A molecular marker linked to a juvenile QTL in kiwifruit and its application
Through the detection of QTL chain molecular markers in childhood, the problem of long breeding time caused by long childhood in kiwi fruit breeding is solved, and early selection and efficient breeding are achieved.
Patent Information
- Application Number
- CN202211279737.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-19
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2042-10-19
AI Technical Summary
In traditional breeding methods, the long childhood period of kiwi fruit leads to long breeding time, making it difficult to choose early, and reduces breeding efficiency.
A molecular marker linked to kiwi fruit childhood QTL is provided, and the childhood traits of kiwi fruit plants are predicted by detecting the genotype of specific SNP sites, and the childhood traits of kiwi fruit plants are rapidly detected using PCR amplification and sequencing technology.
Early prediction of kiwi fruit plants in childhood has been achieved, breeding selection efficiency, shorten breeding time, and save production costs.
Smart Images

Figure CN115838824B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology and genetic breeding, and in particular to a molecular marker linked to a kiwifruit juvenile QTL and its application. Background Art
[0002] Molecular marker technology, based on inter-individual nucleotide sequence variation, directly reflects the genetic variation of individual organisms and can detect differences between individuals at the nucleotide sequence level. Compared with traditional morphological and cytological markers, it offers numerous advantages: it is unaffected by climate and environmental factors, can be detected in all tissues, organs, and developmental stages of plants, and exhibits high polymorphism. Currently, this technology is widely used in genetic diversity analysis, germplasm resource identification, genetic map construction, phylogenetic studies, and molecular marker-assisted breeding.
[0003] Kiwifruit is rich in nutrients like vitamin C, protein, and sugar, as well as minerals like calcium, phosphorus, and iron, making it a popular choice among consumers. Varieties are the foundation of industrial development. Traditional breeding methods, which rely on phenotypic selection, are time-consuming, labor-intensive, and difficult, with cultivating a single new variety taking 10-15 years. Kiwifruit seedlings typically have a long juvenile period, with genetics playing a key role in determining the duration of this period. Kiwifruit seedlings often flower several years after being planted, significantly increasing breeding time and reducing efficiency. The long juvenile period of fruit trees is a bottleneck in improving breeding efficiency, making the selection of the appropriate juvenile period crucial in kiwifruit breeding and production practices. Prematurely selecting plants with a relatively short juvenile period not only optimizes land use and avoids waste, but also significantly shortens the period between flowering and fruiting, reducing breeding time. Summary of the Invention
[0004] The purpose of the present invention is to provide a molecular marker linked to the kiwifruit juvenile QTL and its application to solve the problems existing in the above-mentioned prior art. The molecular marker provided by the present invention is tightly linked to the kiwifruit juvenile QTL and can be used to predict the juvenile traits of kiwifruit plants.
[0005] To achieve the above object, the present invention provides the following solutions:
[0006] The present invention provides a molecular marker linked to a kiwifruit juvenile QTL, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1; there is a SNP site at 117 bp of the molecular marker, which is A or C.
[0007] Furthermore, the genotype of the SNP site is AA or AC.
[0008] Furthermore, when the genotype of the SNP site is AA, the juvenile stage of the kiwifruit plant is greater than AC.
[0009] The present invention also provides a method for predicting the juvenile stage of kiwifruit plants using the above-mentioned molecular markers, comprising the following steps:
[0010] (1) Obtaining genomic DNA of the kiwifruit plant to be predicted;
[0011] (2) The genomic DNA was amplified by PCR using the primer pair shown in SEQ ID NO. 2-3 to obtain an amplified product, which was then sequenced to obtain the genotype of the 117 bp amplified product. When the genotype was AA, the juvenile stage of the kiwifruit plant was greater than AC.
[0012] Furthermore, in step (1), the PCR amplification reaction system includes: 2×Hieff PlusPCR Master Mix (With Dye) 25 μL, forward and reverse primers 2 μL each, genomic DNA template 3 μL, ddH2O to 50 μL.
[0013] Furthermore, in step (1), the reaction procedure of the PCR amplification is: 98°C for 3 min; 98°C for 10 sec, 58°C for 20 sec, 72°C for 30 sec; and 72°C for 5 min.
[0014] The present invention also provides a kit for predicting the juvenile stage of kiwifruit plants, comprising a primer pair as shown in SEQ ID NO. 2-3.
[0015] The present invention also provides application of the molecular marker or kit in kiwifruit breeding.
[0016] Furthermore, the application is to predict the childhood of kiwifruit plants.
[0017] The present invention discloses the following technical effects:
[0018] The present invention locates a QTL linked to kiwifruit juvenile growth in kiwifruit. Conventional breeding methods are difficult to determine kiwifruit tree growth traits during the seedling stage, and the accuracy and breeding efficiency are low. However, by detecting molecular markers linked to these traits, not only can production costs be reduced, but selection efficiency can also be greatly improved. The present invention locates the QTL locus for kiwifruit juvenile growth, and the detection method for the molecular marker locus is convenient and fast, unaffected by climate, environment, and other factors. By detecting molecular markers linked to these traits, the juvenile traits of kiwifruit plants can be predicted, allowing for early screening. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0020] Figure 1 for Figure 1 Genetic map of hybrid populations of Actinidia chinensis;
[0021] Figure 2 The results of childhood testing of 173 individual plants are shown; ** indicates P < 0.01. DETAILED DESCRIPTION
[0022] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0023] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0024] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0025] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.
[0026] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0027] Example 1
[0028] 1. Methods
[0029] 1. The Chinese kiwifruit variety "Hongyang" was used as the female parent and the matching male plant of "Boshan Biyu" was used as the male parent to hybridize to obtain the F1 generation, from which 173 individual plants were selected as research objects.
[0030] 2. Take fresh young leaves of 173 individual plants in the hybrid population and the hybrid parents, quickly freeze them in liquid nitrogen, and use the SDS method to extract genomic DNA, and test the DNA quality.
[0031] 3. Qualified genomic DNA was randomly sheared using enzymes, end-repaired, A-tailed, and supplemented with Illumina sequencing adapters. The DNA fragments were amplified and enriched by PCR, and the products were purified. Sequencing libraries were constructed for the male plants of the diploid Chinese kiwifruit varieties "Hongyang" and "Boshan Biyu" and 173 progeny plants. The sequencing libraries were tested and quantified using real-time PCR. Finally, sequencing was performed on a Novasek 6000 sequencer using the PE 150 sequencing strategy.
[0032] 4. The raw data from the Illumina platform were filtered using FASTP (version 0.18.0) with the following filtering criteria: (1) reads containing ≥10% unknown nucleotides (N) were removed; (2) reads containing ≥50% bases with a phred quality score ≤20 were removed; and (3) reads containing sequencing adapters were deleted. The filtered reads were aligned to the reference genome using the alignment software BWA (version 0.7.12) using the mem algorithm with the alignment parameters -k32-M. After alignment, the results were labeled using the software Picard (version 1.129), and population SNP detection was performed using the variant detection software GATK. The distribution of SNP detection results across the genome is shown in Table 1.
[0033] Table 1 Distribution of SNP detection results on the genome
[0034]
[0035] 5. Based on the SNP information obtained from the above analysis, the evolutionary tree was constructed using the treebest software and the neighbor-joining method. Principal component analysis was performed using plink and GCAT64 software. The population structure was analyzed using admixture software to complete the population analysis of the composition population.
[0036] 6. After preliminary quality filtering and variant detection, a VCF file containing variant information was obtained, which was further filtered according to the following criteria: (1) SNP markers were filtered using bcftools software; (2) markers with a genotype missing rate greater than 0.02, samples with a sample missing rate greater than 0.03, and markers with a minor allele frequency less than 0.05 were removed using Plink software; (3) markers with parental genotypes of "0 / 0×0 / 1", "0 / 1×0 / 0", "0 / 1×0 / 1", "0 / 1×1 / 1", and "1 / 1×0 / 1" were retained using the R program, and markers that did not segregate in the progeny were removed; (4) chi-square tests were performed to remove markers with severe skewed segregation. The results of SNP filtering are summarized in Table 2.
[0037] Table 2 Summary of SNP filtering results
[0038]
[0039] 7. Genetic map was constructed using Lep-MAP3 software. The genetic map of the hybrid population of Actinidia chinensis is shown in Figure 1 Each linkage group was repeated five times, and the one with the highest likelihood value was selected as the final result. The genetic positions between markers and the LOD value matrix of markers to each genetic position were obtained, and a high-density genetic linkage map of the diploid Chinese kiwifruit hybrid population was constructed.
[0040] 8. Measure and evaluate 173 hybrid offspring plants, and calculate the number of years from planting to flowering.
[0041] 9. QTL mapping was performed using R / qtl, using the composite interval mapping method cim() function, with a scanning step size of 1 cM and an LOD threshold of 3. Finally, QTL loci related to childhood were detected.
[0042] 10. Molecular marker detection steps:
[0043] (1) Fresh young leaves of 173 progeny plants and hybrid parents were taken, quickly frozen in liquid nitrogen, and then genomic DNA was extracted using the SDS method.
[0044] (2) According to 2×Hieff Plus PCR Master Mix (With Dye) kit instructions, design a 50μL reaction system: 2×Hieff Add 25 μL of PCR Master Mix (With Dye), 2 μL of forward and reverse primers, 3 μL of kiwifruit genomic DNA template, and ddH2O to 50 μL.
[0045] (3) PCR amplification procedure is shown in Table 3.
[0046] Table 3
[0047]
[0048]
[0049] After the PCR amplification process is completed, store it at 4°C.
[0050] (4) The PCR products were subjected to Sanger sequencing to detect the marker sites, and the kiwifruit juvenile stage was predicted based on the base types at the molecular markers, thereby achieving the goal of efficient breeding.
[0051] 2. Results
[0052] 1. The molecular marker information related to kiwifruit juvenile traits is shown in Table 4.
[0053] Table 4 Molecular marker information related to kiwifruit juvenile traits
[0054]
[0055] Amplification product (SEQ ID NO.1):
[0056] AGGTTCCCTATAAAGTATAAACTCATTTGGTGCAAATGGGATTAGGATAGTAATTAGTTTACGTACAAACGGGATATAACAACCTTTTATTTTGATAAGAAAAATGGATTGATACC A ACAGCAAATGAATTCGTTTTATCTTCTTCTGTTTTTGCGTTTAATCAAATGCCACACAGTATTAGGGAGAATATAAATAATAGTTGTTCATCTCTATAATAACTTAAGTTTTTAGATTAGTTGATGATTAGTAATGTATTATCATATCTAGATAATAGATTGTGCGTTGTATTGAGA; the underline is A or C.
[0057] Table 5 Association analysis between molecular markers and kiwifruit childhood traits
[0058]
[0059] As shown in Table 5 and Figure 2 As shown, for the 10647638th base of kiwifruit Group 14 chromosome, the average childhood age of the genotype of this site is AA is 2.27 years, and the average childhood age of the genotype of this site is AC is 1.92 years, and the difference is extremely significant (P<0.01).
[0060] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. A method for predicting the juvenile stage of kiwifruit plants using molecular markers, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1; there is a SNP site at the 117th base of the molecular marker, which is A or C; The method comprises the following steps: (1) Obtaining genomic DNA of the kiwifruit plant to be predicted; (2) PCR amplification of the genomic DNA was performed using the primer pair shown in SEQ ID NO. 2-3 to obtain an amplified product, and then sequencing was performed to obtain the genotype of the 117 bp amplified product. When the genotype was AA, the juvenile stage of the kiwifruit plant was greater than AC; The kiwi fruit plant is any one of (a) to (c): (a) Actinidia chinensis Hongyang; (b) Boshan Jasper; (c) The F1 generation obtained by hybridizing Actinidia chinensis Hongyang as the female parent and Boshan Jasper as the male parent.
2. The method according to claim 1, characterized in that In step (2), the PCR amplification reaction system includes: 2×Hieff Canace ® Add 25 μL of PCR Master Mix, 2 μL of forward and reverse primers, 3 μL of genomic DNA template, and ddH2O to 50 μL.
3. The method according to claim 1, characterized in that In step (2), the reaction procedure of the PCR amplification is: 98°C for 3 min; 98°C for 10 sec, 58°C for 20 sec, 72°C for 30 sec; and 72°C for 5 min.
4. Application of a kit in kiwifruit breeding, characterized in that: The kit comprises a primer pair as shown in SEQ ID NO. 2-3; The application is to predict the childhood stage of kiwi fruit plants; The primer pair is used to amplify the molecular marker described in claim 1; the primers are used to perform PCR amplification on the genomic DNA of the kiwifruit plant to obtain an amplified product, and then sequencing is performed to obtain the genotype of the 117bp amplified product. When the genotype is AA, the juvenile stage of the kiwifruit plant is greater than AC; The kiwi fruit plant is any one of (a) to (c): (a) Actinidia chinensis Hongyang; (b) Boshan Jasper; (c) The F1 generation obtained by hybridizing Actinidia chinensis Hongyang as the female parent and Boshan Jasper as the male parent.