A disesquiterpene compound, its preparation and application

Abstract

This invention provides a sesquiterpene compound, its preparation, and its application. The sesquiterpene compound has a basic 5 / 7 / 3 / 6 / 5 skeleton. Although its structure differs significantly from that of traditional antimalarial drugs (such as artemisinin and quinoline derivatives), it still effectively inhibits the activity of Plasmodium parasites. It can serve as an outstanding new antimalarial drug, bringing good news to malaria patients and providing a new application for sesquiterpene compounds.

Description

Technical Field

[0001] This invention belongs to the field of microbial pharmaceutical technology. More specifically, it relates to a disesquiterpene compound, its preparation, and its application. Background Technology

[0002] Malaria is a vector-borne infectious disease caused by infection with Plasmodium parasites through the bite of Anopheles mosquitoes or by transfusion of blood from an infected person. Different Plasmodium parasites can cause vivax malaria, quaternary malaria, falciparum malaria, or ovale malaria. The main symptoms of malaria are periodic attacks, chills, fever, and excessive sweating. Long-term and repeated attacks can lead to anemia and splenomegaly.

[0003] Currently, antimalarial drugs are mainly divided into two categories: artemisinin-based drugs, which have a wide range of applications and good efficacy; and quinoline-based drugs, which are mainly used in countries such as France. In recent years, drug resistance to antimalarial drugs has become a threat to global malaria control efforts, making the search for new and highly effective antimalarial drugs particularly urgent.

[0004] Disesquiterpenoids are mainly distributed in ferns, plant pathogens, and lichens, and have various activities such as anti-infection, antibacterial, and cytotoxicity. For example, existing technologies disclose a sesquiterpenoid compound with anti-inflammatory activity, as well as a sesquiterpenoid compound with anti-tuberculosis and anti-Alzheimer's activity. However, no sesquiterpenoid compound with antimalarial activity has been found so far. Summary of the Invention

[0005] This invention addresses the shortcomings of existing technologies by providing a disesquiterpene compound as a new and highly effective antimalarial drug, offering a new option for malaria patients.

[0006] Another object of the present invention is to provide a strain of Aspergillus oryzae AstCBA.

[0007] Another object of the present invention is to provide a method for preparing the aforementioned sesquiterpenoid compounds.

[0008] Another object of the present invention is to provide the use of the fermentation product of the Aspergillus oryzae strain AstCBA in the preparation of antimalarial drugs.

[0009] Another object of the present invention is to provide the use of the aforementioned sesquiterpenoid compounds in the preparation of antimalarial drugs.

[0010] Another object of the present invention is to provide an antimalarial drug.

[0011] The above-mentioned objective of this invention is achieved through the following technical solution:

[0012] This invention provides a strain of Aspergillus oryzae AstCBA, which was deposited at the Guangdong Provincial Center for Microbial Culture Collection on April 24, 2022, with accession number GDMCC No: 62413.

[0013] The present invention also provides a sesquiterpene compound with the structural formula shown in Formula I:

[0014]

[0015] Wherein, R1 is CH3 and R2 is OH;

[0016] Or R1 is CH2OCOCH3 and R2 is OH;

[0017] Alternatively, R1 can be CH2OH and R2 can be OCOCH2COOH.

[0018] The present invention also provides a method for preparing the disesquiterpenoid compound, which is obtained by fermentation of the Aspergillus oryzae AstCBA strain.

[0019] Preferably, the preparation method is as follows: the Aspergillus oryzae AstCBA strain is cultured in a seed culture medium, and then the Aspergillus oryzae AstCBA strain is inoculated into a fermentation culture medium for culture. Then, extraction, filtration, concentration, column chromatography are performed in sequence, and finally the disesquiterpenoid compound is obtained after purification.

[0020] Preferably, the culture in the seed culture medium is a shaking culture, wherein the shaking speed is 80-300 rpm, the shaking temperature is 20-30℃, and the shaking time is 48-200 h.

[0021] Preferably, in the seed culture medium, the mass-to-volume ratio of glucose to potato juice is 8-32 g: 250-800 mL.

[0022] More preferably, the potato juice is prepared by heating potatoes and water in a mass ratio of 1.8 to 2.2:3 to boiling and simmering to make potato juice, with the most preferred ratio being 2:3.

[0023] Preferably, the fermentation medium is used for static culture, the temperature of which is 20-30°C and the time of static culture is 20-60 days.

[0024] Preferably, the fermentation medium consists of 250-3000g of starch matrix and 1.5-50g of sea salt per 0.5L-1.5L of water.

[0025] More preferably, the starch matrix includes, but is not limited to, rice.

[0026] Preferably, the solvent used for extraction includes, but is not limited to, methanol.

[0027] Preferably, the column chromatography is performed using ethyl acetate and petroleum ether as the mobile phase.

[0028] More preferably, the elution is gradient elution.

[0029] More preferably, in the mobile phase, the volume fraction of ethyl acetate changes during elution as follows: 30% → 40% → 50% → 60% → 70% → 80% → 90% → 100%; and the volume fraction of petroleum ether changes as follows: 70% → 60% → 50% → 40% → 30% → 20% → 10% → 0%.

[0030] The volume of elution buffer used for each gradient is 29 to 31 times the sample volume, with 30 times being the most preferred.

[0031] Preferably, the purification is performed by column chromatography or high-performance liquid chromatography.

[0032] The sesquiterpenoid compounds of this invention can effectively inhibit the activity of Plasmodium falciparum and can serve as excellent new antimalarial drugs, bringing good news to malaria patients and providing a new application for sesquiterpenoid compounds. Therefore, the application of the sesquiterpenoid compounds in the preparation of antimalarial drugs should be within the scope of protection of this invention. Furthermore, the fermentation product of Aspergillus oryzae strain AstCBA contains the sesquiterpenoid compounds, so its application in the preparation of antimalarial drugs, as well as antimalarial drugs with the fermentation product of Aspergillus oryzae strain AstCBA or the sesquiterpenoid compounds as active ingredients, should also be within the scope of protection of this invention.

[0033] Preferably, the antimalarial agent is antimalarial against malignant malaria, and more preferably, it is antimalarial against Plasmodium falciparum.

[0034] The present invention has the following beneficial effects:

[0035] 1. The metabolites of the model fungus (A. oryzae) used in this invention have a clean background and the heterologously expressed genes are relatively simple. Therefore, the Aspergillus oryzae strain AstCBA of this invention can be expressed in the model fungus, and the extraction method of the metabolites is relatively simple, which reduces the difficulty and cost of preparing disesquiterpenoids and also broadens the source of raw materials for disesquiterpenoids.

[0036] 2. The sesquiterpenoid compounds of the present invention have a basic 5 / 7 / 3 / 6 / 5 skeleton. Although they differ greatly from the structures of traditional antimalarial drugs (such as artemisinin, quinoline, etc.), they can still effectively inhibit the activity of Plasmodium. They can serve as outstanding new antimalarial drugs, bringing good news to malaria patients and providing a new application for sesquiterpenoid compounds. Attached Figure Description

[0037] Figure 1 This is an electrophoresis image of Example 1.

[0038] Figure 2 It is the single crystal structure of disesquiterpene compound 1.

[0039] Figure 3 This is a comparison chart of the measured ECD values ​​of disesquiterpenoid 1, disesquiterpenoid 2, and disesquiterpenoid 3. In this chart, Expt.ECD of 1 represents the measured ECD comparison result of disesquiterpenoid 1, Expt.ECD of 2 represents the measured ECD comparison result of disesquiterpenoid 2, and Expt.ECD of 3 represents the measured ECD comparison result of disesquiterpenoid 3. Detailed Implementation

[0040] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0041] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0042] Example 1: Obtaining Aspergillus oryzae AstCBA strain

[0043] S1. Talamoyces wortmannii ATCC26942, purchased from the American Type Culture Collection (ATCC), was cultured in potato glucose broth. AstA (Infusion-astA-F: TCGAGCCTCGGTACCCATGGAGCAGAGGGAAATTAT; Infusion-astA-R: CTACTACAGATCCCCTTAAGCACGAACCTCTAACC), astB (Infusion-astB-F: TCGAGCCTCGGTACCCATGATCGACTCTTTGTCGTT; Infusion-astB-R: CTACTACAGATCCCCCACACAATTACTCAGTGACT), and astC (astC-EcoRI-F: CCGGAATTCATGGCTTCTCTAGAGGTATT; astC-EcoRI-R: CCGGAATTCAAGTCTACTTCACATGCAAC) were amplified from the genomic DNA of 26942. The reaction system was prepared according to the reagent instructions, and then... II. Using the One Step Cloning Kit (Vazyme, Nanjing, China) or T4 DNA ligase, insert astA, astB, and astC into the linearized vector pTAex3 (purchased from Takara Bio Engineering (Dalian) Co., Ltd.) to obtain pTAex3-astA, pTAex3-astB, and pTAex3-astC. Amplify the promoter and terminator from the recombinant pTAex3 plasmid (pTAex3-astA, pTAex3-astB, and pTAex3-astC). The primers for constructing the recombinant pAdeA plasmid containing one or two genes are Inf-pAdeA-Parm-F: GCAGTCGACTCTAGACGACTCCAATCTTCAAGAGC, Inf- pTAex3-Tamy-R1: AACGCGCTCGCGAGCAAGTACCATACAGTACCGCG; Inf-pTAex3-Parm-F1: GCTCGCGAGCGCGTTCCACTGCATCATCAGTCTAG; Inf-pAdeA-Tamy-R: TAGTAGATCCTCTAGAGTAAGATACATGAGCTTCGG), and then the DNA fragment containing the promoter and terminator was cloned into the XbaI-digested pAdeA vector (Takara Bio Engineering (Dalian) Co., Ltd.) to obtain the recombinant plasmid pAdeA-astA-astB.

[0044] S2. 100 μL of spore suspension from the parent strain [quadritrophic host A. oryzae NSAR1 (niaD-, sC-, ΔargB, adeA-)] from Jinan University was inoculated into 10 mL of DPY medium (0.05 wt% MgSO4·7H2O, 0.5 wt% yeast extract, 2 wt% dextrin, 0.5 wt% KH2PO4, 1 wt% polypeptone). After culturing at 28℃ for 2 days, the culture was transferred to a fresh 100 mL DPY medium and grown at 28℃ for 1 day. Mycelia were then collected, and cell walls were removed for 3 h at 30℃ using a Yatalase enzyme system (50 mM maleic acid, 0.6 M (NH4)2SO4, 1 wt% Yatalase, pH 5.5). Protoplasts were collected and treated with solution A (50 mM CaCl2·2H2O, 35 mM... After washing with NaCl, 10 mM Tris-HCl, and 1.2 M sorbitol (pH 7.5), the protoplast concentration was adjusted to 1.0 × 10⁻⁶ using solution A. 7 pcs·mL -1 Protoplast suspension was obtained.

[0045] S3. Gently mix 200 μL of protoplast suspension with 10 μg of recombinant plasmid (pAdeA-astA-astB), place on ice for 30 minutes, then add PEG solution (10 mM Tris-HCl, 50 mM CaCl2·2H2O, 60 wt% PEG4000, pH 10). 7.5) 1.35 mL of solution A was added and incubated at 25°C for 20 minutes. Then, 7 mL of solution A was added, and the mixture was centrifuged for 10 minutes (1500 rpm). The precipitate was resuspended in 200 μL of solution A and spread onto a selective medium (0.5 wt% yeast extract, 2 wt% glucose, 1 wt% agar, 1 wt% peptone, 1.2 M sorbitol, 2 wt% dextrin, 0.2 wt% NH4Cl, 0.002 wt% FeSO4·7H2O, 0.05 wt% MgSO4·7H2O, 0.05 wt% KCl, 0.05 wt% NaCl, 0.1 wt% (NH4)2SO4, 0.1 wt% KH2PO4). After spreading, a layer of selective medium was added, and the mixture was incubated at 28°C for 4 days. The transformant *Aspergillus oryzae* AstCBA was obtained and confirmed by PCR (electrophoresis image shown). Figure 1As shown, lane 1: Marker; lane 2: astB amplified from the Aspergillus oryzae host; lane 3: astB amplified from pAdeA-astA-astB; lane 4: astB amplified from transformants containing pTAex3-astC and pAdeA-astA-astB; lane 5: astA amplified from the Aspergillus oryzae host; lane 6: astA amplified from pAdeA-astA-astB; lane 7: astB amplified from transformants containing pTAex3-astC and pAdeA-astA-astB. The transformants of tB amplified astA, and the primers used for PCR were astA-F: ATGGAGCAGAGGGAAATTAT, astA-R: TTAAAGCACGAACCTCTAACC, astB-F: ATGATCGACTCTTTGTCGTT, astB-R: TCAGTGACTTTGATCCGGAT, astC-F: ATGGCTTCTCTAGAGGTATT, and astC-R: AAGTCTACTTCACATGCAAC.

[0046] S4. Aspergillus oryzae AstCBA strain was deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC) on April 24, 2022, with accession number GDMCC No: 62413, at the address of 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0047] Example 2: Obtaining Disesquiterpenoids

[0048] (1) Aspergillus oryzae AstCBA strain was cultured in a seed culture medium on a shaker for 72 h (culture conditions were 28℃ and 200 rpm) to obtain a seed culture solution; wherein, the seed culture medium was prepared by dissolving 60 g of glucose in 1500 mL of potato juice (controlling the mass ratio of potato to water to 2:3, placing the potato in water, heating to boiling, and boiling to make potato juice), and evenly distributing it into 5 500 mL Erlenmeyer flasks, and sterilizing the Erlenmeyer flasks at 121℃ for 30 min;

[0049] (2) Inoculate Aspergillus oryzae strain AstCBA into the fermentation medium and incubate statically for 30 days (culture conditions are 25℃) to obtain fermentation products; wherein, the fermentation medium is prepared by dissolving 60g sea salt and 3000g rice in 3L tap water and sterilizing at 121℃ for 30min.

[0050] (3) The fermentation product was soaked in methanol three times (24 h each time), filtered, and concentrated under reduced pressure at 45 °C to obtain a crude methanol extract. The crude methanol extract was then separated by silica gel column chromatography (using ethyl acetate and petroleum ether as mobile phases for gradient elution, wherein the volume fraction of ethyl acetate during elution changes as follows: 30% → 40% → 50% → 60% → 70% → 80% → 90% → 100%; and the volume fraction of petroleum ether during elution changes as follows: 70% → 60% → 50% → 40% → 30% → 20% → 10% → 0%; wherein the volume of eluent used for each gradient is 30 times the volume of the sample). The eluent was divided into 8 fractions, and the eluent of the 8th fraction was subjected to Sephadex gel chromatography. LH-20 column chromatography (eluting with dichloromethane and methanol in a volume ratio of 1:1) followed by purification by C-18 reversed-phase high-performance liquid chromatography yielded disesquiterpenoid 1, disesquiterpenoid 2, and disesquiterpenoid 3.

[0051] Example 3: Structural determination of disesquiterpenoids

[0052] The structures of disesquiterpenoid 1, disesquiterpenoid 2, and disesquiterpenoid 3 were determined by single-crystal analysis, nuclear magnetic resonance spectroscopy, mass spectrometry, and ECD comparison, respectively. The results are shown below:

[0053] (1) Disesquiterpenoid compound 1: C 25 H 38 O3, HRESI-MS: 385.2750 [MH] - (Theoretical value 385.2737).

[0054] The single-crystal structure of disesquiterpene compound 1 is shown below. Figure 2 As shown in Table 1, the NMR data are as follows.

[0055] Table 1. NMR data of disesquiterpene compound 1 (125 MHz / 500 MHz, TMS, ppm)

[0056]

[0057]

[0058] (2) Disesquiterpenoid compound 2: C 27 H 40 O5, HRESI-MS: m / z 443.2804[M+H] + (Theoretical value 443.2792).

[0059] The NMR data of disesquiterpene compound 2 are shown in Table 2.

[0060] Table 2. NMR data of disesquiterpene compound 2 (125MHz / 500MHz, TMS, ppm)

[0061]

[0062]

[0063] (3) Disesquiterpenoids 3: C 28 H 40 O7, HRESI-MS: m / z 487.2707[MH] - (Theoretical value 487.2707).

[0064] The NMR data of disesquiterpene compound 3 are shown in Table 3.

[0065] Table 3. NMR data of disesquiterpene compound 3 (125MHz / 500MHz, TMS, ppm)

[0066]

[0067]

[0068] A comparison of the measured ECD values ​​of disesquiterpenoid 1, disesquiterpenoid 2, and disesquiterpenoid 3 is shown below. Figure 3 As shown.

[0069] In summary, it can be determined that disesquiterpenoid 1, disesquiterpenoid 2, and disesquiterpenoid 3 have the structural formula shown in Formula I:

[0070]

[0071] Among them, disesquiterpene compound 1: R1 is CH3, R2 is OH;

[0072] Disesquiterpenoid compound 2: R1 is CH2OCOCH3, R2 is OH;

[0073] Disesquiterpenoid compound 3: R1 is CH2OH, R2 is OCOCH2COOH.

[0074] Example 4: Antimalarial activity of disesquiterpenoids

[0075] First, the chloroquine-sensitive strain of Plasmodium falciparum, Pf3D7 (from the Institute of Zoology, Guangdong Academy of Sciences), was revived and cultured. After passage, it was examined under a microscope to determine the infection rate of Plasmodium falciparum in red blood cells. The parasites that were in the ring stage and had an infection rate of more than 3% were synchronized.

[0076] Calculate the total volume of parasite blood required for plating. Prepare a culture system of 100 μL / well with a standard parasite blood addition of 0.5% infection rate and 2% hematocrit (erythrocyte volume ratio). The ratio of drug to parasite blood is 1:100 v / v, and DMSO accounts for 0.1% of the final volume.

[0077] Group 1: Disesquiterpenoid compound 1 (dissolved and diluted with DMSO to final concentrations of 0.05, 0.5, 2.5, 5, 7.5, 10, 25, 50, 100, 150, and 200 μM after addition to 96-well plates) was incubated at 37°C in an incubator (94% N2, 3% O2, and 3% CO2) for 72 h. The test solution (containing 0.2 μL of Sybrgreen 1 per mL of Lysis Buffer) was then poured into the dosing tank. The 96-well plates were removed from the incubator, and the test solution was added at a volume of 100 μL / well using a single-channel 8-well pipette. The plates were incubated at 37°C. After erythrocyte lysis, the OD values ​​were measured using a microplate reader (excitation wavelength 485 nm, emission wavelength 535 nm). The inhibition rate was calculated, and then the EC values ​​of the compound were fitted using GraphPad software. 50 The activity of the compound against chloroquine-sensitive strains of Plasmodium falciparum was determined by curve analysis, and the results are shown in Table 4.

[0078] Group 2: The disesquiterpene compound 1 in Group 1 was replaced with disesquiterpene compound 2.

[0079] Group 3: The disesquiterpene compound 1 in Group 1 was replaced with disesquiterpene compound 3.

[0080] Positive control group 1: The disesquiterpene compound 1 in the treatment group 1 was replaced with chloroquine.

[0081] Positive control group 2: The disesquiterpene compound 1 in the treatment group 1 was replaced with artemisinin.

[0082] Blank group: The disesquiterpene compound 1 in the drug administration group 1 was replaced with insect blood.

[0083] Negative control group: The disesquiterpene compound 1 in group 1 was replaced with DMSO.

[0084] Three parallel samples were set up for each group.

[0085] Table 4. Results of activity against chloroquine-sensitive strains of Plasmodium falciparum.

[0086]

[0087]

[0088] As shown in Table 3, the half-life (WHM) of disesquiterpenoid compounds 1, 2, and 3 against Plasmodium ranged from 12.93 to 16.48 μM, all within 20 μM. They effectively inhibited the chloroquine-sensitive strain Pf3D7 of Plasmodium falciparum, indicating that the disesquiterpenoid compounds described in this invention can effectively inhibit the activity of Plasmodium falciparum and can serve as outstanding new antimalarial drugs, bringing good news to malaria patients and providing a new application for disesquiterpenoid compounds. Furthermore, when R2 is OH, whether R1 is a methyl or hydroxyl group, it has no significant effect on the inhibitory activity against Plasmodium falciparum.

[0089] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A disesquiterpene compound, characterized in that, The structural formula is shown in Formula I: Formula I Wherein, R1 is CH3 and R2 is OH; Or R1 is CH2OCOCH3 and R2 is OH; Alternatively, R1 can be CH2OH and R2 can be OCOCH2COOH.

2. The method for preparing the disesquiterpene compound according to claim 1, characterized in that, Aspergillus oryzae cultured in seed culture medium ( Aspergillus oryzae The AstCBA strain was inoculated into a fermentation medium and cultured to obtain fermentation products. The fermentation products were then extracted, filtered, concentrated, and subjected to column chromatography. Finally, the disesquiterpenoid compounds were obtained after purification. The AstCBA strain was deposited at the Guangdong Provincial Microbial Culture Collection Center on April 24, 2022, with the accession number GDMCC No: 62413.

3. The preparation method according to claim 2, characterized in that, The column chromatography was performed using ethyl acetate and petroleum ether as the mobile phase.

4. The preparation method according to claim 2, characterized in that, In the seed culture medium, the mass-to-volume ratio of glucose to potato juice is 8–32 g: 250–800 mL.

5. The preparation method according to claim 2, characterized in that, The fermentation medium consists of 250-3000g of starch matrix and 1.5-50g of sea salt per 0.5L-1.5L of water.

6. The use of the disesquiterpenoid compound of claim 1 in the preparation of antimalarial drugs.

7. An antimalarial drug, characterized in that, The disesquiterpene compound described in claim 1 is used as the active ingredient.

Images