A 3′-O-methyltransferase mutant and its application

Abstract

The invention provides a 3'-O-methyltransferase mutant and an application thereof. The mutant is obtained by mutating the tryptophan W at position 284 of a wild-type plant oxygen methyltransferase derived from rice to alanine A, wherein the amino acid sequence of the wild-type plant oxygen methyltransferase is as shown in SEQ ID NO: 1, and the amino acid sequence of the 3'-O-methyltransferase mutant is as shown in SEQ ID NO: 2. The key amino acid sites of the catalytic activity of flavonoid 3'-O-methyltransferase are determined by a semi-rational designed enzyme engineering strategy to obtain a superior mutant, clarify the superior effect of directional transformation on the catalytic synthesis of methylated flavonoid compounds by flavonoid-3'-O-methyltransferase, and the obtained 3'-O-methyltransferase mutant has excellent catalytic performance. Meanwhile, the yield of methylated flavonoid compounds is further improved by optimizing and strengthening metabolic pathways.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, in particular to a mutant of a 3'-O-methyltransferase, and relates to a 3'-O-methyltransferase mutant and an application thereof. Background Art

[0002] In recent years, with the improvement of economic conditions and living standards, the market and society have gradually become more stringent in their requirements for the food, pharmaceutical, health care and cosmetic industries, and the development trend of more products is moving towards "natural" and "green". Natural methylated flavonoids have attracted widespread attention from consumers due to their good anti-inflammatory, anti-cancer, antioxidant, free radical scavenging and metabolism-promoting effects. Methylated products greatly improve the absorption and oral availability of flavonoids, enhance the ability of flavonoids to enter cells and prevent degradation, bring new biological activities, and are more suitable as chemical preventive agents than unmethylated flavonoids.

[0003] Existing methylated flavonoid compounds are mainly obtained through the following technologies: plant extraction, chemical synthesis and in vitro enzymatic reaction synthesis. At present, my country has made certain progress in adopting emerging microwave-assisted extraction and ultrasound-assisted extraction, methylation reagents and enzymatic reaction to supplement methyl donors, but it still cannot meet production requirements, mainly manifested in high cost, unfriendly environment, low extraction rate, and complex production process. Therefore, improving the catalytic efficiency of key enzyme preparation O-methyltransferase and synthesizing methylated flavonoid compounds by biotransformation has great market application value. Obtaining O-methyltransferase mutant strains with excellent catalytic performance and optimizing and strengthening metabolic pathways are key technical issues for increasing the yield of methylated flavonoid compounds. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the present invention provides a 3′-O-methyltransferase mutant and application thereof, determines the key amino acid sites of the catalytic activity of flavonoid 3′-O-methyltransferase through a semi-rational designed enzyme engineering strategy, obtains a superior mutant, clarifies the superior effect of directional modification on the catalysis of flavonoid compounds to synthesize methylated flavonoid compounds by flavonoid-3′-O-methyltransferase, and the obtained 3′-O-methyltransferase mutant has significantly improved substrate affinity and excellent catalytic performance, and further improves the yield of methylated flavonoid compounds by optimizing and strengthening metabolic pathways.

[0005] To achieve the above object, the present invention provides the following technical solution: a 3′-O-methyltransferase mutant, obtained by mutating the tryptophan W at position 284 of a wild-type plant oxygen methyltransferase to alanine A, wherein the amino acid sequence of the wild-type plant oxygen methyltransferase is as shown in SEQ ID NO: 1, and the amino acid sequence of the 3′-O-methyltransferase mutant is as shown in SEQ ID NO: 2.

[0006] Furthermore, amino acid site mutations were performed on the wild-type plant oxygen methyltransferase from rice.

[0007] Furthermore, the present invention also provides a gene encoding the above 3′-O-methyltransferase mutant, and the nucleotide sequence of the gene encoding is as shown in SEQ ID NO:3.

[0008] Furthermore, the present invention also provides a plasmid containing the above coding gene, wherein the plasmid also contains a coding gene for overexpressing S-adenosyl-L-methionine synthetase.

[0009] Furthermore, the present invention also provides a mutant strain containing the above encoding gene, wherein the mutant strain also contains a gene encoding overexpressing S-adenosyl-L-methionine synthetase.

[0010] Furthermore, the present invention also provides a plasmid pACYCDuet-1 comprising the above-mentioned gene encoding overexpression of S-adenosyl-L-methionine synthetase.

[0011] Furthermore, the present invention also provides a mutant strain, wherein the mutant strain is transformed with a recombinant plasmid containing the above-mentioned 3′-O-methyltransferase mutant encoding gene, or

[0012] The recombinant plasmid overexpressing S-adenosyl-L-methionine synthetase and the recombinant plasmid containing the gene encoding the above-mentioned 3′-O-methyltransferase mutant were co-transformed.

[0013] Furthermore, the mutant strain includes Corynebacterium glutamicum, Escherichia coli or Bacillus subtilis.

[0014] Furthermore, the present invention also provides the use of one or more of the 3′-O-methyltransferase mutant, the encoding gene, the plasmid, and the mutant strain in the production of methylated flavonoid compounds.

[0015] Furthermore, the present invention also provides a product comprising one or more of the 3′-O-methyltransferase mutant, encoding gene, plasmid, and mutant strain.

[0016] Compared with the prior art, the present invention has at least the following beneficial effects:

[0017] The present invention provides a 3'-O-methyltransferase mutant, wherein the mutant is obtained by mutating the 284th amino acid of a flavonoid 3'-O-methyltransferase from rice from tryptophan W to alanine A. According to the amino acid sequence alignment of the flavonoid-3'-O-methyltransferase domain, the methyltransferase-substrate docking model, the catalytic kinetic parameters, the fermentation test of the point mutation strain and the optimization of the methyl supply of the synthetic pathway, the present invention clarifies the positive mutation effect of the mutation site of the rice-derived 3'-O-methyltransferase, clarifies the advantageous effect of the directional transformation on the catalysis of flavonoid compounds by the flavonoid-3'-O-methyltransferase and the synthesis of methylated flavonoid compounds, and provides a basis for further improving the yield of methylated flavonoid compounds by utilizing the site.

[0018] Furthermore, the present invention determines the key amino acid sites of the catalytic activity of flavonoid 3′-O-methyltransferase through a semi-rational enzyme engineering strategy. The steps are simple, the screening of mutants is relatively fast, and it is easier to obtain advantageous mutants. The method mainly includes screening the key amino acids of the rice-derived flavonoid 3′-O-methyltransferase (ROMT) domain-specific transfer substrates, and mutating the obtained key amino acid 284 tryptophan W to alanine A to obtain a 3′-O-methyltransferase mutant with improved catalytic activity. The activity assay analysis of the 3′-O-methyltransferase found that the 3′-O-methyltransferase mutant of the present invention exhibited significantly improved enzyme activity compared with the wild-type 3′-O-methyltransferase, and the yield of the methylated flavonoid compound luteolin catalyzed and synthesized using luteolin as a substrate was increased by about 3.5 times compared with the wild-type.

[0019] Furthermore, the present invention uses metabolic engineering to introduce the endogenous SAM synthase gene metk of Escherichia coli, rebuild the SAM supply pathway, and improve the shortcomings of low catalytic activity and expression level of flavonoid 3′-O-methyltransferase. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 HPLC profile of the mutant strain synthesizing chrysanthemum yellow;

[0021] Figure 2 The yield of methylated products of dominant site mutant W284A and wild type;

[0022] Figure 3 The amount of gentianin synthesized by the recombinant strain overexpressing the metk gene and exogenously added methionine. DETAILED DESCRIPTION

[0023] The technical solution of the present invention is fully described below in conjunction with the drawings in the embodiments of the present invention. The described embodiments are only part of the embodiments of the present invention, in order to enable those skilled in the art to better understand the present invention, but do not impose any limitation on the present invention.

[0024] The present invention provides a 3′-O-methyltransferase mutant, which is obtained by mutating the amino acid at position 284 of a wild-type plant oxygen methyltransferase from rice from tryptophan W to alanine A. The amino acid sequence of the wild-type plant oxygen methyltransferase is shown in SEQ ID NO: 1:

[0025]

[0026] The amino acid sequence of the 3′-O-methyltransferase mutant is shown in SEQ ID NO: 2:

[0027]

[0028] The encoding nucleotide sequence of the 3′-O-methyltransferase mutant is shown in SEQ ID NO: 3:

[0029]

[0030] Note: The yellow ones are mutation sites.

[0031] Embodiment 1:

[0032] 1. Construction of mutant strains and fermentation test:

[0033] O-methyltransferase is a class of enzymes used to modify the structure of secondary metabolites, transferring methyl groups to the hydroxyl, carboxyl, carbon, nitrogen or sulfur atoms of the acceptor molecule to synthesize a variety of methylated derivatives. Flavonoid O-methyltransferase uses flavonoids as substrates to transfer the methyl group provided by S-adenosyl-L-methionine (SAM) to the hydroxyl group of the acceptor, and performs an enzyme-catalyzed reaction to synthesize the corresponding methylated product; rice-derived flavonoid 3′-O-methyltransferase (ROMT, amino acid sequence as shown in SEQ ID NO: 1) is a class I oxygen methyltransferase that specifically acts on the 3′ position of the B ring of the flavonoid skeleton.

[0034] 1. Determination of mutation targets:

[0035] The caffeic acid-O-methyltransferase protein from ryegrass with a known structure and 78% homology to the rice-derived flavonoid 3′-O-methyltransferase protein (COMT PDB ID: 3P9K, amino acid sequence as shown in SEQ ID NO: 5) was used.

[0036]

[0037] As a template, we obtain the protein skeleton model, in the enzyme active center Mutation sites were selected within a certain range, and attempts were made at multiple amino acid residue mutation sites: Met31, Leu34, Trp284, Cys316, Gly330, Val331, Ala372, and Asn373. The principles for screening mutants were to enhance the binding ability of the enzyme to the substrate and to increase the synthesis of the methylated product. Finally, the optimal mutation target was determined to be the amino acid at position 284 of SEQ NO: 1, which was mutated from tryptophan W to alanine A.

[0038] 2. Expression vector construction

[0039] The expression vector selected in this embodiment is the pGS21a plasmid, which is an inducible expression vector. The plasmid itself contains a strong promoter tac-related sequence (including the operator sequence lacO). When an inducer such as IPTG is added, the repressor protein will be prompted to leave the operator sequence to initiate gene expression.

[0040] The pGS21a-OMT plasmid containing the wild-type 3′-O-methyltransferase coding sequence was used as a template. Max DNA Polymeras (Takara) recommended system was used for whole plasmid PCR, where the PCR amplification program was set as follows: 95°C denaturation for 30 sec, 65°C annealing for 15 sec, 72°C extension for 7 min, 19 thermal cycles; 72 extension for 5 min, 25°C storage, to obtain a PCR product containing a point mutation.

[0041] The PCR product containing the point mutation was recovered by 1% agarose gel electrophoresis and connected to the vector plasmid pGS21a. The vector plasmid pGS21a was then transformed into Escherichia coli BL21 (DE3) competent cells and coated on LB screening plates containing ampicillin to obtain a recombinant plasmid containing a specific mutation site. Sequencing analysis was performed and the mutant plasmid was named pGS21a-OMT-W284A.

[0042] The mutant in which tryptophan W was mutated to alanine A showed a positive mutation compared with the wild type.

[0043] The upstream and downstream primers containing the mutation site are designed as follows:

[0044]

[0045] (Note: the darkened bases are the amino acids after mutation)

[0046] 3.3′-O-methyltransferase mutant enzyme activity parameter determination:

[0047] The recombinant E. coli containing the pGS21a-OMT-W284A mutant plasmid was subjected to protein induction expression and purification, and the specific method was as follows:

[0048] Pick the mutant glycerol bacteria stored at -80℃ and streak them on the LB plate containing Amp resistance for activation; pick the activated single colony and culture it overnight in 3mL LB liquid medium containing 3μL Amp (80mg / mL); transfer 1mL of overnight culture solution to 50mL fresh LB liquid medium containing 50μL Amp (80mg / mL) at a ratio of 1:50, and culture at 37℃, 200rpm until OD600=0.6-0.7, take 50μL of pre-induction cells and mark them as (-);

[0049] Add IPTG as an inducer with a final concentration of 0.5 mM, culture in a constant temperature shaking incubator at 30°C, 200 rpm for 4 h, take 50 μL of induced cells and mark them as (+);

[0050] The remaining bacterial liquid was divided into clean 50 mL centrifuge tubes and centrifuged at 4°C and 8000 rpm for 10 min. The supernatant was discarded, and the cells were resuspended with 10 mL of 1×NPB and stored at -80°C for more than 3 h. The cells were thawed at room temperature and PMSF was added to a final concentration of 0.05 mM for cell disruption. The ultrasonic disruptor conditions were as follows: power 60 W; total duration 3 min (ultrasound on 3.0 s, off 3.0 s), and 50 μL of the disrupted components were collected and marked as Total (T);

[0051] The disrupted cells were centrifuged at 4°C and 6000 rpm for 10 min, and 50 μL of the supernatant was collected and labeled as Soluble (S);

[0052] The remaining supernatant was filled into the equilibrated Ni-NTA affinity chromatography column and incubated at 4°C and 90 rpm for 3 h. The effluent was collected and 50 μL of the effluent fraction was taken and marked as Unbound (U).

[0053] The column was washed with 50 times the filler volume of 1×NWB, and 50 μL of the flow-through was taken and marked as Wash (W);

[0054] Eluted with 3 mL of 1×NEB and took 50 μL of the effluent fraction, marked as Eluted (E);

[0055] The mixture was dialyzed in 2L 50mM Tris-HCl precooled for 8h until the imidazole concentration was below 60nM. After the dialysis was completed, the components were collected and sterilized using a 0.22μm filter membrane to obtain the purified 3′-O-methyltransferase mutant.

[0056] Each component collected during the purification process was subjected to SDS-PAGE detection with equal volume loading. The mutant and its wild-type enzyme were both expressed intracellularly soluble and the protein was successfully expressed after induction. The position of the protein band was consistent with the theoretically calculated protein molecular weight, which was 41.2 kDa. The separation gel concentration was 12%, and the preparation steps are shown in Table 1; the concentration of the concentrated gel was 4%, and the preparation steps are shown in Table 2.

[0057] Table 1

[0058]

[0059] Table 2

[0060]

[0061]

[0062] The concentration of 3′-O-methyltransferase after mutation was determined by protein quantification kit (BCA). The concentration of the purified 3′-O-methyltransferase mutant was 4 μg / mL, ignoring Ni. 2+ There was a slight loss of the target protein during the purification process, indicating that a relatively pure 3′-O-methyltransferase mutant was obtained.

[0063] The kinetic constants were determined to illustrate the difference in affinity between the mutant strain and the wild-type strain for the substrate, as well as the catalytic efficiency of the 3′-O-methyltransferase mutant. The specific method is as follows:

[0064] The preferred supply concentration of the fixed methyl donor SAM is 200 μM, luteolin is used as the substrate, the concentration of luteolin is used as the variable, the measured concentration range is 0-60 μM, the pure enzyme concentration is 4 μg / mL, 2 mM DTT (dithiothreitol), and the measurement is carried out in 50 mM Tris-HCl at pH 8.0, 37°C, 200 rpm, and the preferred reaction time is 30 min. The Km value and Vmax value are calculated by plotting according to the Lineweaver-Burk method:

[0065]

[0066] Where: V is the reaction rate (μmol / (min·L)); Vmax is the maximum reaction rate (μmol / (min·L)); Km is the Michaelis constant (μM); [S] = substrate concentration (μM).

[0067] The experimental results are shown in Table 3: The 3′-O-methyltransferase mutant (W284A) has a greatly improved affinity for the substrates luteolin and SAM, and the catalytic efficiency is comparable to that of WT (wild-type 3′-O-methyltransferase), with a slightly weakened catalytic ability. However, after mutation, its affinity for the substrate is greatly improved, thereby increasing the synthesis of the methylated flavonoid compound scutellariae;

[0068] Table 3 Kinetic parameters of luteolin by 3′-O-methyltransferase mutants

[0069]

[0070] The Km of mutant W284A is 21.28 μM, which is less than the Km value of the wild type (71.43 μM), indicating that the affinity of the mutant for the substrate luteolin is significantly improved compared with the wild type; however, its catalytic constant Kcat is 0.05S -1 Lower than the wild type Kcat value of 0.17S -1 , indicating that the catalytic ability of W284A for luteolin was not well improved. After the tryptophan at position 284 was mutated to alanine, the amount of substrate molecules converted by the enzyme per unit time was reduced. In addition, the analysis of the kinetic parameters of SAM showed that the Km value of W284A was 14.43μM, which was lower than the Km value of the wild type of 47.62μM, indicating that the mutant had a better affinity for SAM than the wild type. The Kcat value of W284A was 0.05S -1 It is lower than the wild type, indicating that its SAM catalytic ability is weaker than the wild type. Similarly, the mutation also reduces the enzyme's ability to convert SAM per unit time; but the Kcat / Km value of W284A is 3.47mM -1 S -1 Higher than the wild type Kcat / Km value of 1.89mM -1 S -1 , indicating that the catalytic efficiency of SAM has been improved after mutation.

[0071] II. Construction of a recombinant strain co-expressing 3′-O-methyltransferase and methyl donor SAM synthetase

[0072] 1. Construction of recombinant plasmid of methyl donor SAM synthase

[0073] Using the E. coli genome as a template, primer metk-F (metk-F:

[0074] ATAAGAAGGAGATATACATATGGCAAAACACCTTTTTACGTC) and metk-R (metk-R: CGGTTTCTTTACCAGACTCGAGTTACTTCAGACCGGCAGCA), a specific fragment of metk gene (1155 bp) was amplified from the genome, and the nucleotide sequence of S-adenosyl-L-methionine (SAM) synthetase gene metk is as shown in SEQ ID NO:4:

[0075] atggcaaaac acctttttac gtccgagtcc gtctctgaag ggcatcctga caaaattgct

[0076] gaccaaattt ctgatgccgt tttagacgcg atcctcgaac aggatccgaa agcacgcgtt

[0077] gcttgcgaaa cctacgtaaa aaccggcatg gttttagttg gcggcgaaat caccaccagc

[0078] gcctgggtag acatcgaaga gatcacccgt aacaccgttc gcgaaattgg ctatgtgcat

[0079] tccgacatgg gctttgacgc taactcctgt gcggttctga gcgctatcgg caaacagtct

[0080] cctgacatca accagggcgt tgaccgtgcc gatccgctgg aacagggcgc gggtgaccag

[0081] ggtctgatgt ttggctacgc aactaatgaa accgacgtgc tgatgccagc acctatcacc

[0082] tatgcacacc gtctggtaca gcgtcaggct gaagtgcgta aaaacggcac tctgccgtgg

[0083] ctgcgcccgg acgcgaaaag ccaggtgact tttcagtatg acgacggcaa aatcgttggt

[0084] atcgatgctg tcgtgctttc cactcagcac tctgaagaga tcgaccagaa atcgctgcaa

[0085] gaagcggtaa tggaagagat catcaagcca attctgcccg ctgaatggct gacttctgcc

[0086] accaaattct tcatcaaccc gaccggtcgt ttcgttatcg gtggcccaat gggtgactgc

[0087] ggtctgactg gtcgtaaaat tatcgttgat acctacggcg gcatggcgcg tcacggtggc

[0088] ggtgcattct ctggtaaaga tccatcaaaa gtggaccgtt ccgcagccta cgcagcacgt

[0089] tatgtcgcga aaaacatcgt tgctgctggc ctggccgatc gttgtgaaat tcaggtttcc

[0090] tacgcaatcg gcgtggctga accgacctcc atcatggtag aaactttcgg tactgagaaa

[0091] gtgccttctg aacaactgac cctgctggta cgtgagttct tcgacctgcg cccatacggt

[0092] ctgattcaga tgctggatct gctgcacccg atctacaaag aaaccgcagc atacggtcac

[0093] tttggtcgtg aacatttccc gtggg.

[0094] The cloning vector pACYCDuet-1 was selected, and two restriction sites, Xho I and Nde I, were selected in the multiple cloning site of the vector for double restriction digestion of the vector.

[0095] The target gene fragment and the vector fragment were electrophoresed using 1.2% agarose gel. After the electrophoresis, the amplified specific fragments were recovered from the gel and connected using homologous recombination. The connected products were transformed into Escherichia coli DH5α competent cells. The single colony was verified by enzyme digestion and recombinant plasmid sequencing, and the metk gene was successfully cloned, completing the construction of the recombinant plasmid pACYCDuet-1-metk.

[0096] 2. The recombinant plasmid pACYCDuet-1-metk and the 3′-O-methyltransferase mutant plasmid were co-expressed in the Escherichia coli BL21 (DE3) strain, and the recombinant strain containing the co-expression of the two enzymes was screened and obtained for the production and preparation of the methylated flavonoid compound aureus.

[0097] 3. Fermentation and Condition Optimization of Recombinant Strain

[0098] The mutant strain was tested in a 48-well plate, with a fermentation volume of 1 mL and a substrate addition amount of 200 mg / L luteolin. The OD600 value of the strain was measured after 24 h of fermentation. The content of the methylated flavonoid compound luteolin in the fermentation supernatant was analyzed by high performance liquid chromatography (HPLC). The peaks of the liquid chromatogram of the substrate luteolin and the methylated flavonoid product luteolin are shown in Figure 2. Figure 1 As shown, the retention time of the methylated flavonoid compound luteolin is about 17 minutes and its polarity is weaker than that of the substrate luteolin, wherein the UV detection wavelength is set to 280nm; the mobile phase flow rate is 1mL / min; the acquisition time is 20min; the sample volume is 10μL; the mobile phase A is: acetonitrile containing 0.1% formic acid; the mobile phase B is: water containing 0.1% formic acid; program: 10%-40%A (0-10min), 40%-60%A (10-15min), 60%-10%A (15-20min); chromatographic column: Eclipse XDB-C18 chromatographic column (5μm, 150×4.6mm).

[0099] like Figure 2 As shown, the yield of methylated flavonoids at this site increased by about 45%. The same fermentation method was used for two rounds of screening. The final experimental results showed that the mutant had a maximum yield of 52.80 mg / L of chrysanthemum flavonoids, which was 74% higher than that of the wild type, about 1.7 times higher.

[0100] Adding methionine to the culture medium is an effective method to increase the amount of SAM synthesis. The constructed mutant plasmid was co-expressed with the SAM pathway gene, and the addition or non-addition of methionine was selected to verify the synthesis of scutellariae after overexpression of the SAM pathway gene. The results are shown in Figure 3As shown (where the horizontal axis represents: no optimization item None, exogenous addition of methionine Met, overexpression of SAM synthetase gene metK, exogenous addition of methionine and overexpression of SAM synthetase gene metK-Met, Native represents the wild-type strain, and the vertical axis represents the production of ginsenoside), it is confirmed that the synthesis amount of ginsenoside is higher under the condition of overexpression of SAM synthetase MetK, and the maximum yield of the target product can reach 104.26 mg / L.

[0101] The above is an explanation of the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A 3′-O-methyltransferase mutant, characterized in that: The 3′-O-methyltransferase mutant is obtained by mutating the tryptophan W at position 284 of the wild-type plant oxygen methyltransferase to alanine A. The amino acid sequence of the wild-type plant oxygen methyltransferase is shown in SEQ ID NO: 1, and the amino acid sequence of the 3′-O-methyltransferase mutant is shown in SEQ ID NO:

2.

2. The 3′-O-methyltransferase mutant according to claim 1, characterized in that The amino acid site mutation is performed on the wild-type plant oxygen methyltransferase derived from rice.

3. A gene encoding the 3′-O-methyltransferase mutant according to claim 1, wherein the nucleotide sequence of the gene encoding is shown in SEQ ID NO:

3.

4. A plasmid containing the coding gene according to claim 3, characterized in that The plasmid also contains a gene encoding overexpression of S-adenosyl-L-methionine synthetase.

5. A mutant strain containing the coding gene according to claim 3, characterized in that: The mutant strain also comprises a gene encoding overexpressed S-adenosyl-L-methionine synthetase.

6. A mutant strain, characterized in that The mutant strain is transformed with a recombinant plasmid containing a gene encoding the 3′-O-methyltransferase mutant of claim 1, or A recombinant plasmid overexpressing S-adenosyl-L-methionine synthetase and a recombinant plasmid comprising a gene encoding the 3′-O-methyltransferase mutant of claim 1 are co-transformed.

7. The mutant strain according to claim 6, wherein The recombinant plasmid for overexpressing S-adenosine-L-methionine synthetase is a plasmid pACYCDuet-1 comprising a gene encoding the overexpression S-adenosine-L-methionine synthetase.

8. The mutant strain according to any one of claims 5 to 7, wherein The mutant strain is derived from Corynebacterium glutamicum, Escherichia coli or Bacillus subtilis.

9. Use of one or more of the 3'-O-methyltransferase mutant of claim 1, the encoding gene of claim 3, the plasmid of claim 4, and the mutant strain of any one of claims 5 to 8 in the production of methylated flavonoid compounds.

Images