SNP Molecular Marker of SbDW3 Gene in Sorghum and Its Application

Abstract

The present invention discloses a SNP molecular marker of sorghum SbDW3 gene and its application. The present invention relates to a molecular marker related to the dry weight of the aboveground part of sorghum salt-alkali tolerance trait and its application in the field of molecular biotechnology, and specifically to a SNP molecular marker of sorghum SbDW3 gene and its application. By detecting the polymorphism or genotype of the two SNPs SNP1 and SNP2 or detecting the haploid of sorghum, it is found that the aboveground dry weight of sorghum varieties containing haplotype SbDW3-Hap2 is higher than that of other haplotypes. 81.11% of the homozygous genotype sorghum corresponding to the haplotype SbDW3-Hap2 (TT) has an aboveground dry weight higher than 0.12 kg. It shows that the SbDW3-Hap2 haplotype molecular marker can be used for sorghum molecular marker-assisted selection breeding, significantly improving the selection efficiency of sorghum varieties with high aboveground dry weight.

Description

Technical Field

[0001] The invention relates to a molecular marker related to the dry weight of the aerial part of sorghum and an application thereof in the field of molecular biotechnology, and in particular to a SNP molecular marker of a sorghum SbDW3 gene and an application thereof. Background Art

[0002] Marker-assisted Selection (MAS) is a new breeding model that combines molecular biology with conventional breeding. KASP (Kompetitive Allele-Specific PCR) achieves the effect of genotyping by specifically identifying gene loci with fluorescent probes, and can be used to detect SNP loci and InDel loci. Compared with molecular markers such as SSR, RFLP, and InDel, KASP markers have the characteristics of rapid detection, low cost, and easy large-scale application, thus making up for many drawbacks in traditional breeding and being an effective way to solve the problem of difficult plant variety selection. Among them, the use of high-throughput molecular detection platforms for molecular marker-assisted selection is an effective means to increase breeding accuracy and improve breeding efficiency.

[0003] Sorghum (Sorghum bicolor), also known as millet, is an annual herbaceous plant of the genus Sorghum in the Poaceae family. It is one of the world's five major cereal crops and a C4 crop. It is widely planted in arid, semi-arid tropical, subtropical and temperate regions. Globally, sorghum is used for animal feed, feed, and high-value products such as syrup and bioethanol. Due to its drought resistance, waterlogging resistance and salinity tolerance, it has become a high-yield crop under environmental conditions that restrict the cultivation of other cereals. It is also an important source of food, feed and brewing raw materials, and is expected to become a promising bioenergy crop. Studying the genes that regulate the aboveground dry weight, obtaining the KASP molecular markers that are closely linked to the aboveground dry weight genes, locating and detecting the major gene loci of the aboveground dry weight of sorghum, effectively regulating the aboveground dry weight type of sorghum, and breeding new sorghum varieties with the expected aboveground dry weight type are of great significance to increasing sorghum yield. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to identify or assist in identifying the dry weight trait of the aboveground part of sorghum and / or how to carry out sorghum breeding.

[0005] In order to solve the above technical problems, the present invention first provides an application of a substance for detecting a molecular marker of dry weight of aerial parts of sorghum in detecting or assisting in detecting dry weight traits of aerial parts of sorghum, wherein the application is the following P1 or P2:

[0006] The P1 is an application of a substance for detecting the polymorphism or genotype of the two SNPs SNP1 and SNP2 in identifying or assisting in identifying the dry weight of the aerial part of sorghum. The SNP1 is a SNP in the sorghum genome, which is the 1020th nucleotide of SEQ ID No.1 in the sequence list, which is T or A, and the SNP1 site mutates from T to A, causing the 26th amino acid to mutate from glutamine (Q) to histidine (H); the SNP2 is a SNP in the sorghum genome, which is the 1021st nucleotide of SEQ ID No.1 in the sequence list, which is T or A, and the SNP2 site mutates from T to A, causing the 26th amino acid to mutate from glutamine (Q) to histidine (H).

[0007] The P2 is an application of a substance for detecting haplotypes in identifying or assisting in identifying the dry weight of the aerial part of sorghum. The haplotype is a polymorphic combination of two SNPs, SNP1 and SNP2, on a chromosome of sorghum.

[0008] The three single nucleotide polymorphism sites SNP1 and SNP2 are located in the SbDW3 gene on chromosome 1 of the sorghum genome (BTx623 (v3.1) sorghum genome sequence information). The SbDW3 gene is located at positions 11339409-11340551 on chromosome 1 of sorghum, and is related to the dry weight of the aboveground part of sorghum. Its nucleotide sequence is the DNA molecule shown in SEQ ID No.1 in the sequence table.

[0009] In order to solve the above technical problems, the present invention further provides an application, wherein the application is Q1 and Q2:

[0010] The Q1 is an application of a substance for detecting the polymorphism or genotype of the two SNPs SNP1 and SNP2 in the preparation of identification or auxiliary identification of the dry weight product of the aboveground part of sorghum; the SNP1 is a SNP in the sorghum genome, which is the 1020th nucleotide of SEQID No.1 in the sequence list, which is T or A; the SNP2 is a SNP in the sorghum genome, which is the 1021st nucleotide of SEQID No.1 in the sequence list, which is T or A.

[0011] The Q2 is the application of a substance for detecting haplotypes in the preparation and identification of or auxiliary identification of dry weight products of aerial parts of sorghum; the haplotype is a polymorphic combination of the two SNPs SNP1 and SNP2 on a chromosome of sorghum.

[0012] In order to solve the above technical problems, the present invention also provides the following applications of E1 and E2:

[0013] The E1 is a substance for detecting the polymorphism or genotype of the two SNPs SNP1 and SNP2, and its application in sorghum breeding or preparing sorghum breeding products; the SNP1 is a SNP in the sorghum genome, which is the 1020th nucleotide of SEQ ID No.1 in the sequence list, which is T or A; the SNP2 is a SNP in the sorghum genome, which is the 1021st nucleotide of SEQ ID No.1 in the sequence list, which is T or A.

[0014] The E2 is a substance for detecting haplotypes and is used in sorghum breeding or in preparing sorghum breeding products; the haplotype is a polymorphic combination of the two SNPs SNP1 and SNP2 on a chromosome of sorghum.

[0015] The aboveground dry weight of the sorghum may be the aboveground dry weight of the sorghum at maturity. The sorghum may be a sorghum inbred line.

[0016] The genotype (i.e., allele) of the SNP1 may be genotype TT, genotype AA or genotype TA, genotype TT is the homozygous type of SNP1 being T; genotype AA is the homozygous type of SNP1 being A; genotype TA is the heterozygous type of SNP1 being T and A; the genotype (i.e., allele) of the SNP2 may be genotype TT, genotype AA or genotype TA, genotype TT is the homozygous type of SNP2 being T; genotype AA is the homozygous type of SNP2 being A; genotype TA is the heterozygous type of SNP2 being T and A. The haplotype may specifically be haplotype SbDW3-Hap1 (AT) (abbreviated as SbDW3-Hap1), haplotype SbDW3-Hap2 (TT) (abbreviated as SbDW3-Hap2), and haplotype SbDW3-Hap3 (AA) (abbreviated as SbDW3-Hap3); the haplotype SbDW3-Hap1 (AT) is that SNP1 is A and SNP2 is T; the haplotype SbDW3-Hap2 (TT) is that SNP1 is T and SNP2 is T; the haplotype SbDW3-Hap3 (AA) is that SNP1 is A and SNP2 is A.

[0017] The genotypes of the two SNPs SNP1 and SNP2 can be genotype AATT, genotype TTTT, and genotype AAAA. Genotype AATT is a two-SNP combination genotype of SNP1 with genotype AA and SNP2 with genotype TTTT; genotype TTTT is a two-SNP combination genotype of SNP1 with genotype TT and SNP2 with genotype TT; genotype AAAA is a two-SNP combination genotype of SNP1 with genotype AA and SNP2 with genotype AA. The average dry weight of the aboveground part of sorghum (such as sorghum inbred line) with genotype TTTT of the two SNPs SNP1 and SNP2 is extremely significantly higher or candidate higher than that of sorghum with genotype AATT and sorghum with genotype AAAA, and there is no significant difference in the dry weight of the aboveground part of sorghum (such as sorghum inbred line) with genotype AATT of the two SNPs SNP1 and SNP2.

[0018] The dry weight of the aboveground part of the homozygous genotype sorghum (such as sorghum inbred line) corresponding to haplotype SbDW3-Hap2 is extremely significantly higher or significantly higher than the homozygous genotype sorghum (such as sorghum inbred line) and homozygous genotype sorghum (such as sorghum inbred line) corresponding to haplotype SbDW3-Hap1 and haplotype SbDW3-Hap3; there is no significant difference in the dry weight of the aboveground part of the homozygous genotype sorghum (such as sorghum inbred line) corresponding to haplotype SbDW3-Hap3 and haplotype SbDW3-Hap1.

[0019] In order to solve the above technical problems, the present invention also provides a product, which contains the above-mentioned substance for detecting the polymorphism or genotype of the two SNPs SNP1 and SNP2 in the sorghum genome or the above-mentioned substance for detecting haplotype, and can be any one of the following G1)-G3):

[0020] G1) Detection of single nucleotide polymorphisms or genotypes related to aboveground dry weight of sorghum;

[0021] G2) Identify or assist in identifying products based on the dry weight of the aboveground parts of sorghum;

[0022] G3) Products for sorghum breeding.

[0023] In order to solve the above technical problems, the present invention also provides a method for identifying or assisting in identifying the dry weight of the aerial part of sorghum, which is method A or method B.

[0024] The method A is a method for identifying or assisting in identifying the dry weight of the aboveground part of sorghum, comprising detecting the genotypes of the two SNPs SNP1 and SNP2 in the sorghum to be tested, and identifying or assisting in identifying the dry weight of the aboveground part of sorghum according to the genotypes of the two SNPs in the sorghum to be tested: the average dry weight of the aboveground part of sorghum (such as sorghum inbred line) whose genotypes of the two SNPs are genotype TTTT is higher than or has a candidate to be higher than that of sorghum with genotype AATT and genotype AAAA, and there is no significant difference in the dry weight of the aboveground part of sorghum with genotype AAAA and genotype AATT (such as sorghum inbred line).

[0025] The genotype TTTT is a two-SNP combination genotype of the genotype of the SNP1 being TT and the genotype of the SNP2 being TT; the genotype AATT is a two-SNP combination genotype of the genotype of the SNP1 being AA and the genotype of the SNP2 being TT; the genotype AAAA is a two-SNP combination genotype of the genotype of the SNP1 being AA and the genotype of the SNP2 being AA.

[0026] The method B is a method for identifying or assisting in identifying the dry weight of the aboveground part of sorghum, comprising detecting the haplotypes described above in the sorghum to be tested, and identifying or assisting in identifying the dry weight of the aboveground part of sorghum according to the haplotypes of the sorghum to be tested: the aboveground dry weight of the homozygous genotype sorghum corresponding to the haplotype SbDW3-Hap2 is extremely significantly higher or candidate higher than the homozygous genotype sorghum (such as sorghum inbred line) corresponding to the haplotypes SbDW3-Hap1 and SbDW3-Hap3; there is no significant difference in the aboveground dry weight of the homozygous genotype sorghum (such as sorghum inbred line) corresponding to the haplotype SbDW3-Hap3 and the haplotype SbDW3-Hap1. The haplotype SbDW3-Hap1 is a haplotype in which SNP1 is A and SNP2 is T, the haplotype SbDW3-Hap2 is a haplotype in which SNP1 is T and SNP2 is T, and the haplotype SbDW3-Hap3 is a haplotype in which SNP1 is A and SNP2 is A.

[0027] The application of the above-mentioned method for identifying or assisting in identifying the dry weight of the aerial part of sorghum in sorghum breeding also falls within the protection scope of the present invention.

[0028] The sorghum to be tested mentioned above may be a sorghum inbred line. In the above application, the sorghum inbred line is selected as a parent for breeding.

[0029] The present invention also provides a method for sorghum breeding, comprising: detecting the polymorphism or genotype of two SNPs, SNP1 and SNP2, in the sorghum genome, or detecting the type of haplotype described above in the sorghum genome, and selecting a sorghum inbred line with a genotype combination of genotype TTTT as a parent for breeding; or selecting a sorghum inbred line with haplotype SbDW3-Hap2 (TT) as a parent for breeding.

[0030] The sorghum breeding described above is to cultivate sorghum varieties with higher dry weight of above-ground parts.

[0031] The above-ground dry weight of sorghum may specifically be the above-ground dry weight of sorghum at maturity.

[0032] In the above applications and methods, the substance for detecting the polymorphism or genotype of the two SNPs SNP1 and SNP2, or the substance for detecting the haplotype, can be used to determine the nucleotide types of the SNP1 and SNP2 sites in the above sorghum genome by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-stranded conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein DNA binding reaction, and a chip based on fluorescent molecule DNA binding reaction.

[0033] In the above application or method, the substance for detecting the polymorphism or genotype of the two SNPs SNP1 and SNP2, or the substance for detecting the haplotype, may be as follows (D1), D2) or D3):

[0034] D1) containing PCR primers for amplifying a sorghum genomic DNA fragment including the SNP1 and SNP2 sites;

[0035] D2) a PCR reagent containing the PCR primers described in D1);

[0036] D3) A kit containing the PCR primers described in D1) or the PCR reagents described in D2).

[0037] The above PCR primers are F1-1, F1-2, F2-1, F2-2:

[0038] F1-1, a primer set consisting of the single-stranded DNA shown in SEQ ID No. 2 in the sequence listing, the single-stranded DNA shown in SEQ ID No. 3 in the sequence listing, and the single-stranded DNA shown in SEQ ID No. 4 in the sequence listing;

[0039] F1-2, a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 22 to 43 of SEQ ID No. 2 in the sequence listing, a single-stranded DNA having a nucleotide sequence of positions 22 to 43 of SEQ ID No. 3 in the sequence listing, and a single-stranded DNA shown in SEQ ID No. 4 in the sequence listing;

[0040] F2-1, a primer set consisting of the single-stranded DNA shown in SEQ ID No.5 in the sequence listing, the single-stranded DNA shown in SEQ ID No.6 in the sequence listing, and the single-stranded DNA shown in SEQ ID No.7 in the sequence listing;

[0041] F2-2, a primer set consisting of a single-stranded DNA having a nucleotide sequence of 22-42nd to SEQ ID No. 5 in the sequence listing, a single-stranded DNA having a nucleotide sequence of 22-42nd to SEQ ID No. 6 in the sequence listing, and a single-stranded DNA shown in SEQ ID No. 7 in the sequence listing.

[0042] In the above-mentioned applications and methods, the PCR primer may be labeled or not labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the marker is detectable. In some embodiments, the nucleic acid is directly detected (e.g., directly reading the sequence) without a marker.

[0043] In the above applications and methods, the product may be a reagent or a kit or a system, and the system may include a combination product of a reagent or a kit, an instrument and an analysis software, such as a product consisting of PCR primers, PARMS master mix reagents, an ELISA reader and an online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ), and a combination product consisting of PCR primers, PARMS master mix reagents, an online software SNP decoder and a fluorescence quantitative PCR instrument. The product may include the above-mentioned substance for detecting the polymorphism or genotype of the SNP1 and SNP2 sites in the sorghum genome.

[0044] In the above-mentioned applications and methods, the above-ground dry weight of the sorghum variety with high above-ground dry weight is relative to the hybrid parent sorghum. If the above-ground dry weight of the two hybrid parent sorghums is the same, the above-ground dry weight of the sorghum variety with high above-ground dry weight can be equal to or higher than the above-ground dry weight of the hybrid parent sorghum; if the above-ground dry weight of the two hybrid parent sorghums is different, the above-ground dry weight of the sorghum variety with high above-ground dry weight can be equal to or higher than the hybrid parent sorghum with higher above-ground dry weight of the two hybrid parent sorghums.

[0045] The present invention also provides a DNA molecule, the nucleotide sequence of which is shown in Sequence 1 of the sequence table.

[0046] The application of the above-mentioned DNA molecules also falls within the scope of protection of the present invention. The application is specifically any of the following:

[0047] (1) Identify or assist in identifying the dry weight of the aboveground part of sorghum;

[0048] (2) screening or breeding sorghum plants or lines or strains or varieties with high aboveground dry weight;

[0049] (3) Screening or breeding sorghum plants, plant lines, strains or varieties that are sensitive to aboveground dry weight;

[0050] (4) Sorghum breeding;

[0051] (5) preparing products for identification or assisting in identification of the dry weight of the aerial parts of sorghum;

[0052] (6) preparing products for screening or breeding sorghum plants, strains, lines or varieties with high aboveground dry weight;

[0053] (7) preparing products for screening or breeding sorghum plants, lines, strains or varieties with low aboveground dry weight;

[0054] (8) Prepare sorghum breeding products.

[0055] Optionally, in the above application, the DNA molecule is used as a detection target.

[0056] In the embodiment of the present invention, through the genetic variation analysis of the SbDW3 gene in the sorghum inbred line associated population, two SNPs were found, SNP1 and SNP2 were respectively located in the SbDW3 gene related to the aboveground dry weight in the sorghum genome, i.e., the 1020th and 1021st positions of the sequence list SEQ ID No. 1, and there were three haplotypes in the combination of these two SNPs: haplotype SbDW3-Hap1 (AT), haplotype SbDW3-Hap2 (TT) and haplotype SbDW3-Hap3 (AA). Experiments have shown that the aboveground dry weight of the homozygous genotype sorghum corresponding to the haplotype SbDW3-Hap2 is significantly higher than that of the homozygous genotype sorghum corresponding to other haplotypes, and there is no significant difference in the aboveground dry weight of the homozygous genotype sorghum corresponding to the haplotype SbDW3-Hap3 and the haplotype SbDW3-Hap1. 81.11% of the homozygous genotypes of sorghum corresponding to the haplotype SbDW3-Hap2 (TT) had an aboveground dry weight higher than 0.12 kg, and 54.78% of the homozygous genotypes of sorghum corresponding to the haplotype SbDW3-Hap1 (AT) had an aboveground dry weight less than or equal to 0.12 kg. The haplotype SbDW3-Hap2 (TT) molecular marker can be used for early prediction and screening of aboveground dry weight of sorghum, as well as for molecular marker-assisted selection breeding of sorghum and breeding of sorghum varieties with high aboveground dry weight. DETAILED DESCRIPTION

[0057] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0058] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0059] The 226 sorghum inbred line association populations in the following embodiments were provided by Jing Haichun Laboratory, Key Laboratory of Northern Resource Plants, Institute of Botany, Chinese Academy of Sciences. For detailed information on the association population, see the published article: XiaoyuanWu, et al..Genomic footprints of sorghum domestication and breeding selection for multiple end uses.Molecular Plant, 2022, VOLUME 15, ISSUE3, P537-551 (DOI: https: / / doi.org / 10.1016 / j.molp.2022.01.002), and the variety details are shown in Table 1.

[0060] Example 1. Discovery of haplotype combinations associated with dry weight of aerial parts of sorghum and related haplotype molecular markers

[0061] 1. Statistics of dry weight of above-ground part of test materials

[0062] 1. Planting of test materials

[0063] In 2021, 226 sorghum inbred line-related population germplasm resources were planted in slightly saline-alkali soil in the Agricultural High-tech Zone of Dongying City, Shandong Province, China. A randomized complete block design was adopted. The experimental plot was 3m long and 2m wide, with 5 rows planted, 10 plants per row, 0.3m spacing between plants, 0.5m spacing between rows, and normal irrigation.

[0064] 2. Statistics of dry weight of above-ground part of test materials

[0065] After the 226 sorghum inbred line related populations were fully mature, three plants were selected from each material, and the aboveground dry weight of the main stem of each plant was counted. The average value of the three repetitions was taken as the final result of the aboveground dry weight of the sample, as shown in Table 1.

[0066] 2. Discovery of haplotype combinations related to gene SbDW3 and its haplotype molecular markers

[0067] 1. Whole genome sequencing of 226 sorghum inbred line association populations

[0068] The whole genome sequencing data of 226 sorghum inbred line association populations were provided by Jing Haichun Laboratory, Key Laboratory of Northern Resource Plants, Institute of Botany, Chinese Academy of Sciences.

[0069] 2. Discovery of haplotype combinations related to gene SbDW3 and related haplotype molecular markers

[0070] According to the results of genome-wide association analysis of the aboveground dry weight of sorghum inbred lines and their genotype data, a haplotype combination of the aboveground dry weight gene SbDW3 related to the salt-alkali tolerance trait of sorghum was screened. The haplotype combination includes two SNP sites, namely SNP1 and SNP2, where SNP1 corresponds to the 11340378th position on chromosome 1 of the sorghum inbred line BTx623 (BTx623 (v3.1) sorghum genome sequence information), and its nucleotide is T or A, corresponding to the 1020th position of SEQ ID No.1 in the sequence list; SNP2 corresponds to the 11340379th position on chromosome 1 of the sorghum inbred line BTx623, and its nucleotide is T or A, corresponding to the 1021st position of SEQ ID No.1 in the sequence list. The w in SEQ ID No.1 in the sequence list represents t or a.

[0071] The genotype detection results of various sorghum varieties are shown in Table 1. The results showed that there were two genotypes at the SNP1 site (referred to as SNP1 genotypes), namely TT or AA, genotype TT is the homozygous type of SNP1 T, and genotype AA is the homozygous type of SNP1 G; there were two genotypes at the SNP2 site (referred to as SNP2 genotypes), namely TT or AA, genotype TT is the homozygous type of SNP2 T, and genotype AA is the homozygous type of SNP2 A.

[0072] In the test population, there are three haplotypes for these two SNP combinations, namely haplotype combinations: haplotype SbDW3-Hap1(AT) (abbreviated as SbDW3-Hap1), haplotype SbDW3-Hap2(TT) (abbreviated as SbDW3-Hap2) and haplotype SbDW3-Hap3(AA) (abbreviated as SbDW3-Hap3). Haplotype SbDW3-Hap1(AT) is a combination of SNP1 being A and SNP2 being T, haplotype SbDW3-Hap2(TT) is a combination of SNP1 being T and SNP2 being T, and haplotype SbDW3-Hap3(AA) is a combination of SNP1 being A and SNP2 being A.

[0073] The aboveground dry weight of the homozygous sorghum genotype corresponding to haplotype SbDW3-Hap2 (TT) was higher than that of the homozygous sorghum genotypes corresponding to other haplotypes. There was no significant difference in the aboveground dry weight of the homozygous sorghum genotypes corresponding to haplotypes SbDW3-Hap3 and SbDW3-Hap1 (such as sorghum inbred lines).

[0074] The genotype of the homozygous sorghum genotype corresponding to the haplotype SbDW3-Hap1 (AT) is AATT, which is a combination genotype of two SNPs: SNP1 genotype AA and SNP2 genotype TT; the genotype of the homozygous sorghum genotype corresponding to the haplotype SbDW3-Hap2 (TT) is TTTT, which is a combination genotype of two SNPs: SNP1 genotype TT and SNP2 genotype TT; the genotype of the homozygous sorghum genotype corresponding to the haplotype SbDW3-Hap3 (AA) is AAAA, which is a combination genotype of two SNPs: SNP1 genotype AA and SNP2 genotype AA.

[0075] Therefore, the haplotype combination related to the gene SbDW3 obtained above was selected for identifying or assisting in identifying the aboveground dry weight of different sorghum varieties; the SbDW3-Hap2 (TT) haplotype in the haplotype combination was used as a molecular marker for identifying or assisting in identifying the aboveground dry weight of different sorghum varieties, and the aboveground dry weight of the sorghum varieties containing the SbDW3-Hap2 (TT) haplotype molecular marker may be higher than 0.12 kg.

[0076] 3. Design of haplotype combinations related to gene SbDW3 and establishment of primers for SbDW3-Hap2(TT) haplotype molecular markers and their methods

[0077] 1. Design of genome-specific primers for haplotype combination-related SNP sites

[0078] The specific primer sequences of SNP1 (SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4 in the sequence listing) and the specific primer sequences of SNP2 (SEQ ID No. 5, SEQ ID No. 6 and SEQ ID No. 7 in the sequence listing) were designed and synthesized by Zhongyujin Labeling (Beijing) Biotechnology Co., Ltd.

[0079] The primer set F1 for identifying the polymorphism of SNP1 site is as follows:

[0080] Specific primer F1-A (SEQ ID No. 2):

[0081] 5'- GAAGGTGACCAAGTTCATGCT CAACAACGAGACCCTCGAGCAT-3'

[0082] Specific primer F1-B (SEQ ID No.3):

[0083] 5'- GAAGGTCGGAGTCAACGGATT CAACAACGAGACCCTCGAGCAA-3'

[0084] Universal primer F1-C (SEQ ID No. 4): 5'-CCAGCGAGAACGAAACGAAACGAAA-3'

[0085] The primer set F2 for identifying the polymorphism of SNP2 site is as follows:

[0086] Specific primer F2-A (SEQ ID No.5):

[0087] 5'- GAAGGTGACCAAGTTCATGCT CAACAACGAGACCCTCGAGCT-3'

[0088] Specific primer F2-B (SEQ ID No.6):

[0089] 5'- GAAGGTCGGAGTCAACGGATT CAACAACGAGACCCTCGAGCA-3'

[0090] Universal primer F2-C (SEQ ID No. 7): 5'-CCAGCGAGAACGAAACGAAACGAAA-3'

[0091] The primer set F1 for identifying the polymorphism of the SNP1 site is designed based on the sequence SEQ ID No.1, and the primer set F2 for identifying the polymorphism of the SNP2 site is designed based on the sequence SEQ ID No.1.

[0092] The underlined sequences in the above primers F1-A and F2-A are FAM sequences; the underlined sequences in F1-B and F2-B are HEX sequences.

[0093] The single-stranded DNA molecule amplification sequence shown in the above sequences SEQ ID No. 2 and SEQ ID No. 4, in which the SNP1 site in the sequence table SEQ ID No. 1 is T, can read the fluorescent signal of the fluorescent group bound to the FAM sequence in the template using an ELISA reader or a fluorescence quantitative PCR instrument;

[0094] The single-stranded DNA molecule amplification sequence shown in the above sequences SEQ ID No.3 and SEQ ID No.4, wherein the SNP1 site is A in the sequence table SEQ ID No.1, can read the fluorescent signal of the fluorescent group bound to the HEX sequence in the template using an ELISA reader or a fluorescence quantitative PCR instrument.

[0095] The single-stranded DNA molecule amplification sequence shown in the above sequences SEQ ID No.5 and SEQ ID No.7, in which the SNP2 site in the sequence table SEQ ID No.1 is T, can read the fluorescent signal of the fluorescent group bound to the FAM sequence in the template using an ELISA reader or a fluorescence quantitative PCR instrument;

[0096] The single-stranded DNA molecules shown in the above sequences SEQ ID No.6 and SEQ ID No.7 amplify the fragment in which the SNP2 site is A in the sequence SEQ ID No.1. The fluorescent signal of the fluorescent group bound to the HEX sequence in the template can be read by an ELISA reader or a fluorescence quantitative PCR instrument.

[0097] 2. Establishment of detection method

[0098] 2.1 DNA extraction

[0099] Extract genomic DNA of the tested sorghum varieties and add ddH 2 O was used as a template for PCR amplification.

[0100] 2.2 PCR amplification and fluorescence signal detection

[0101] Use SNP1 primer set F1 and SNP2 primer set F2 in step 1 to perform PCR amplification on the template obtained in 2.1, respectively, to detect the polymorphism (nucleotide type) and genotype of SNP1 site and SNP2 site; use Douglas-Araya high-throughput pipeline fluorescence signal scanner to read the fluorescence data of the PCR products of the two primer sets F1 and F2, and use Douglas special software-Kraken for fluorescence signal processing.

[0102] Prepare primer mixture: firstly mix primer F1-A, primer F1-B, primer F1-C, primer F2-A, primer F2-B and primer F2-C with ddH 2 O was diluted to 100mmol·L -1 , respectively obtain primer F1-A solution, primer F1-B solution, primer F1-C solution, primer F2-A solution, primer F2-B solution and primer F2-C solution. Take 60 μL of primer F1-A solution, 60 μL of primer F1-B solution and 150 μL of primer F1-C solution, add 230 μL of 10 mM Tris-HCL to obtain primer mixture F1. Take 60 μL of primer F2-A solution, 60 μL of primer F2-B solution and 150 μL of primer F2-C solution, add 230 μL of 10 mM Tris-HCL to obtain primer mixture F2.

[0103] The 2μL PCR fluorescence quantitative instrument detection reaction system includes: 50ng genomic DNA, 0.02μL primer mixture, 0.6μL 1×KASP Mix (Low Rox) from LGC, and the rest is ddH 2 O. Edit the program and run it according to the operating manual of the Douglas-Nexar and Soellex water bath systems, and save the data.

[0104] If the PCR product of the F1 primer group shows only the fluorescent signal of the fluorescent group bound to the FAM sequence, the genotype of the sorghum SNP1 site to be tested is TT (i.e., the SNP1 site in the sorghum genome is the homozygous type of T); if it shows only the fluorescent signal of the fluorescent group bound to the HEX sequence, the genotype of the sorghum SNP1 site to be tested is AA (i.e., the SNP1 site in the sorghum genome is the homozygous type of A); if it shows both the fluorescent signal of the fluorescent group bound to the FAM sequence and the fluorescent signal of the fluorescent group bound to the HEX sequence, the genotype of the sorghum SNP1 site to be tested is TA (i.e., the SNP1 site in the sorghum genome is the heterozygous type of T and A).

[0105] If the PCR product of the F2 primer group shows only the fluorescent signal of the fluorescent group bound to the FAM sequence, the genotype of the sorghum SNP2 site to be tested is TT (i.e., the SNP2 site in the sorghum genome is the homozygous type of T); if it shows only the fluorescent signal of the fluorescent group bound to the HEX sequence, the genotype of the sorghum SNP2 site to be tested is AA (i.e., the SNP2 site in the sorghum genome is the homozygous type of A); if it shows both the fluorescent signal of the fluorescent group bound to the FAM sequence and the fluorescent signal of the fluorescent group bound to the HEX sequence, the genotype of the sorghum SNP2 site to be tested is AT (i.e., the SNP2 site in the sorghum genome is the heterozygous type of A and T).

[0106] Determine the haplotype and genotype of the haplotype combination related to the gene SbDW3 to identify or assist in identifying the aboveground dry weight of the tested sorghum varieties: the aboveground dry weight of the sorghum (such as sorghum inbred line) whose genotypes of the two SNPs SNP1 and SNP2 are genotype TTTT is higher or is a candidate for being higher than the sorghum (such as sorghum inbred line) whose genotypes of the two SNPs SNP1 and SNP2 are genotype AATT or genotype AAAA. The aboveground dry weight of the homozygous genotype sorghum (such as sorghum inbred line) corresponding to the haplotype SbDW3-Hap2 (TT) is higher or is a candidate for being higher than the homozygous genotype sorghum (such as sorghum inbred line) corresponding to the haplotype SbDW3-Hap1 (AT) and the homozygous genotype sorghum (such as sorghum inbred line) corresponding to the haplotype SbPDW3-Hap3 (AA).

[0107] Example 2: Application of haplotype combination significantly associated with dry weight of aerial parts of sorghum and SbDW3-Hap2 (TT) haplotype molecular marker

[0108] Sorghum to be tested: 226 sorghum inbred line related populations

[0109] 1. Determination of dry weight of aboveground part of sorghum

[0110] The method is the same as Example 1. The results show that 226 sorghum inbred lines were planted in slightly saline-alkali soil in the Agricultural High-tech Zone of Dongying City, Shandong Province, China, and there were significant differences in the aboveground dry weight of different sorghum varieties, with the aboveground dry weight of sorghum ranging from 0.045 to 0.3 kg, of which 139 sorghum inbred lines had an aboveground dry weight of more than 0.12 kg, accounting for about 61.50% of the associated population.

[0111] 2. Molecular identification or assisted identification of aboveground dry weight of sorghum inbred lines

[0112] Extract the genomic DNA of sorghum to be tested, add ddH 2 O was dissolved as a template. The genome-specific primers SNP1 primer set F1 and SNP2 primer set F2 of the haplotype combination-related SNP sites in Example 1 were used for PCR amplification respectively to obtain the polymorphism information of the two SNP sites in the SbDW3 gene-related haplotype combination, thereby determining the haplotype and genotype of the haplotype combination related to the gene SbDW3 of the sorghum to be tested, thereby identifying or assisting in identifying the aboveground dry weight of the tested sorghum variety: the aboveground dry weight of the sorghum whose genotypes of the two SNPs SNP1 and SNP2 are genotype TTTT is higher than or candidate higher than the sorghum whose genotypes of the two SNPs SNP1 and SNP2 are genotype AAAA or genotype AATT. The aboveground dry weight of the homozygous sorghum genotype corresponding to the haplotype SbDW3-Hap2(TT) was higher or potentially higher than that of the homozygous sorghum genotype corresponding to the haplotype SbDW3-Hap1(AT) and the homozygous sorghum genotype corresponding to the haplotype SbDW3-Hap3(AA).

[0113] The genotypes of the two SNP loci in the 226 sorghum samples and the aboveground dry weight of sorghum are shown in Tables 1 and 2. The SNP1 loci of the sorghum samples include two genotypes, TT and AA (shown in the SNP1 genotype column); the SNP2 loci include two genotypes, TT and AA (shown in the SNP2 genotype column). There are three haplotype combinations of the two SNP loci in the sorghum genome according to the genome sequence, namely haplotypes SbDW3-Hap1 (AT), SbDW3-Hap2 (TT) and SbDW3-Hap3 (AA). The test results showed that among the 226 sorghum varieties, 73 of the 90 haplotype SbDW3-Hap2 (TT) sorghum varieties had an aboveground dry weight higher than 0.12 kg; 63 of the 115 haplotype SbDW3-Hap1 (AT) sorghum varieties had an aboveground dry weight less than or equal to 0.12 kg, 81.11% of the haplotype SbDW3-Hap2 (TT) sorghum varieties had an aboveground dry weight higher than 0.12 kg, and 54.78% of the haplotype SbDW3-Hap1 (AT) sorghum varieties had an aboveground dry weight less than or equal to 0.12 kg. This indicates that it is effective to use haplotype SbDW3-Hap2(TT) to select sorghum varieties with high aboveground dry weight, eliminate haplotype SbDW3-Hap1(AT) varieties with low aboveground dry weight, and use it as a haplotype molecular marker for auxiliary selection of sorghum aboveground dry weight.

[0114] Table 1. Dry weight of aboveground parts and genotypes of two SNP loci of 226 sorghum inbred lines

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121] Remarks: IS: Sweet Sorghum; IG: Grain Sorghum; LG: Grain Sorghum; AL: unknown; LB: Broom Sorghum

[0122] The significance analysis of the difference between the three haplotypes and the aboveground dry weight showed that the aboveground dry weight of the homozygous genotype sorghum corresponding to the haplotype SbDW3-Hap2 was significantly different from that of the homozygous genotype sorghum corresponding to the haplotype SbDW3-Hap1 (P<0.0001), and the aboveground dry weight of the homozygous genotype sorghum corresponding to the haplotype SbDW3-Hap2 was significantly different from that of the homozygous genotype sorghum corresponding to the haplotype SbDW3-Hap3 (P<0.05). The aboveground dry weight of the homozygous genotype sorghum corresponding to the haplotype SbDW3-Hap2 was higher or higher than that of the homozygous genotype sorghum corresponding to the haplotype SbDW3-Hap1 and the homozygous genotype sorghum corresponding to the haplotype SbDW3-Hap3.

[0123] Table 2 Aboveground dry weight of 226 sorghum inbred lines according to genotype and haplotype combination homozygous type of gene SbDW3

[0124] genotype Haplotype Haplotype combination Number of varieties Dry weight (kg) AATT SbDW3-Hap1 AT 115 <![CDATA[0.1202±0.04155 a ]]> TTTT SbDW3-Hap2 TT 90 <![CDATA[0.1634±0.04714 b ]]> AAAA SbDW3-Hap3 AA 21 <![CDATA[0.137±0.05895 a ]]>

[0125] The results of the significant difference analysis between the genotype of SNP1 or the genotype of SNP2 and the aboveground dry weight showed that the aboveground dry weight of sorghum of the homozygous genotype (AA) of SNP1 was significantly different from that of the homozygous genotype (TT) of sorghum (P<0.0001), and the aboveground dry weight of sorghum corresponding to the genotype SNP1-TT was higher or candidate higher than that of sorghum corresponding to SNP1-AA. The aboveground dry weight of sorghum of the homozygous genotype (TT) of SNP2 was significantly different from that of the homozygous genotype (AA) of sorghum (P<0.05), and the aboveground dry weight of sorghum corresponding to the genotype SNP2-AA was higher or candidate higher than that of sorghum corresponding to SNP2-TT.

[0126] Table 3 Dry weight of aboveground part of 226 sorghum inbred lines corresponding to different genotypes of two SNP loci of gene SbDW3 and their difference analysis

[0127]

[0128] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Application, Features: The application is P1 or P2; The P1 is a material for detecting the polymorphism or genotype of two SNPs, SNP1 and SNP2, in identifying or assisting in identifying the dry weight of the aerial part of sorghum, wherein SNP1 is a SNP in the sorghum genome, which is the 1020th nucleotide of SEQ ID No. 1 in the sequence list, which is T or A; and SNP2 is a SNP in the sorghum genome, which is SEQ ID No. The 1021st nucleotide of No.1 is T or A; the aboveground dry weight of sorghum with the genotype of the two SNPs being genotype TTTT is higher or candidate higher than that of sorghum with the genotype AATT and genotype AAAA, and there is no significant difference in the aboveground dry weight of sorghum with the genotype of the two SNPs SNP1 and SNP2 being genotype AAAA and genotype AATT; the genotype TTTT is a two-SNP combination genotype in which the genotype of the SNP1 is TT and the genotype of the SNP2 is TT; the genotype AATT is a two-SNP combination genotype in which the genotype of the SNP1 is AA and the genotype of the SNP2 is TT; the genotype AAAA is a two-SNP combination genotype in which the genotype of the SNP1 is AA and the genotype of the SNP2 is AA; the genotype AAAA is a two-SNP combination genotype in which the genotype of the SNP1 is AA and the genotype of the SNP2 is AA; The P2 is an application of a substance for detecting haplotypes in identifying or assisting in identifying the dry weight of the aerial part of sorghum, wherein the haplotype is a polymorphic combination of two SNPs, SNP1 and SNP2, on a chromosome of sorghum; SbW -Hap2-corresponding homozygous genotypes had a higher or candidate higher aboveground dry weight of sorghum haplotype SbW -Hap1 and haplotype SbW -Hap3 corresponding homozygous genotype sorghum; haplotype SbW -Hap3 and haplotype SbW -Hap1 homozygous genotypes had no significant difference in aboveground dry weight; the haplotype SbW -Hap1 is a haplotype in which SNP1 is A and SNP2 is T, and the haplotype SbW -Hap2 is a haplotype in which SNP1 is T and SNP2 is T, and the haplotype SbW -Hap3 is a haplotype in which SNP1 is A and SNP2 is A.

2. Application, Features: The application is Q1, Q2, E1 or E2; The Q1 is an application of a substance for detecting the polymorphism or genotype of two SNPs, SNP1 and SNP2, in preparing a product for identifying or assisting in identifying the dry weight of the aerial part of sorghum; the SNP1 is a SNP in the sorghum genome, which is the 1020th nucleotide of SEQ ID No. 1 in the sequence list, which is T or A; the SNP2 is a SNP in the sorghum genome, which is the 1021st nucleotide of SEQ ID No. 1 in the sequence list, which is T or A; The Q2 is the application of a substance for detecting haplotypes in the preparation and identification of or auxiliary identification of dry weight products of aerial parts of sorghum; the haplotype is a polymorphic combination of the two SNPs SNP1 and SNP2 on a chromosome of sorghum; The E1 is a material for detecting the polymorphism or genotype of two SNPs, SNP1 and SNP2, in sorghum breeding or preparing sorghum breeding products; the SNP1 is a SNP in the sorghum genome, which is the 1020th nucleotide of SEQ ID No.1 in the sequence list, which is T or A; the SNP2 is a SNP in the sorghum genome, which is the 1021st nucleotide of SEQ ID No.1 in the sequence list, which is T or A; The E2 is an application of a substance for detecting haplotypes in sorghum breeding or preparing sorghum breeding products; the haplotype is a polymorphic combination of the two SNPs SNP1 and SNP2 on a chromosome of sorghum; Wherein, the sorghum breeding is to cultivate sorghum with high aboveground dry weight or to select sorghum varieties with high aboveground dry weight; The aboveground dry weight of sorghum whose genotypes are TTTT is higher or has a candidate to be higher than that of sorghum whose genotypes are AATT and AAAA, and there is no significant difference in aboveground dry weight of sorghum whose genotypes are AAAA and AATT respectively; the genotype TTTT is a two-SNP combination genotype in which the genotype of SNP1 and SNP2 is TT; the genotype AATT is a two-SNP combination genotype in which the genotype of SNP1 is AA and the genotype of SNP2 is TT; the genotype AAAA is a two-SNP combination genotype in which the genotype of SNP1 is AA and the genotype of SNP2 is TT; the genotype AAAA is a two-SNP combination genotype in which the genotype of SNP1 is AA and the genotype of SNP2 is AA; Haplotype SbW -Hap2-corresponding homozygous genotypes had a higher or candidate higher aboveground dry weight of sorghum haplotype SbW -Hap1 and haplotype SbW -Hap3 corresponding homozygous genotype sorghum; haplotype SbW -Hap3 and haplotype SbW -Hap1 homozygous genotypes had no significant difference in aboveground dry weight; the haplotype SbW -Hap1 is a haplotype in which SNP1 is A and SNP2 is T, and the haplotype SbW -Hap2 is a haplotype in which SNP1 is T and SNP2 is T, and the haplotype SbW -Hap3 is a haplotype in which SNP1 is A and SNP2 is A.

3. A method for identifying or assisting in identifying the dry weight of the aerial part of sorghum, the method being method A or method B: The method A is a method for identifying or assisting in identifying the dry weight of the aboveground part of sorghum, comprising detecting the genotypes of the two SNPs SNP1 and SNP2 in claim 1 in the sorghum to be tested, and identifying or assisting in identifying the dry weight of the aboveground part of sorghum according to the genotypes of the two SNPs in the sorghum to be tested: the aboveground dry weight of sorghum whose genotypes are genotype TTTT is higher or candidate higher than that of sorghum whose genotypes are AATT and AAAA, and there is no significant difference in the aboveground dry weight of sorghum whose genotypes are genotype AAAA and sorghum whose genotypes are AATT; the genotype TTTT is a combined genotype of two SNPs, wherein the genotype of SNP1 is TT and the genotype of SNP2 is TT; the genotype AATT is a combined genotype of two SNPs, wherein the genotype of SNP1 is AA and the genotype of SNP2 is TT; the genotype AAAA is a combined genotype of two SNPs, wherein the genotype of SNP1 is AA and the genotype of SNP2 is AA; the genotype AAAA is a combined genotype of two SNPs, wherein the genotype of SNP1 is AA and the genotype of SNP2 is AA; The method B is a method for identifying or assisting in identifying the dry weight of the aboveground part of sorghum, comprising detecting the haplotype of claim 1 in the sorghum to be tested, and identifying or assisting in identifying the dry weight of the aboveground part of sorghum according to the haplotype of the sorghum to be tested: haplotype SbW -Hap2-corresponding homozygous genotypes had a higher or candidate higher aboveground dry weight of sorghum haplotype SbW -Hap1 and haplotype SbW -Hap3 corresponding homozygous genotype sorghum; haplotype SbW -Hap3 and haplotype SbW -Hap1 homozygous genotypes had no significant difference in aboveground dry weight; the haplotype SbW -Hap1 is a haplotype in which SNP1 is A and SNP2 is T, and the haplotype SbW -Hap2 is a haplotype in which SNP1 is T and SNP2 is T, and the haplotype SbW -Hap3 is a haplotype in which SNP1 is A and SNP2 is A.

4. Use of the method according to claim 3 in sorghum breeding, wherein the sorghum breeding is to cultivate sorghum with high aboveground dry weight or to select sorghum varieties with high aboveground dry weight.

5. The use according to claim 1, 2 or 4 or the method according to claim 3, Features: The substance for detecting the polymorphism or genotype of the two SNPs SNP1 and SNP2, or the substance for detecting the haplotype, is as follows (D1), D2) or D3): D1) containing PCR primers for amplifying a sorghum genomic DNA fragment including the SNP1 and SNP2; D2) a PCR reagent containing the PCR primers described in D1); D3) A kit containing the PCR primers described in D1) or the PCR reagents described in D2).

6. The use or method according to claim 5, Features: The PCR primers are F1-1, F1-2, F2-1, and F2-2: F1-1, a primer set consisting of the single-stranded DNA shown in SEQ ID No. 2 in the sequence listing, the single-stranded DNA shown in SEQ ID No. 3 in the sequence listing, and the single-stranded DNA shown in SEQ ID No. 4 in the sequence listing; F1-2, a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 22 to 43 of SEQ ID No. 2 in the sequence listing, a single-stranded DNA having a nucleotide sequence of positions 22 to 43 of SEQ ID No. 3 in the sequence listing, and a single-stranded DNA shown in SEQ ID No. 4 in the sequence listing; F2-1, a primer set consisting of the single-stranded DNA shown in SEQ ID No.5 in the sequence listing, the single-stranded DNA shown in SEQ ID No.6 in the sequence listing, and the single-stranded DNA shown in SEQ ID No.7 in the sequence listing; F2-2, a primer set consisting of a single-stranded DNA having a nucleotide sequence of 22-42nd to SEQ ID No. 5 in the sequence listing, a single-stranded DNA having a nucleotide sequence of 22-42nd to SEQ ID No. 6 in the sequence listing, and a single-stranded DNA shown in SEQ ID No. 7 in the sequence listing.

7. The nucleotide sequence is the DNA molecule of SEQ ID No. 1 in the sequence list, and the application of the nucleotide sequence is any of the following: (1) Identify or assist in identifying the dry weight of the aboveground part of sorghum; (2) Screening or breeding sorghum plants, lines, strains or varieties with high aboveground dry weight; (3) preparing products for identification or assisting in the identification of the dry weight of the aboveground parts of sorghum; (4) preparing products for screening or breeding sorghum plants, lines, strains or varieties with high aboveground dry weight; SNP1 is a SNP in the sorghum genome, which is the 1020th nucleotide of SEQ ID No.1 in the sequence list, which is T or A; SNP2 is a SNP in the sorghum genome, which is the 1021st nucleotide of SEQ ID No.1 in the sequence list, which is T or A; The aboveground dry weight of sorghum whose genotype is TTTT is higher or has a candidate to be higher than that of sorghum whose genotype is AATT and genotype is AAAA, and there is no significant difference in the aboveground dry weight of sorghum whose genotypes are AAAA and AATT respectively; the genotype TTTT is a combination genotype of two SNPs whose genotype is TT for SNP1 and TT for SNP2; the genotype AATT is a combination genotype of two SNPs whose genotype is AA for SNP1 and TT for SNP2; the genotype AAAA is a combination genotype of two SNPs whose genotype is AA for SNP1 and AA for SNP2.

Images