A SNP molecular marker, detection primer set, detection kit and application

Abstract

The present invention relates to a SNP molecular marker, a detection primer set, a detection kit and an application thereof; the present invention provides a SNP molecular marker associated with susceptibility to non-tuberculous mycobacteria, comprising: a SNP site with an RS number of rs194800, or / and a SNP site with an RS number of rs2520016; the SNP molecular marker of the present invention can be used to detect susceptibility to non-tuberculous mycobacteria, and provides a new solution for evaluating an individual's early warning risk of developing non-tuberculous mycobacteria.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, and in particular to a SNP molecular marker, a detection primer set, a detection kit and applications. Background Art

[0002] Nontuberculous mycobacteria (NTM) are opportunistic pathogens found in water, soil, and human environments. They can invade tissues and organs such as lymph nodes, skin and soft tissue, bones, and the genitourinary system. They most commonly invade the lungs, causing nontuberculous mycobacterial pulmonary disease (NTM), which can even cause systemic disseminated disease in immunocompromised individuals. In recent years, the incidence and prevalence of NTM have been increasing, rapidly becoming a public health concern. As opportunistic pathogens, the specific populations at risk for infection and disease are of concern. Studies have shown that individuals with underlying lung diseases, such as chronic obstructive pulmonary disease, bronchiectasis, cystic fibrosis (CF), prior tuberculosis (TB), silicosis, pneumoconiosis, and pulmonary alveolar proteinosis, are at increased risk for NTM. Furthermore, increasing age, male sex, smoking, alcohol abuse, urban or coastal residence, and involvement in mining and smelting are also risk factors for NTM disease, factors that can be readily assessed through medical history. In addition to the above factors, studies in recent years have shown that the host's genetic susceptibility also plays an important role in the onset of NTM disease. Individuals carrying NTM disease susceptibility genes have a significantly increased risk of developing NTM disease.

[0003] In recent years, with the rapid development of genomic research and the increasing sophistication of sequencing technology, the role of genetic factors in the development and progression of NTM has been intensively studied. In 2005, Won-Jung Koh et al. examined the association between polymorphisms at three sites in the NRAMP1 gene, INT4, D543N, and 3'UTR, and NTM disease in samples from 41 NTM patients and 50 healthy controls. The results showed that all three polymorphisms were associated with NTM susceptibility. In 2013, Mi-Ae Jang et al. found that a polymorphism at the Q1352H site in the CFTR gene was associated with NTM susceptibility in a Korean population, and that variants at this site could increase NTM susceptibility. In 2017, Fei Chen et al. used whole-exome sequencing (WES) technology to examine 12 NTM families and 57 sporadic cases, identifying the chromosome 6q12-q16 linkage region as a genetically variable region for NTM disease and TTK as a susceptibility gene for NTM disease. These studies further confirm that host genetic susceptibility plays a significant role in the pathogenesis of NTM. However, these studies are limited by the small sample size and the number of genes tested. Whether the NTM susceptibility genes or risk loci identified can serve as markers for NTM susceptibility remains to be determined.

[0004] Genome-wide association studies (GWAS) explore the association between genetic polymorphisms and diseases at the genome-wide level and are currently a comprehensive method for screening for susceptibility genes. Risk loci identified through GWAS screening have been used for disease risk assessment in conditions such as hypertension and various tumors. Summary of the Invention

[0005] The purpose of the present invention is to address the deficiencies in the prior art and to provide a SNP molecular marker, a detection primer set, a detection kit and applications.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] The first aspect of the present invention is to provide a SNP molecular marker associated with susceptibility to non-tuberculous mycobacteria, including: a SNP site with rs number rs194800, or / and a SNP site with rs number rs2520016.

[0008] The second aspect of the present invention is to provide a primer set for detecting the above-mentioned SNP molecular marker, including: a primer set for detecting the SNP site with rs number rs194800, or / and a primer set for detecting the SNP site with rs number rs2520016.

[0009] Preferably, the nucleotide sequence of the primer set for detecting the SNP site with rs number rs194800 is shown as SEQ ID NO: 2-3.

[0010] Preferably, the nucleotide sequence of the primer set for detecting the SNP site with rs number rs2520016 is shown as SEQ ID NO: 5-6.

[0011] The third aspect of the present invention is to provide a kit for detecting susceptibility to non-tuberculous mycobacteria, comprising: the above-mentioned SNP molecular marker, or the above-mentioned primer set.

[0012] The fourth aspect of the present invention is to provide the use of the above-mentioned SNP molecular marker, or the above-mentioned primer set, or the above-mentioned kit in preparing a detection reagent or a detection kit for susceptibility to non-tuberculous mycobacteria disease.

[0013] Preferably, the heterozygous SNP genotype is more susceptible to nontuberculous mycobacterial disease than the wild type, and the homozygous SNP genotype is more susceptible to nontuberculous mycobacterial disease than the heterozygous SNP genotype.

[0014] The present invention adopts the above technical solution, which has the following technical effects compared with the prior art:

[0015] The SNP molecular marker of the present invention can be used to detect susceptibility to non-tuberculous mycobacteria diseases, providing a new solution for evaluating the early warning risk of individuals suffering from non-tuberculous mycobacteria diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the rs194800 genotyping result diagram;

[0017] Figure 2 This is the rs2520016 genotyping result diagram. DETAILED DESCRIPTION

[0018] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0019] It should be noted that, in the absence of conflict, the embodiments of the present invention and the features in the embodiments may be combined with each other.

[0020] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but they are not intended to limit the present invention.

[0021] In the present invention, the SNP locus with the rs number rs194800 has the following nucleotide sequence: ATTTCTCTTTGGTGATCTGAAGAATGCAAAAAAGAATTGAGAAGGGTACAATTTTTTTTTTCTTTTTTTGAGACCAGATCTTGCCCTGTCACCAAGCCTGGAGTGCAGTGGTGCAATTTTGGCACACTGCAGCCTCTACTTCCTGTGCTCAAGTGATCCTCTCACCTCAGCCTCCTGAATAGTTGGGATCACAGGTACATGCCACTACACCTCGTTAATTTTGCTATTTTTTGTAGAGATGGGGTCTTGCTATATTGCCTAGGCTGGAATTACAAGTGTGAGCTACCGCACCTGGTTAGGAATAACCTTTTCACTGTGTGATTCAATGTTATTGAGCTGTGTTGTTACTACCCAAAATCATCTTGTGTATGTGAGTGGTGTGTTTCCCACACCTTGGGAACCTCTGGCTGGAGCAATCTATGAGG AAATAAACTTGGGTTGAGTCTTCC CTTCCTGTCCCTTCAGGGAGCATCTGGAGGCAGCCATCAGTGGGCTGAACAYCGTGATGCTCAGGTTGGCCACTGGTCAGGTTGGGTTTGGCAGAGGTTGGCCATCGTAGCGGAATTCACTTATCAGGCCAGGTCCAGGGACAAGTAACAGGACATTATGACAGATG CTTCGTGGA GCTGGAAATATTAAAAGCAACAGCCCTCTGCTGACATTCGTCTCCAGAACCTGGTAAGACTTGTAAGTTTGGAGACAGGGCCCATGAACTTGCCCACTTGCTGGGCTAAGATGGCAGAGTCCCCAAGGGAGAAACTGGAGGTGGCTCTAGTCCTGGTGCTTGCGATCCTCATTTGAGAGGGAGGGTGCTTCCCAGCCAGGAGTGGGAAGGGCACTGGAGTGGTCCCAGCTTGTTCCACTGTGGCTGCTGGGAAAGGCCTTGGCTATCCTGGAATTTTCTAGAATAACTCATCTATGTATCTCAAAGAGGAGACGGGAGTTCCAGAAGAAGCACCTCTCCTTGCCAAGGAGACAAAACTTGAGAGGGTATGTAGGGA (SEQ ID NO: 1); Among them, the underlined part represents the primer set, and Y represents [T / C], that is, the SNP site.

[0022] In this invention, the SNP site with rs number rs2520016 is represented by the following nucleotide sequence: GAGTTCATGTCCTTTGTAGGGACATGGATGAAACTGGAAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACAAAAATACTTTTAAATGAGTGTTTTCTTTCACTTAACTTTATATCTGTGAAGTTCATGCATGTCATTGTGTGGAGTGTTTGTGCACTTTCACTGTTCTATGGTATTCCATTGTGTGAATAAATGACAATTAAAAAAACTCATTCTCCCGTTGAAGGATACTTGCATTGTTTCCAATGTTTGGCTTTTATAAACAATGCTGTCTGCAGAACTGTTTGGATAAGAGATTTTGTGATTGATGGGGAAGCGAGCAGATTTGCAGTGATGGAGCGATGGGGAAAAGGTGGTCCTGTGCAGAATCCACCTCACCTGGGGCACCCCCAGAACTGGTCACCTTGTGGGCACTAGGGGATGGTACCTCAAAACCAGCATAGGC ATCCTCAAAAGAGACACTCTC AGCTGTGGCTAGTTTATGTGGCTTCCTGMACCTCAATCTGAAGCCAGAGAGAAAGAACTTGGCAATTTTTGTGTTTTTAGATTGCAGTGGAAAACTGGTGTGTGAGTGCATATGAGGTTGCTTTTTGAAAGTAGGAATGGGGTGCAGGTGGGAGGCTCAGAG GCATTGTAATTCAGGAATACGTGT AAATGTTCCATATATGAATCCACTGGAAACAATAATCCACAGGCCTGCTGACTAGTGGGGAAGGGTCTGGGCCACCTGGGGTGGGTGGGAATGTTTCTCACTGGGTTCTGGCCTGAGCAGTGACAGGTTTTTGTTGGTGTTGCTGCAGTAGAAGGGCTTGCTTCTTTCCCATTG GCTAACTCTGAAGTAGCTGTTACTCACCAAAATGGTGTTGGAATGAGATACTCATGATCTGTGCAGATAAGCAATGACTAATGGTGCTTTTGCAAGTTCTGGAGTCCCTCCCTTGGGGAAGGAACTAGACTTGGAACCAGACTACGGGTTGGCAAAATTAAGCATAAT (SEQID NO: 4); among them, the underline indicates the primer set, and M indicates [A / C], which is the SNP site. Example

[0023] This embodiment provides a SNP molecular marker, a detection primer set, a detection kit, and applications.

[0024] Peripheral blood mononuclear cells (PBMCs) were collected from healthy individuals and NTM patients, DNA was extracted, and the genotype of the SNP site with rs number rs194800 was detected;

[0025] 1. Extraction of DNA template

[0026] Take 2 mL of peripheral venous blood from the subject, add it to a blood collection tube containing heparin or EDTA anticoagulant, and divide it into 1.5 mL centrifuge tubes; take 1 mL of peripheral venous blood, add 2-3 times the volume of red blood cell lysis buffer, mix thoroughly by inversion, centrifuge at 12000 rpm for 1 min, carefully aspirate the supernatant, repeat the above steps once, add 20 μL of RNase A (10 mg / mL) to the suspension, mix thoroughly by inversion, and let it stand at room temperature for 10 min; add 20 μL of proteinase K (10 mg / mL), mix thoroughly by inversion, and digest in a 65°C water bath for 30 min-60 min; add 200 μL of anhydrous ethanol, mix thoroughly by inversion, and at this time, flocculent precipitate may appear. Add both the solution and flocculent precipitate to the adsorption column and let it stand at room temperature for 2 min; centrifuge at 12000 rpm for 2 min, discard the waste liquid, and place the adsorption column in a collection tube; add 600 μL of rinse solution to the adsorption column Liquid, centrifuge at 12000rpm for 1min, discard the waste liquid, and place the adsorption column in a collection tube; repeat the above steps once, centrifuge at 12000rpm for 2min, place the adsorption column open at room temperature or in a 50℃ incubator for a few minutes, place the adsorption column in a clean centrifuge tube, and drop 50μL-200μL of eluent preheated in a 65℃ water bath into the center of the adsorption membrane, place it at room temperature for 5min, and centrifuge at 12000rpm for 1min to obtain high-quality genomic DNA, which can be stored at -20℃ for later use.

[0027] 2. PCR amplification target fragments include:

[0028]

[0029] PCR reaction system (10 μL) includes:

[0030] ddH2O 3μL

[0031] Buffer (10×) 1 μL

[0032] Primer (50nM) 2μL

[0033] dNTP (2.5 mM) 0.8 μL

[0034] UDG (5 U / μL) 0.1 μL

[0035] Enzyme (5U / μL) 0.1μL

[0036] Sample 2μL

[0037] Mg 2+ (100mM) 1μL

[0038] The PCR reaction cycle includes:

[0039]

[0040] Take 2 μL of PCR product and perform 2% agarose gel electrophoresis at 12 V / cm for 20 min. Then check the amplification effect under ultraviolet light.

[0041] 3. Allele typing using high-throughput sequencing based on second-generation sequencing

[0042] Sequencing adapters were added, and different samples were distinguished by different indices. Amplified products were then sequenced using a high-throughput sequencing platform (Illumina ISEQ x Ten). The resulting raw binary basecalling data was converted to sequence data using Illumina bcl2fastq software and stored in the fastq file format. Image recognition and basecalling were performed using Illumina RTA software. Illumina bcl2fastq 2.17 software then demultiplexed the data based on the index information for each sample and calculated the number of reads and sequencing quality (Q30). Genotyping results for each locus were then obtained for each sample.

[0043] 4. Results

[0044] Table 1

[0045]

[0046] As shown in Table 1 , individuals carrying the rs194800 T / C genotype had a 2.19-fold higher risk of NTM disease than those carrying the rs194800 T / T genotype, and individuals carrying the rs194800 C / C genotype had a 2.82-fold higher risk of NTM disease than those carrying the rs194800 T / T genotype. Example

[0047] This embodiment provides another SNP molecular marker, a detection primer set, a detection kit, and applications.

[0048] Peripheral blood mononuclear cells (PBMCs) were collected from healthy individuals and NTM patients, DNA was extracted, and the genotype of the SNP site rs2520016 was detected.

[0049] 1. Extraction of DNA template (same as Example 1)

[0050] 2. PCR amplification target fragments include:

[0051]

[0052] The rest is the same as in Example 1;

[0053] 3. Allele typing using high-throughput sequencing based on second-generation sequencing (same as Example 1)

[0054] 4. Results

[0055] Table 2

[0056]

[0057] As shown in Table 2 , individuals carrying the rs2520016 A / C genotype had a 1.70-fold higher risk of developing tuberculosis than those carrying the rs2520016 A / A genotype, and individuals carrying the rs2520016 C / C genotype had a 3.09-fold higher risk of developing tuberculosis than those carrying the rs2520016 A / A genotype.

[0058] In summary, the SNP molecular markers of the present invention can be used to detect susceptibility to nontuberculous mycobacteria, and provide a new solution for evaluating the early warning risk of individuals suffering from nontuberculous mycobacteria.

[0059] The above description is only a preferred embodiment of the present invention and does not limit the implementation mode and protection scope of the present invention. For those skilled in the art, it should be aware that all solutions obtained by equivalent substitutions and obvious changes made using the description and illustrations of the present invention should be included in the protection scope of the present invention.

Claims

1. Use of a primer set for detecting SNP molecular markers associated with susceptibility to nontuberculous mycobacteria in the preparation of a detection kit for susceptibility to nontuberculous mycobacteria, characterized in that: The SNP molecular marker includes a SNP site with rs number rs194800, or / and a SNP site with rs number rs2520016.

2. The use according to claim 1, characterized in that The nucleotide sequence of the primer set for detecting the SNP site with rs number rs194800 is shown in SEQ ID NO: 2-3.

3. The use according to claim 1, characterized in that The nucleotide sequences of the primer set for detecting the SNP site with rs number rs2520016 are shown in SEQ ID NOs: 5-6.

Images