A quantitative detection technology for single nucleotide polymorphism of live bacterial RNA

Abstract

The present invention discloses a detection technology for quantitative live bacterial RNA single nucleotide polymorphism, which belongs to the field of nucleic acid detection. This method integrates nucleic acid sequence-dependent amplification technology (NASBA), allowing rapid and specific generation of target RNA amplification, and amplification hindrance mutation system (ARMS), which introduces mismatches at the 3' end base of the forward primer to enhance the specificity of identifying single nucleotides, thereby highly selectively identifying RNA mutations, and can sensitively identify single nucleotide polymorphisms with abundance as low as 0.5%, and detect live Salmonella as low as 80 CFU. This technology allows RNA to be amplified under isothermal conditions and single nucleotide polymorphisms on RNA to be detected in a single tube, and can be used to evaluate the presence and vitality of drug-resistant bacteria under the action of disinfectants, and has good application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of nucleic acid detection, and specifically relates to a detection technology for quantitative live bacterial RNA single nucleotide polymorphism, and its application in live bacteria analysis of drug-resistant bacteria exposed to disinfectants. Background Art

[0002] The use and overuse of disinfectants may contribute to the acquisition of stress resistance in bacteria, such as resistance, viable but nonculturable (VBNC) state, through mutation, horizontal gene transfer or other mechanisms. If bacterial pathogens develop resistance, some drugs may be ineffective against bacterial infections (e.g., salmonellosis), resulting in higher treatment costs and a higher risk of side effects. For example, according to the World Health Organization, additional health expenditures are expected to exceed $1 trillion per year by 2050 due to the growing global problem of resistance. The survival of stress-resistant pathogens after exposure to disinfectants may pose a huge threat to public health and environmental safety.

[0003] Analysis of bacterial phenotypes, such as viability and drug resistance, mainly relies on traditional culture-based methods, which may destroy dormant pathogens that grow slowly or not but remain metabolically active. Entering a dormant state allows pathogens to tolerate external stresses (e.g., starvation, extreme temperatures, antibiotics, osmotic effects). In addition to traditional culture-dependent detection, antibody-based (enzyme-linked immunosorbent assay, ELISA) and DNA-targeted methods (e.g., PCR) have been widely used to detect pathogens. Antibody-based diagnostics rely on immobilized antibodies and secondary labeled antibodies to achieve high specificity and sensitivity for identification of target bacterial pathogens, however, immunological methods have difficulty indicating bacterial viability regardless of their physiological conditions. Among DNA-targeted strategies, PCR is the most widely used technology that can detect bacteria quickly and accurately, however, this method cannot identify single nucleotide polymorphisms (SNPs), especially at the transcriptional level, which are associated with the development of bacterial stress resistance phenotypes (e.g., drug resistance).

[0004] Therefore, the development of a detection method that can simultaneously evaluate pathogenic bacterial activity and single nucleotide polymorphisms is of great significance for evaluating bacterial viability after exposure to disinfectants and whether there is the emergence of resistant bacteria. Summary of the invention

[0005] In order to overcome the deficiencies in the prior art, the present invention provides a detection technology for quantitative live bacterial RNA single nucleotide polymorphisms, which integrates nucleic acid sequence-based amplification (NASBA) to allow rapid and specific generation of target RNA amplicons, and an amplification retardation mutation system (ARMS) to specifically distinguish single nucleotides to highly selectively identify RNA mutations, and can also evaluate sample viability while detecting single nucleotide polymorphisms.

[0006] The specific detection steps of the detection technology of quantitative live bacterial RNA single nucleotide polymorphism described in the present invention are as follows:

[0007] (1) Nucleic acid extraction: Extract total RNA from the sample to be tested.

[0008] (2) ARMS-NASBA amplification: The extracted RNA was transferred to the NASBA reaction system for amplification.

[0009] (3) CRISPR reaction. The reaction mixture in step (2) is added to the CRISPR-Cas13a detection system for recognition reaction.

[0010] (4) Fluorescence intensity detection. The fluorescence intensity after the reaction is obtained by a multi-mode microplate reader, and the fluorescence intensity is used to determine whether the target RNA containing the SNP is present.

[0011] This method can specifically amplify the target RNA containing SNP under isothermal conditions and quickly complete the detection of SNP in a single tube.

[0012] Furthermore, the sequences of the specific primers dF and dR required for amplification are shown in SEQ ID NO.1-16 and SEQ ID NO.17, respectively.

[0013] Furthermore, mismatches were artificially introduced at the 1st to 5th positions of the 3' end of the specific primer dF required for amplification to enhance the single-base recognition specificity.

[0014] Furthermore, the enzyme mixture in the ARMS-NASBA amplification reaction system includes ribonuclease H (RNaseH), reverse transcriptase (ProtoScript RT) and RNA polymerase (T7 polymerase).

[0015] Furthermore, the reaction steps of ARMS-NASBA are: before adding the enzyme mixture, incubate at 65°C for 5 to 10 minutes, then cool to 41°C for 5 to 15 minutes for equilibrium, add the enzyme mixture, and incubate at 41°C for 1 to 3 hours.

[0016] Furthermore, the CRISPR reaction system includes ARMS-NASBA reaction mixture, LwaCas13a buffer, Lwacas13a, crRNA, reporter probe and water.

[0017] Furthermore, the reporter probe is a single-stranded RNA molecule labeled with a fluorescent group at the 5' end and modified with a quenching group at the 3' end, and its nucleic acid structure is 5'FAM-UUUUU-3'BHQ1 (5'FAM represents FAM at the 5' end, 3'BHQ1 represents BHQ1 at the 3' end).

[0018] Furthermore, the crRNA sequence used for CRISPR reaction is shown as SEQ ID NO.20 or SEQ ID NO.22 or SEQ ID NO.24 or SEQ ID NO.26; the aforementioned crRNA can be obtained by in vitro transcription.

[0019] The detection principle of this method is as follows Figure 1 As shown. The NASBA reaction involves a pair of primers, a forward primer and a reverse primer. The reverse primer facilitates the reverse transcription of the gyrA RNA fragment into a single-stranded cDNA by reverse transcriptase. The forward primer with a T7 promoter sequence binds to the cDNA product to further form a double-stranded DNA template with transcriptional activity, which is used to synthesize RNA amplicons in the presence of T7 RNA polymerase. In this work, the ARMS principle was used to rationally design primers so that the 3' end of the primer mismatches the wide gyrA mRNA base at the mutation site. Therefore, metastable binding only allows the mutant gyrA mRNA to be successfully amplified by the NASBA reaction. The mutant gyrA mRNA amplicon specifically hybridizes with the clustered regularly interspaced short palindromic repeats-associated Cas13a protein (CRISPR-Cas13a) crRNA, and the non-selective ribonuclease activity of Cas13a is activated to cut the single-stranded RNA labeled with a fluorophore and a quencher group, and the fluorescence of the fluorophore is released, and finally a fluorescent signal is output.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] 1. This method provides an isothermal RNA amplification method with single-base mutation recognition capability and can directly detect bacterial RNA, thereby simultaneously evaluating the activity and drug resistance of pathogens.

[0022] 2. This method is an innovative application of the amplification-hindering mutation system in nucleic acid sequence-based amplification.

[0023] 3. The method provided by the present invention has good specificity and can detect single nucleotide polymorphisms as low as 0.5%. Quantitative reverse transcription PCR (RT-qPCR) was performed for comparison. When gyrA mRNA was less than 5%, RT-qPCR failed to detect the mutant.

[0024] 4. The method provided by the present invention has high sensitivity. When the concentration of mutant gyrA mRNA is as low as 2.5 fM, the fluorescence signal can be distinguished from the blank control.

[0025] 5. This method can quickly detect single nucleotide polymorphisms in a single tube, does not rely on large instruments, and is conducive to real-time detection on site.

[0026] 6. This method can be used to evaluate the effects of different disinfectants and can be used to monitor live bacteria and drug-resistant pathogens simultaneously. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a schematic diagram of the detection technology for quantitative live bacterial RNA single nucleotide polymorphism provided by the present invention.

[0028] Figure 2 This is a method to verify the technical principle of this method. (A) and (B) show the fluorescence intensity and fluorescence spectrum of this method after the reaction in the presence of mutant gyrA mRNA or wild-type gyrA mRNA, or in the absence of mutant gyrA mRNA, RNase H, ProtoScript II reverse transcriptase, T7 polymerase and Cas13a; (C) shows the electrophoresis analysis of the above process.

[0029] Figure 3 The reaction condition optimization method of this method is shown. (A) shows the fluorescence intensity and corresponding signal ratio of mutant and wild-type gyrA mRNA using different forward primers; (B) shows the fluorescence intensity and corresponding signal ratio of mutant and wild-type gyrA mRNA at different NASBA reaction times; (C) shows the fluorescence intensity generated after the reaction of Cas13a-guide RNA with different sites; (D) shows the nucleotide sequence of Cas13a gRNA and its corresponding RNA target.

[0030] Figure 4The sensitivity of the method for detecting SNPs in gyrA mRNA is shown. (A) Schematic diagram of the process of analyzing mutant and wild-type gyrA mRNA using the method; (B) Fluorescence intensity obtained with different proportions of mutant gyrA mRNA (0~100%), and the established linear relationship between fluorescence intensity and mutant gyrA mRNA proportion; (C) Typical fluorescence spectra generated by different concentrations of mutant gyrA mRNA (0~1000 fM).

[0031] Figure 5 The method is shown to quantify live Salmonella. (A) Schematic diagram of the process for analyzing different ratios of live and dead quinolone-resistant Salmonella; (B) The method detects different ratios of live quinolone-resistant Salmonella (0-100%, total 3.82×10 6 The fluorescence intensity was obtained by measuring the number of live quinolone-resistant Salmonella (CFU), and a linear relationship between the fluorescence intensity and the number of live quinolone-resistant Salmonella was established; (C) Typical fluorescence spectra after adding different numbers of live quinolone-resistant Salmonella.

[0032] Figure 6 The effects of disinfectants on the resistance and survival of Salmonella are evaluated using this method. (A) Represents the workflow of disinfectant bactericidal evaluation; (B) Represents the quantification of mutation rate of quinolone-resistant Salmonella; (C) Represents the quantification of viable counts of quinolone-resistant Salmonella; (D) Colony determination of LB medium and LB medium supplemented with ciprofloxacin (LB+CIP) under different disinfection treatments; (E) Salmonella cell recovery test on LB medium treated with quaternary ammonium salts, ethanol and sodium hypochlorite and LB medium supplemented with ciprofloxacin (LB+CIP); (F) Gene expression of quinolone-sensitive Salmonella and quinolone-resistant Salmonella after disinfectant treatment; (G) Pattern of Salmonella to disinfectant stressor. DETAILED DESCRIPTION

[0033] The following is a further description of the detection technology of the quantitative live bacterial RNA single nucleotide polymorphism provided by the present invention in conjunction with examples and drawings. It should be understood that the following embodiments of the present invention are only used to explain the present invention, rather than to limit the present invention. Based on the embodiments described in the present invention, other forms of modification, replacement or change of the present invention by common technical knowledge and conventional means in the art are all within the scope of protection of the present invention.

[0034] Example 1: Design of primers and probes for detection of drug-resistant mutation SNPs in Salmonella

[0035] In this example, we selected the gyrA mRNA fragment as the target sequence. The gyrA gene is involved in encoding DNA gyrase (the main target of quinolones). Single base mutations in the gyrA gene are related to the resistance of Gram-positive and Gram-negative strains (such as Salmonella and Escherichia coli) to quinolones, etc. Therefore, the detection of SNPs in gyrA is one of the most important indicators of bacterial resistance phenotypes. Using the gyrA mRNA containing SNP as a template for primer design, according to the relevant principles of primer design, a single or multiple mismatches are introduced at positions 1 to 5 at the 3' end of the gyrA mRNA-specific forward primer containing SNP to enhance the specificity of detecting low-abundance SNPs. Primers at different mismatch positions are all commercially synthesized. The forward primers for ARMS-NASBA amplification are dF0~dF15 (the nucleic acid sequences are shown in SEQ ID NO.1~16, respectively). It was found through experiments that a single mismatch at the 3' end base of the forward primer dF0 brought the highest signal-to-noise ratio (such as Figure 3 A). The reverse primer for ARMS-NASBA amplification is dR, and its nucleic acid sequence is shown in SEQ ID NO.17. The crRNA sequence of Cas13a is CR1 or CR2 or CR3 or CR4, and its nucleic acid sequence is shown in SEQ ID NO.20, SEQ ID NO.22, SEQ ID NO.24, and SEQ ID NO.26. The experiment showed that CR3 had the highest signal-to-noise ratio (as shown in Figure 3 C). In this embodiment, the preferred forward primer for ARMS-NASBA amplification is dF0 (the nucleic acid sequence is shown in SEQ ID NO.1), and the reverse primer is dR (the nucleic acid sequence is shown in SEQ ID NO.17); the preferred sequence of crRNA of Cas13a is CR3 (the nucleic acid sequence is shown in SEQ ID NO.24); the nucleic acid structure of the reporter probe is 5'FAM-UUUUU-3'BHQ1 (5'FAM represents FAM at the 5' end, and 3'BHQ1 represents BHQ1 at the 3' end).

[0036] Example 2: In vitro transcription of Cas13a-crRNA

[0037] In this example, an in vitro transcription reaction was performed using a 40 μL mixture containing 4 μL of oligonucleotide template (10 μM, SEQ ID NO.19 or SEQ ID NO.21 or SEQ ID NO.23 or SEQ ID NO.25), 4 μL of T7 promoter (10 μM, SEQ ID NO.18), 4 μL of 10×phi29 DNA polymerase buffer (330 mM Tris-acetate (pH 7.9 at 37°C), 100 mM magnesium acetate, 660 mM K-acetate, 1% (v / v) Tween 20, 10 mM DTT) and 13.5 μL of water. The oligonucleotide template was denatured by incubation at 90°C for 3 minutes, and then cooled at room temperature for 20 minutes. Subsequently, 0.5 μL of phi29 DNA polymerase (1 U / μL) and 1 μL of dNTPs (10 mM) were added to the mixture to form a double-stranded template at 30°C for 30 minutes. Afterwards, 8 μL of 5× transcription buffer (200 mM Tris-HCl (pH 7.9 at 25°C), 30 mM MgCl2, 50 mM DTT, 50 mM NaCl and 10 mM spermidine), 2 μL of T7 RNA polymerase (20 U / μL) and 3 μL of rNTPs (25 mM) were added to the mixture, and then incubated at 37°C for 5 hours. After transcription, 4 μL of DNase I was added to degrade the DNA template and incubated at 37°C for 2 hours. It was then inactivated at 70°C for 10 minutes. The crRNA of Cas13a was obtained.

[0038] Example 3: ARMS-NASBA-Cas13a reaction

[0039] (1) Experimental procedures: Total bacterial RNA was extracted using the Trizol method. Bacterial cells were pelleted by centrifugation at 5,940 × g, 4°C for 10 min. 5 ~10 70.3~0.4 mL Trizol reagent was added to each cell to lyse the cells. After mixing, the mixture was incubated for 10 minutes to completely dissociate the nucleoprotein complex. 200 μL / mL Trizol reagent in chloroform was added to the mixture, followed by vigorous shaking for 1 minute and incubation at room temperature for 2 minutes. The mixture was separated into three phases by centrifugation at 12,000 × g for 15 minutes at 4°C, including a colorless upper aqueous phase, a middle phase, and a red lower phenol-chloroform phase. The upper aqueous phase was then removed and thoroughly mixed with 0.5 mL isopropanol, followed by incubation for 10 minutes and centrifugation at 12,000 × g and 4°C for 10 minutes. The RNA pellet was washed three times with 1 mL 75% ethanol and centrifuged at 7,500 × g at 4°C for 5 minutes. The RNA pellet was then air-dried for 5~10 minutes and resuspended in RNase-free water. Transfer 1 μL of extracted RNA to the NASBA reaction system, which contains 1 μL of primer mixture (forward and reverse ARMS primers, 500 nM) (SEQ ID NO.1 and SEQ ID NO.17), 5 μL of 4× buffer (120 mMTris-HCl, pH 8.0, 39.6 mM MgCl2, 225 mM KCl, 30 mM DTT, 32% DMSO), 2 μL of nucleotide mixture (2.5 mM dNTP, 18.75 mM rNTP) and 6 μL of water. Incubate the mixture at 65°C for 5 minutes and then cool to 41°C for 10 minutes to equilibrate. Then, 5 μL of enzyme mixture (15 U / mL RNase H, 10,000 U / mL ProtoScript RT, 25,000 U / mL T7 polymerase, 0.48 mg / mL BSA, 120 mM Tris–HCl pH 8.0, 39.6 mM MgCl2, 225 mM KCl, 30 mM DTT was added to the mixture) and then incubated at 41°C for 1-3 hours. The above reaction mixture (4 μL) was then detected by the Cas13a assay, which contained 4 μL 10×LwaCas13a buffer, 0.4 μL Lwacas13a (10 μM), 4 μL crRNA (2 μM, SEQ ID NO.24), 4 μL polyU reporter gene (5 μM, nucleic acid structure is 5'FAM-UUUUU-3'BHQ1) and 23.6 μL nuclease-free water, and incubated at 37°C for 30 minutes. Afterwards, Lwacas13a was inactivated at 65 °C for 3 min to terminate the CRISPR-Cas reaction.Fluorescence intensity was obtained by a multimode microplate reader (Synergy H1, BioTek Instruments, Inc., VT, USA) at an excitation wavelength of 480 nm and an emission wavelength range of 510-600 nm. (2) Proof of principle: RNA from resistant Salmonella strains and an equal amount of RNA from a standard Salmonella strain were extracted. Using RNA from a Salmonella resistant strain, the reaction was carried out according to the experimental step (1); using RNA from a Salmonella standard strain, the reaction was carried out according to the experimental step (1); using an equal amount of ultrapure water instead of RNaseH, the reaction was carried out according to the experimental step (1); using RNA from a Salmonella resistant strain, the reaction was carried out according to the experimental step (1) using an equal amount of ultrapure water instead of ProtoScriptII, the reaction was carried out according to the experimental step (1); using RNA from a Salmonella resistant strain, the reaction was carried out according to the experimental step (1) using an equal amount of ultrapure water instead of T7polymerase, the reaction was carried out according to the experimental step (1); using RNA from a Salmonella resistant strain, the reaction was carried out according to the experimental step (1) using an equal amount of ultrapure water instead of cas13a; the fluorescence intensity after the reaction was measured using an enzyme reader. Electrophoresis was performed as follows: 5 μL of the nucleic acid solution obtained in the above reaction was thoroughly mixed with 1 μL of 6× DNA loading buffer (10 mM Tris-HCl (pH 7.6), 60% glycerol, 100 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol FF). The mixture was then analyzed by 3% (w / v) agarose gel electrophoresis at a constant voltage of 150 V for 40 min. The gel was visualized using the Gel Doc XR+ system (Bio-Rad Laboratories, Inc., CA, USA). The experimental results are shown in Figure 2. Figure 2 As shown, the results indicate that the primers designed by this method exhibit excellent specificity for identifying single nucleotide variations and high sensitivity for detecting low-abundance RNA.

[0040] Example 4: Detection of SNPs in gyrAmRNA using this method

[0041] Wild-type and mutant Salmonella RNA were extracted and mixed in a ratio of 0%, 0.01%, 0.1%, 0.5%, 1%, 20%, 40%, 50%, 60%, 70%, 90%, and 100% of the mutant and wild-type, respectively, and the total RNA amount was 600 ng. The mixed RNA solution was used to react according to the reaction step of experimental step (1) in Example 3, and the fluorescence intensity values ​​corresponding to the mixed solutions of Salmonella RNA in different ratios were recorded. The standard curve was fitted with the ratio as the horizontal axis and the fluorescence intensity as the vertical axis. The results are shown in FIG. Figure 4As shown in B, in the ratio range of 0% to 100%, the fluorescence intensity is linear, and the regression equation is y=253.15x+1093.4, R 2 =0.9811.

[0042] Example 5: Detection of live quinolone-resistant Salmonella

[0043] To prepare dead bacterial cells, freshly cultured quinolone-resistant Salmonella XJ9S was treated with 70% isopropanol for 2 h at room temperature with thorough mixing every 15 min. The dead cell pellet was obtained by centrifugation (5,940 × g, 4 °C, 10 min) and then washed three times with sterile saline solution to remove the remaining isopropanol. A total of 3.82 × 10 6 Different proportions of CFU of quinolone-resistant live Salmonella XJ9S were obtained. RNA was extracted according to the experimental steps of Example 3 (1), and the detection was carried out according to the method of experimental step (1) to measure the fluorescence intensity. Results As the proportion of live quinolone-resistant Enterobacteriaceae XJ9S increased, the fluorescence intensity increased accordingly ( Figure 5 B). In order to quantify the quinolone-resistant live bacteria XJ9S cells, a linear model was established to determine the fluorescence intensity of the quinolone-resistant live bacteria XJ9S when the cell mass was 4.9-7.2 log10 CFU. The fitting equation was y = 6615.8x-25181 (R 2 = 0.9807), where y is the fluorescence intensity and x represents the amount of viable quinolone-resistant Salmonella (log10 CFU) ( Figure 5 C). The results showed that the method can identify and detect viable quinolone-resistant Salmonella enterica at a concentration as low as 80 CFU.

[0044] Example 6: Analysis of bacterial resistance phenotypes under disinfectant exposure

[0045] We used a quantitative live bacterial RNA single nucleotide polymorphism assay to assess the ability of quinolone-susceptible and -resistant Salmonella to survive exposure to commonly used commercial disinfectants (quaternary ammonium salts, 75% ethanol, peracetic acid, chlorine dioxide, sodium hypochlorite). Figure 6 A). Test according to the experimental steps of Example 3 (1). Figure 6As shown in B, after treatment with quaternary ammonium salt, 75% ethanol and peracetic acid, the ratio of mutant gyrA mRNA increased to 93.46%, 62.56% and 93.64%, respectively. The results showed that compared with quinolone-sensitive Salmonella enterica strains, quinolone-resistant strains showed higher survival ability under the stress of quaternary ammonium salt, 75% ethanol and peracetic acid. In addition, the treatment of chlorine dioxide and sodium hypochlorite significantly reduced the ratio of mutant gyrA RNA.

[0046] Sequence Listing

[0047] <110> Sichuan University

[0048] <120> A quantitative detection technology for single nucleotide polymorphism of live bacterial RNA

[0049] <160> 26

[0050] <170> SIPOSequenceListing 1.0

[0051] <210> 1

[0052] <211> 43

[0053] <212> DNA

[0054] <213> Artificial Sequence

[0055] <400> 1

[0056] taatacgact cactataggg aaataccatc cccacggcga ttt 43

[0057] <210> 2

[0058] <211> 43

[0059] <212> DNA

[0060] <213> Artificial Sequence

[0061] <400> 2

[0062] taatacgact cactataggg aaataccatc cccacggcga att 43

[0063] <210> 3

[0064] <211> 43

[0065] <212> DNA

[0066] <213> Artificial Sequence

[0067] <400> 3

[0068] taatacgact cactataggg aaataccatc cccacggcga gtt 43

[0069] <210> 4

[0070] <211> 43

[0071] <212> DNA

[0072] <213> Artificial Sequence

[0073] <400> 4

[0074] taatacgact cactataggg aaataccatc cccacggcga ctt 43

[0075] <210> 5

[0076] <211> 43

[0077] <212> DNA

[0078] <213> Artificial Sequence

[0079] <400> 5

[0080] taatacgact cactataggg aaataccatc cccacggcgt ttt 43

[0081] <210> 6

[0082] <211> 43

[0083] <212> DNA

[0084] <213> Artificial Sequence

[0085] <400> 6

[0086] taatacgact cactataggg aaataccatc cccacggcgg ttt 43

[0087] <210> 7

[0088] <211> 43

[0089] <212> DNA

[0090] <213> Artificial Sequence

[0091] <400> 7

[0092] taatacgact cactataggg aaataccatc cccacggcgc ttt 43

[0093] <210> 8

[0094] <211> 43

[0095] <212> DNA

[0096] <213> Artificial Sequence

[0097] <400> 8

[0098] taatacgact cactataggg aaataccatc cccacggcta att 43

[0099] <210> 9

[0100] <211> 43

[0101] <212> DNA

[0102] <213> Artificial Sequence

[0103] <400> 9

[0104] taatacgact cactataggg aaataccatc cccacggcta gtt 43

[0105] <210> 10

[0106] <211> 43

[0107] <212> DNA

[0108] <213> Artificial Sequence

[0109] <400> 10

[0110] taatacgact cactataggg aaataccatc cccacggcta ctt 43

[0111] <210> 11

[0112] <211> 43

[0113] <212> DNA

[0114] <213> Artificial Sequence

[0115] <400> 11

[0116] taatacgact cactataggg aaataccatc cccacggcaa att 43

[0117] <210> 12

[0118] <211> 43

[0119] <212> DNA

[0120] <213> Artificial Sequence

[0121] <400> 12

[0122] taatacgact cactataggg aaataccatc cccacggcaa gtt 43

[0123] <210> 13

[0124] <211> 43

[0125] <212> DNA

[0126] <213> Artificial Sequence

[0127] <400> 13

[0128] taatacgact cactataggg aaataccatc cccacggcaa ctt 43

[0129] <210> 14

[0130] <211> 43

[0131] <212> DNA

[0132] <213> Artificial Sequence

[0133] <400> 14

[0134] taatacgact cactataggg aaataccatc cccacggcca att 43

[0135] <210> 15

[0136] <211> 43

[0137] <212> DNA

[0138] <213> Artificial Sequence

[0139] <400> 15

[0140] taatacgact cactataggg aaataccatc cccacggcca gtt 43

[0141] <210> 16

[0142] <211> 43

[0143] <212> DNA

[0144] <213> Artificial Sequence

[0145] <400> 16

[0146] taatacgact cactataggg aaataccatc cccacggcca ctt 43

[0147] <210> 17

[0148] <211> 16

[0149] <212> DNA

[0150] <213> Artificial Sequence

[0151] <400> 17

[0152] cctgaccatc caccag 16

[0153] <210> 18

[0154] <211> 20

[0155] <212> DNA

[0156] <213> Artificial Sequence

[0157] <400> 18

[0158] taatacgact cactataggg 20

[0159] <210> 19

[0160] <211> 86

[0161] <212> DNA

[0162] <213> Artificial Sequence

[0163] <400> 19

[0164] gtatggcgca gccattctcg ctgcgttaca gttttagtcc ccttcgtttt tggggtagtctaaatcccct atagtgagtc gtatta 86

[0165] <210> 20

[0166] <211> 66

[0167] <212> RNA

[0168] <213> Artificial Sequence

[0169] <400> 20

[0170] gauuuagacu accccaaaaa cgaaggggac uaaaacugua acgcagcgag aauggcugcgccauac 66

[0171] <210> twenty one

[0172] <211> 86

[0173] <212> DNA

[0174] <213> Artificial Sequence

[0175] <400> twenty one

[0176] tcgttcgtat ggcgcagcca ttctcgctgc gttttagtcc ccttcgtttt tggggtagtctaaatcccct atagtgagtc gtatta 86

[0177] <210>22

[0178] <211>66

[0179] <212>RNA

[0180] <213>Artificial Sequence

[0181] <400>22

[0182] gauuuagacu accccaaaaa cgaaggggac uaaaacgcag cgagaauggc ugcgccauacgaacga 66

[0183] <210>23

[0184] <211>86

[0185] <212>DNA

[0186] <213>Artificial Sequence

[0187] <400>23

[0188] gcgttacatg ctggtggatg gtcagggtaa gttttagtcc ccttcgtttt tggggtagtctaaatcccct atagtgagtc gtatta 86

[0189] <210>24

[0190] <211>66

[0191] <212>RNA

[0192] <213>Artificial Sequence

[0193] <400>24

[0194] gauuuagacu accccaaaaa cgaaggggac uaaaacuuac ccugaccauc caccagcauguaacgc 66

[0195] <210> 25

[0196] <211> 86

[0197] <212> DNA

[0198] <213> Artificial Sequence

[0199] <400> 25

[0200] cagccattct cgctgcgtta catgctggtg gttttagtcc ccttcgtttt tggggtagtctaaatcccct atagtgagtc gtatta 86

[0201] <210> 26

[0202] <211> 66

[0203] <212> RNA

[0204] <213> Artificial Sequence

[0205] <400> 26

[0206] gauuuagacu accccaaaaa cgaaggggac uaaaaccacc agcauguaac gcagcgagaauggcug 66

Claims

1. An ARMS-NASBA detection method for quantitative live bacterial RNA single nucleotide polymorphism for non-disease diagnosis or treatment purposes, characterized in that: The steps include: (1) Extract RNA from the sample to be tested; (2) The extracted RNA is transferred to an ARMS-NASBA reaction system, wherein the reaction system contains specific primers for recognizing single nucleotide polymorphisms (SNPs), wherein the nucleic acid sequences of the forward primer dF and the reverse primer dR are shown in SEQ ID NO.1 and SEQ ID NO.17, respectively, and the target RNA region containing the SNP can be amplified by ARMS-NASBA. The forward primer dF artificially introduces mismatches to enhance the specificity of single-base recognition; (3) adding the ARMS-NASBA amplification product of step (2) to a CRISPR reaction system for recognition reaction, wherein the CRISPR reaction system includes the ARMS-NASBA amplification product, LwaCas13a buffer, Lwacas13a, crRNA, a reporter probe and water, wherein the nucleic acid sequence of crRNA is as shown in SEQ ID NO. 24, and the nucleic acid structure of the reporter probe is 5'FAM-UUUUU-3'BHQ1; (4) Read the fluorescence intensity of the reaction product of step (3), determine whether the target RNA containing the SNP is present in the sample to be tested based on the fluorescence intensity, and quantify the target RNA using the standard curve.

2. The method according to claim 1, characterized in that The ARMS-NASBA amplification reaction system includes target RNA, primer mixture, buffer, dNTP, rNTP, enzyme mixture and water, and the enzyme mixture includes ribonuclease H, reverse transcriptase and T7 RNA polymerase.

3. The method according to claim 2, characterized in that The reaction steps of ARMS-NASBA are as follows: before adding the enzyme mixture, incubate at 65°C for 5-10 minutes, then cool to 41°C for 5-15 minutes to equilibrate, add the enzyme mixture, and incubate at 41°C for 1-3 hours.

4. The method according to claim 1, characterized in that: The aforementioned crRNA can be obtained by in vitro transcription.

5. Use of the ARMS-NASBA detection method for quantitative live bacterial RNA single nucleotide polymorphism for non-disease diagnosis or treatment purposes as described in any one of claims 1 to 4 in detecting drug-resistant bacterial RNA containing SNPs, characterized in that: The use is for purposes other than disease diagnosis or treatment.

Images