmGMS1-spacer1. The name of the recombinant vector containing target sequence 2 is Em-SFR / Cas9-ZmGMS1-spacer2. Em-SFR / Cas9-ZmGMS1-spacer1 expresses Cas9 and sgRNA1, and sgRNA1 contains the RNA sequence encoded by target sequence 1. Em-SFR / Cas9-ZmGMS1-spacer2 expresses Cas9 and sgRNA2, and sgRNA2 contains the RNA sequence encoded by target sequence 2.

[0102] The recombinant vectors Em-SFR / Cas9-ZmGMS1-spacer1 and Em-SFR / Cas9-ZmGMS1-spacer2 were transformed into Escherichia coli DH5α by heat shock method, and the plasmids of positive clones with correct sequences were extracted after sequencing identification. The Em-SFR / Cas9-ZmGMS1-spacer1 and Em-SFR / Cas9-ZmGMS1-spacer2 with correct sequences were introduced into Agrobacterium EHA105 by electric shock method (voltage 2000V), and the positive Agrobacterium was screened by PCR amplification using the primers DsRED-F and DsRED-R (product size 976bp) of the vector element reporter gene to obtain the recombinant bacteria EHA105-Em-SFR / Cas9-ZmGMS1-spacer1 and EHA105-Em-SFR / Cas9-ZmGMS1-spacer2.

[0103] DsRED-F: 5'-ATGGCCTCCTCCGAGAACGTCATCACC-3';

[0104] DsRED-R: 5'-AGCTTGATCTAGTAACATAGATGAC-3'.

[0105] (4) Transformation receptor material

[0106] The maize inbred line KN5585 was used as the transformation receptor material, and maize immature embryos were infected with Agrobacterium to obtain male sterile maize materials. The strains used were EHA105-Em-SFR / Cas9-ZmGMS1-spacer1 and EHA105-Em-SFR / Cas9-ZmGMS1-spacer2, and each strain was independently transformed into maize immature embryos. The specific transformation was completed by Weimi Biotechnology (Jiangsu) Co., Ltd.

[0107] (5) Identification of positive plants

[0108] Take the leaves of T0 plants with good growth status and extract genomic DNA using CTAB method. Use genomic DNA as template and perform PCR amplification using the following primers to screen T0 plants with positive target editing.

[0109]

[0110] The PCR system was as follows: 20 μL of 2×Taq Master Mix Dye, 1.5 μL of each of forward primer and reverse primer (10 mM), 1 μL of DNA template, and ddH2O added to 40 μL.

[0111] The PCR program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 20 s, 35 cycles; and extension at 72°C for 5 min.

[0112] The PCR product was sequenced by Sanger sequencing to analyze the changes in the target sequence. If a homozygous mutation occurs, it is an effective gene knockout plant, and the phenotype can be directly observed in the T0 generation; if it is a heterozygous mutation, the phenotype of the homozygous mutant must be observed after separation in the T1 generation.

[0113] A total of 14 transgenic T0 generation strains were obtained. Through PCR identification and Sanger sequencing analysis, it was determined that 2 strains were homozygous mutants, 8 strains were heterozygous, and 4 strains had no changes in the target sequence. The two homozygous mutants of the ZmGMS1 gene were named zmgms1-crispr1 and zmgms1-crispr5, and their sequence changes were as follows Figure 1 As shown. zmgms1-crispr1 is a mutant obtained by mutation at target sequence 1, which lacks 1 base (C) at target sequence 1, resulting in a frameshift mutation and premature termination of the protein encoded by the ZmGMS1 gene; zmgms1-crispr5 is a mutant obtained by mutation at target sequence 2, which lacks 10 bases (TGCAGATCAG) at target sequence 2, resulting in a deletion mutation and premature termination of the protein encoded by the ZmGMS1 gene. Seeds of all homozygous lines were self-fertilized for subsequent fruit set analysis.

[0114] 3. Phenotypic analysis of mutants

[0115] The fertility of EMS-induced homozygous mutants zmgms1-b5, zmgms-d3, and zmgms1-de was analyzed, with the wild-type B73 strain as the control. The fertility of CRISPR homozygous mutants zmgms1-crispr1 and zmgms1-crispr5 was analyzed, with the wild-type KN5585 strain as the control.

[0116] (1) Pollen grain phenotype

[0117] Observation of pollen dehydration rate: An optical microscope Olympus CX21 (Olympus, Japan) equipped with an image sensor CCD (coupled device) was used to take real-time photos of pollen grains. Fresh pollen grains from the flowering period of corn were shaken off on a glass slide and directly placed under a 10x microscope for observation. The field of view at different time periods was photographed and recorded using OPTPro software. The percentage of the number of shriveled pollen grains in the field of view at different time periods to the total number of pollen grains was calculated. Ten or more biological replicates were observed for each group of mutants and wild types. The relative humidity of the observation environment was controlled at 50-60% and the temperature was 23-27°C.

[0118] Microscopic observation results showed that compared with the B73 wild type, the morphological characteristics of the zmgms1-de and zmgms1-b5 mutant pollen grains were not significantly different when they were just separated from the body and 90 seconds after separation. The zmgms1-d3 mutant pollen grains had no morphological difference from the B73 wild type pollen grains when they were just separated from the body, but they completely shrank 90 seconds after separation, while the B73 wild type pollen grains had almost no morphological changes after 90 seconds of separation. Figure 2 A). This indicates that the amino acid changes in the ZmGMS1 protein in the zmgms1-de and zmgms1-b5 mutants did not lead to functional changes in the ZmGMS1 protein, and they are non-functional mutants; the zmgms1-d3 mutant is a ZmGMS1 protein functional mutant. Compared with the wild type KN5585, the CRISPR homozygous mutants zmgms1-crispr1 and zmgms1-crispr5 showed no significant differences in pollen grains just after being separated from the body, and the pollen grains were completely shrunken 90s after being separated from the body ( Figure 2 B).

[0119] (2) Fruit setting rate analysis

[0120] To further analyze whether the rapid shrinkage and inactivation of mutant pollen grains affects the fertilization and fruiting of maize silks, natural field fruiting experiments were conducted on the zmgms1-b5, zmgms-d3, and zmgms1-de mutants with a genetic background of B73, and the zmgms1-crispr1 and zmgms1-crispr5 mutants with a genetic background of KN5585.

[0121] In 2021, in Xiangshan, Beijing, plots were designed to test the fruit set rate of the above mutants under natural conditions (temperature of 18-36°C, humidity of 30%-90%, and light duration of 12-14 hours), with wild-type B73 and KN5585 materials as controls. The row spacing and plant spacing of each plot are 60 cm, 25 cm, 5 plants per row, and each plot is repeated three times. The plots of different materials are spaced apart from each other to avoid pollination during the flowering period. The water and fertilizer management of each plot is consistent. After entering the flowering period, the plants in each plot are pollinated under natural conditions. When the seeds are mature, the fruit set rate of the 9 plants in the middle of each plot is counted, and the fruit set rate is calculated as the percentage of the number of fruited seeds in each female ear to the total number of all ovules.

[0122] The experimental results are as follows Figure 3 As shown, there is no significant difference between the mutants zmgms1-b5 and zmgms1-de and the wild-type B73 plants, and the natural fruiting rate in the field is more than 90%, while the natural fruiting rate of the mutant zmgms1-d3 is less than 2%, which further verifies that zmgms1-b5 and zmgms1-de are non-functional mutants, and zmgms1-d3 is a ZmGMS1 protein functional mutant. The natural fruiting rate of the wild-type KN5585 plant is more than 90%, while the natural fruiting rate of the zmgms1-crispr1 and zmgms1-crispr5 mutants is less than 2%.

[0123] The results of the functional analysis of the ZmGMS1 gene in maize materials with different genetic backgrounds showed that the ZmGMS1 gene regulates the water loss rate of pollen grains after in vitro separation, and further affects the seed setting rate of maize under natural conditions. Therefore, ZmGMS1 can be used as a male sterility regulatory gene to broaden the existing fertility-related gene resources of maize. ZmGMS1 mutants can be used as new male sterility germplasm resources for maize hybrid seed production.

Claims

1. A method for preparing male sterile corn, comprising: Reducing the protein content in corn or inhibiting the expression of protein coding genes in corn to obtain male sterile corn; The amino acid sequence of the protein is shown in SEQ ID NO:

6.

2. The method according to claim 1, characterized in that: The nucleotide sequence of the gene encoding the protein is shown in SEQ ID NO: 4 or 5.

3. The method according to claim 2, characterized in that: The method is achieved by performing site-specific editing on the gene encoding the protein through the CRISPR gene editing system.

4. The method according to claim 3, characterized in that: The CRISPR gene editing system is a CRISPR-Cas9 system; the target sequence of the protein encoding gene used in the CRISPR-Cas9 system is target sequence 1 or target sequence 2; The target sequence 1 is the nucleotide sequence at positions 110-129 of SEQ ID NO: 4; The target sequence 2 is the nucleotide sequence at positions 6143-6162 of SEQ ID NO:

4.

5. The method according to claim 4, characterized in that: The method obtains male sterile corn by introducing the coding gene of the sgRNA targeting the target sequence 1 or the target sequence 2 and the coding gene of Cas9 into corn.

6. A product for regulating corn fertility, the product being a reagent required for site-specific editing of the protein encoding gene using the CRISPR / Cas9 system, the reagent being reagent 1 or reagent 2; The reagent 1 is a composition consisting of R1) or R2) and Cas9: R1) an sgRNA targeting the target sequence 1 of claim 4; R2) an sgRNA targeting the target sequence 2 of claim 4; The reagent 2 is a recombinant vector containing the coding gene of R1) or R2) and the coding gene of Cas9.

7. Use of the protein of claim 1 or the gene encoding the protein of claim 2 in regulating corn fertility, wherein the use is to prepare male sterile corn, specifically to reduce the content of the protein in corn or inhibit the expression of the gene encoding the protein in corn.

Images