Monkeypox virus typing reagent, kit and application thereof
By designing specific primers and probes targeting the conserved regions of the J1L and J3R genes of monkeypox virus, and employing rapid fluorescent PCR technology, the problems of high safety, long cycle, and high cost of existing monkeypox virus detection methods have been solved, enabling rapid and efficient typing detection of West African clade and Congo Basin clade monkeypox virus.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- GUANGDONG RUNPENG BIOLOGICAL TECH CO LTD
- Filing Date
- 2022-08-24
- Publication Date
- 2026-04-14
AI Technical Summary
Existing methods for detecting monkeypox virus have limitations such as high laboratory safety requirements, long testing cycles, high costs, and insufficient speed, making it difficult to achieve rapid and efficient typing of West African and Congo Basin branched monkeypox viruses.
Specific primers and probes targeting the conserved regions of the J1L and J3R genes of monkeypox virus were designed. Rapid fluorescent PCR technology was used to detect specific target sequences of West African clade and Congo Basin clade monkeypox virus, achieving rapid and efficient typing detection.
Rapid typing of West African and Congo Basin clades of monkeypox virus has been achieved, reducing detection costs, shortening detection time, and improving detection sensitivity and specificity.
Smart Images

Figure CN115838830B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a monkeypox virus typing reagent, kit, and its application. Background Technology
[0002] Monkeypox virus (MPXV) belongs to the family Poxviridae, genus Orthopoxvirus, and possesses the typical morphology of orthopoxviruses. Its morphology is consistent with orthopoxviruses, with a rounded, brick-shaped or oval shape, measuring 200 nm to 400 nm in size. It is a relatively complex DNA virus. The genome of monkeypox virus is a double-stranded DNA approximately 197 kb long. The genome ends with an identical but oppositely oriented terminal inverted repeat sequence. The virus contains 190 open reading frames, four of which are located in the terminal inverted repeat sequence. Monkeypox virus, along with smallpox virus, vaccine virus, and vaccinia virus, are the four orthopoxviruses that are pathogenic to humans. They all contain soluble antigens, nucleoprotein antigens, and hemagglutinins, with essentially the same antigenic structure, and exhibit cross-immunity. Monkeypox virus mainly exists in two branches: the West African branch and the Congo Basin (Central African Republic) branch. The two branches have clear differences in epidemiology and clinical outcomes. The West African branch has a lower mortality rate, with approximately 1% to 3.6% of infections leading to death. In contrast, the Congo Basin (Central African) branch can lead to a mortality rate of up to 10%. Therefore, it is essential to achieve rapid genotyping of the West African and Congo Basin (Central African) branches while simultaneously detecting and identifying monkeypox virus.
[0003] Monkeypox is a zoonotic viral disease characterized by a skin rash, similar to smallpox. It is transmitted from animals to humans through close contact and can also spread from person to person, classifying it as a zoonotic infectious disease. Besides humans and monkeys, other primates and rodents can be infected with the monkeypox virus. The monkeypox virus is primarily transmitted through close contact with infected people or animals, or through contact with contaminated objects. Human-to-human transmission occurs through close contact with lesions, bodily fluids, respiratory droplets, and contaminated items (such as bedding). The incubation period for monkeypox is typically 6 to 13 days. The most prominent feature of this disease is a severe rash, but the severity of the rash is considered to be between that of smallpox and chickenpox. Other symptoms include fever, headache, muscle pain, back pain, and swollen lymph nodes.
[0004] Virus isolation and identification is a classic method for diagnosing monkeypox virus. However, monkeypox virus is a biological agent with a high level of microbial safety, requiring extremely high laboratory safety standards and a long detection cycle. Furthermore, there is antigenic cross-infection between monkeypox virus and poxvirus, resulting in insufficient specificity of serological methods. Currently, the most common detection method for monkeypox virus is real-time quantitative PCR based on the TaqMan probe method. For example, in their 2009 paper, "Establishment of a Real-Time PCR Detection Method for Monkeypox Virus," Zhu Na et al. designed two sets of primers and probes based on the conserved region of the monkeypox virus F3L gene. The primers and probes provided in this paper can detect monkeypox virus. This method has the characteristics of high sensitivity and strong specificity, and results can be obtained in just a few hours. In their 2010 article "Real-time PCR assays for the specific detection of monkeypox virus West African and Congo Basin strain DNA" published in J Virol Methods, Yu Li et al. designed three primer-probe combinations targeting three different gene loci (G2R gene, C3L gene, etc.) to achieve the typing detection of the universal, West African, and Congo Basin (Central African) branches of monkeypox virus. The detection reagent system was relatively complex and costly, and the amplification time required was more than one hour, which was far from meeting the requirements for ultra-fast detection.
[0005] In view of this, the present invention is proposed. Summary of the Invention
[0006] The purpose of this invention is to develop a detection reagent targeting the conserved regions of the specific genes J1L and J3R of monkeypox virus. Using this reagent or a corresponding kit, the typing of West African branched monkeypox virus and Congo Basin branched monkeypox virus can be achieved rapidly and efficiently.
[0007] To solve the above-mentioned technical problems and achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0008] In a first aspect, the present invention provides a reagent for detecting monkeypox virus nucleic acid in a sample to be tested, wherein the reagent detects the conserved target sequence of the J1L gene and / or the conserved target sequence of the J3R gene of monkeypox virus:
[0009] The monkeypox virus includes West African branched monkeypox virus and / or Congo Basin branched monkeypox virus;
[0010] The target sequence of the conserved region of the J1L gene of the West African clade-type monkeypox virus is position 1335-1403 of the whole genome of the West African clade-type monkeypox virus, and the target sequence of the conserved region of the J3R gene is position 195722-195790 of the whole genome of the West African clade-type monkeypox virus.
[0011] The target sequence of the conserved region of the J1L gene of the Congo Basin clade-type monkeypoxvirus is located at positions 1135–1221 of the whole genome of the Congo Basin clade-type monkeypoxvirus, and the target sequence of the conserved region of the J3R gene is located at positions 195222–195308 of the whole genome of the Congo Basin clade-type monkeypoxvirus.
[0012] In an optional embodiment, the reagent is used to detect at least one base region among (a) to (d) below:
[0013] (a) Base region at positions (1335–1340)–(1398–1403) of the whole genome of West African clade-type monkeypoxvirus;
[0014] (b) Base positions (195722–195727)–(195785–195790) of the whole genome of West African clade-type monkeypox virus;
[0015] (c) Base positions (1135–1140)–(1216–1221) of the whole genome of Congo Basin clade monkeypoxvirus;
[0016] (d) Base regions at positions (195222–195227)–(195303–195308) of the whole genome of the Congo Basin clade monkeypox virus.
[0017] In an optional embodiment, the reagent includes a probe, which includes probe 1 and / or probe 2;
[0018] The nucleotide sequence of probe 1 is shown in SEQ ID NO:1;
[0019] The nucleotide sequence of probe 2 is shown in SEQ ID NO:2.
[0020] In an optional embodiment, the reagent further includes primer pairs with nucleotide sequences as shown in SEQ ID NO:3-4.
[0021] In an optional embodiment, probe 1 and probe 2 are both Taqman probes, with different reporter fluorescent groups attached to the 5' ends of probe 1 and probe 2, and quenching fluorescent groups and / or MGBs attached to the 3' ends of probe 1 and probe 2.
[0022] Preferably, the reporter fluorescent group is selected from FAM, NEX, ROX, TET, TAMRA, JOE, VIC, CY3, CY5 or Texas Red.
[0023] Preferably, the quenching fluorescent group is selected from BHQ, TAMRA, Eclipse, Dabcyl, Lowa Black™ RQ or Lowa Black™ FQ.
[0024] Preferably, the 5' end of the probe 1 is connected to FAM, and the 5' end of the probe 2 is connected to VIC or NEX.
[0025] Secondly, the present invention provides the use of the reagent described in any of the foregoing embodiments in the preparation of a reagent kit for diagnosing diseases related to monkeypox virus infection.
[0026] Thirdly, the present invention provides a kit for diagnosing diseases related to monkeypox virus infection, the kit comprising the reagents described in any of the foregoing embodiments.
[0027] In an optional embodiment, the kit may further include a combination of at least one or more of the following reagents: RT-PCR buffer or enzyme mixture.
[0028] Preferably, the enzyme mixture comprises hot-start DNA polymerase and reverse transcriptase.
[0029] Preferably, the enzyme mixture further includes an RNase inhibitor and / or UDG enzyme.
[0030] Preferably, the RT-PCR buffer comprises PCR buffer, dNTPs, and Mg. 2+ The dNTPs are a combination of dATP, dTTP, dCTP and dGTP.
[0031] Fourthly, the present invention provides a method for detecting monkeypox virus nucleic acid in a test sample for non-diagnostic purposes. The method involves PCR amplification of the test sample using the reagents or kits described in any of the foregoing embodiments, wherein the PCR amplification reaction conditions include condition 1 or condition 2.
[0032] Condition 1: Preheat at 50℃ for 60s; after denaturation at 95℃, anneal at 55-62℃ for 15s; repeat denaturation and annealing cycles for 40-45 times.
[0033] Condition 2: Pre-denaturation at 94-96℃ for 1-10 min; denaturation at 94-96℃ for 10-15 s; annealing at 55-60℃ for 15-50 s; repeat denaturation to annealing for 40-45 cycles.
[0034] Fifthly, the present invention provides the application of the method for detecting monkeypox virus nucleic acid in the sample to be tested as described in the foregoing embodiments in monkeypox virus typing, wherein monkeypox virus typing includes distinguishing between Congo Basin branched monkeypox virus and West African branched monkeypox virus.
[0035] This invention designs a set of primer pairs for monkeypox virus (MMV), a shared probe for the West African and Congo Basin clades, and a probe for the Congo Basin (Central African Republic) clade, targeting conserved regions of the J1L and J3R genes. The conserved regions of the target genes selected in this invention exhibit a double-copy characteristic in the genome. Furthermore, the West African and Congo Basin clades of MMV differ in their probe-binding regions (single and double copies, respectively). Based on this structural characteristic, two probes can be designed to achieve both universal detection and nucleic acid typing, significantly reducing costs and optimization difficulty. Attached Figure Description
[0036] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0037] Figure 1 This is a schematic diagram of the binding site of the probe in the monkeypox virus genome, where "." represents the same base and "-" represents the missing base;
[0038] Figure 2 The lowest detection limit amplification curve data for detecting West African branch types on P810 using the provided kit;
[0039] Figure 3 This is the specific amplification curve for Example 3;
[0040] Figure 4 Linear analysis data for detecting West African branched monkeypox virus plasmids using a detection channel containing a shared probe from the West African and Congo Basin branched types;
[0041] Figure 5 Linear analysis data for detecting Congo Basin branched monkeypox virus plasmids using a shared probe detection channel containing West African and Congo Basin branched types;
[0042] Figure 6 Linear analysis data for detecting Congo Basin branched monkeypox virus plasmids using a detection channel containing a Congo branched-type specific probe. Detailed Implementation
[0043] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall be followed. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.
[0044] Therefore, the following detailed description of the embodiments of the invention provided in the accompanying drawings is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the invention without inventive effort are within the scope of protection of the invention.
[0045] The term “amplification” as used in this specification should be understood in a broad sense, including processes for obtaining DNA from RNA or DNA, and including but not limited to PCR reactions, reverse transcription reactions, and their various variations (e.g., real-time PCR reactions).
[0046] The “sample to be tested” used in this specification may be provided in any suitable form, such as a sample of biological tissue or fluid from a patient. The sample may be derived from oral swabs, nasopharyngeal swabs, saliva, sputum, bronchoalveolar lavage fluid, or from blood samples, whole blood, plasma, serum, or may be a sample containing nucleic acids extracted from the above samples. The sample may be any sample containing nucleic acids, and the nucleic acids contained in the sample may be DNA and / or RNA.
[0047] The sample can be from any eukaryotic, prokaryotic, or viral source, such as microorganisms (e.g., bacteria or fungi), plants, or animals. Preferably, the sample is of human origin. The sample can be a tissue or blood sample from an animal.
[0048] The West African branched monkeypox virus described in this specification may be the sequence of Accession No. ON563414.2, and the Congo Basin (Central African Republic) branched monkeypox virus may be the sequence of Accession No. KJ642613.1.
[0049] The Ct value (cycle threshold) described in this invention is defined as the number of cycles required for the fluorescence signal in each reaction tube to reach a set threshold. The threshold is typically set to just cover the fluorescence values of the negative and blank controls, thus effectively removing the fluorescence values from the reaction tubes, i.e., the background.
[0050] Our company (Guangdong Runpeng Biotechnology Co., Ltd.) offers an ultra-fast real-time quantitative PCR analyzer (model: P810). This device enables rapid heating and cooling of PCR amplification reagents, completing 40 amplification cycles within 15 minutes. Simultaneously, the real-time quantitative PCR analyzer completes the fluorescence PCR step, enabling fluorescence PCR detection of the target.
[0051] In one specific embodiment, the present invention provides a kit for detecting mucor nucleic acid based on rapid fluorescent PCR technology. The kit mainly includes four components: PCR reaction solution, enzyme mixture, positive control, and negative control.
[0052] The PCR reaction solution mainly consists of four nucleotides: dATPs, dGTPs, dCTPs, and dTTP; fluorescent PCR primers and probes for detecting monkeypox virus genotyping; and a buffer solution containing magnesium ions.
[0053] The forward primer, reverse primer, and fluorescent probe sequences in the primer pair are as follows:
[0054] Forward primer: 5'-GGGATCTCCTTTTACAACTTCTTCG-3' (SEQ ID NO:3);
[0055] Reverse primer: 5'-CAATCCGTAACGGAAGTTACAGAGA-3' (SEQ ID NO:4);
[0056] The West African branched and Congo Basin branched oligonucleotide probe 1: 5'-ATACCTCATCATCTTCGG-3' (SEQ ID NO:1) is shared.
[0057] Congo Basin branched oligonucleotide probe 2: 5'-CATCTTCGGATACCTCAT-3' (SEQ ID NO:2);
[0058] All of the above probes have a fluorescent reporter group labeled at the 5' end and a fluorescent quencher group and / or MGB labeled at the 3' end.
[0059] The MGB is a minor groove binder modification group. The MGB modification group is attached to the 3' end of the probe, which can increase the probe's Tm value by approximately 10°C, thereby enhancing the specificity of the quantitative PCR reaction.
[0060] As a further improvement of the present invention, the fluorescent reporter group mentioned above is selected from FAM, NEX, ROX, TET, TAMRA, JOE, VIC, CY3, CY5 or Texas Red; wherein the common oligonucleotide probe 1 for the West African branch and Congo Basin branch of monkeypox virus is preferably FAM, and the oligonucleotide probe 2 for the Congo Basin branch is preferably VIC or NEX, etc., and the fluorescent quenching group is selected from BHQ, TAMRA, Eclipse, Dabcyl, Lowa Black™ RQ, Lowa Black™ FQ, etc.
[0061] The enzyme mixture in the kit contains hot-start Taq DNA polymerase, UDG enzyme, and enzyme preservation solution.
[0062] The positive control sample contained a mixture of a plasmid vector containing a specific conserved sequence of Congo Basin clade-type monkeypox virus and a plasmid vector containing the gene for the cytoskeletal protein Beta-actin. After transformation into *E. coli* DH5α and proliferation, the recombinant plasmids were extracted, purified, and their concentration and purity were determined using a spectrophotometer before dilution with sterile TE buffer. The concentration of both plasmid vectors was 1.0 × 10⁻⁶. 6 copies / mL.
[0063] The positive control sample contained a Congo Basin clade-specific conserved sequence of monkeypox virus:
[0064] AATAAGTGGTGGGATCTCCTTTCAACTTCTTCGGATAACCTCATCATCTTCGGATAACCTCATCTTCGGTCTCTGTAACTTCCGTTACGGATTGACAAATCTTATCATTGGTCGG (SEQ ID NO: 5).
[0065] The positive control sample contains a specific conserved sequence of the cytoskeletal protein Beta-actin gene, which is:
[0066] GCGAGAAGATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAGGCTGTGCTATCC (SEQ ID NO: 6).
[0067] The negative control sample mentioned above is a sterile TE buffer solution, which is prepared using molecular-grade water.
[0068] Furthermore, the present invention also provides a rapid detection method for monkeypox virus and nucleic acid genotyping using the above-mentioned kit, comprising the following steps:
[0069] (1) Sample processing and nucleic acid extraction (negative control, positive control and sample to be tested are processed simultaneously):
[0070] Remove the reagents 30 minutes in advance, allow them to thaw at room temperature, and vortex each component for 15 seconds. Centrifuge each component of the kit at low speed for 15 seconds and set aside. Transfer all quality control samples (including negative and positive controls) to the sample extraction chamber. Based on the number of test samples, negative controls, and positive controls, take the corresponding amount of test sample, negative control, and positive control at 200 μl / person sample, mix thoroughly to form the sample to be extracted, and centrifuge briefly before use. Extract sample DNA using our company's Viral DNA / RNA Extraction Kit (Magnetic Bead Method) (Catalog No.: RK1002), following the instructions in the kit's instruction manual.
[0071] (2) First, remove the PCR reaction solution and enzyme mixture reagents, thaw them at room temperature, vortex for 15 seconds, and centrifuge at low speed for 15 seconds. Determine the reaction number N, N = number of samples to be tested (n) + number of quality control samples (2) + 1. Calculate the required reaction solution based on the reaction number N, using 8.0 μL of PCR reaction solution and 2.0 μL of enzyme mixture per reaction. Vortex the PCR reaction solution and enzyme mixture for 15 seconds and centrifuge at low speed for 15 seconds. Then, aliquot the mixed reaction solution into PCR reaction tubes at 10 μL / tube.
[0072] Components 1 serving N samples (N+1 positive + 1 negative) PCR reaction solution 8.0μL 18.0×(N+3) enzyme mixture 2.0μL 2.0×(N+3) Test sample 10μL 10×(N+3)
[0073] (3) Sample addition:
[0074] Add the extracted DNA sample, negative control, and positive control to a PCR reaction tube at a volume of 10 μL. Seal the tube tightly and centrifuge at low speed for 15 seconds to remove all liquid from the tube walls. Then, use a pipette to transfer the reaction solution from the PCR reaction tube to a capillary tube. Centrifuge the capillary tube containing the reaction solution at low speed for 15 seconds using a capillary centrifuge. Immediately proceed with the PCR amplification reaction.
[0075] (4) Amplification program settings on the P810 ultra-fast qPCR instrument.
[0076] Specifically, the West African and Congo Basin clades of monkeypox virus share the FAM (Reporter: FAM, Quencher: MGB) detection channel, while the Congo Basin clade uses the VIC (Reporter: VIC, Quencher: MGB) detection channel; the internal standard is the ROX (Reporter: ROX, Quencher: MGB) detection channel.
[0077]
[0078] (5) The amplification can be completed in 15 minutes using this procedure.
[0079] (6) Amplification program settings on a standard qPCR instrument ABI 7500: For the shared detection of monkeypox virus West African and Congo Basin clades, select the FAM detection channel; for the detection of monkeypox virus Congo Basin clades, select the VIC / JOE / NEX detection channel; for the internal standard, select the ROX detection channel.
[0080]
[0081] (7) Results Analysis:
[0082] 7.1 Save the test data file after the experiment is completed.
[0083] 7.2 Analysis Condition Settings: The results are automatically saved after the reaction. The curves for monkeypox virus and the corresponding internal standard are analyzed. Based on the analyzed image, adjust the Start, End, and Threshold values of the Baseline (users can adjust these values according to their actual situation; the Start value can be 3–15, and the End value can be set to 5–20 to flatten the amplification curve of the negative control or make it below the threshold). Click Analyze to perform the analysis, ensuring the curve in the amplification curve window reaches its optimal value. Then, record the results in the Plate window.
[0084] (8) Quality Control
[0085] 8.1 Negative control: No amplification curves were observed in the FAM channel, VIC channel, and ROX channel, or Ct > 38, and no obvious S-shaped amplification curve was observed.
[0086] 8.2 Positive control: Amplification curves were observed in the FAM channel, VIC channel, and ROX channel, and the Ct values were all ≤30;
[0087] Both of the above requirements must be met simultaneously in the same experiment; otherwise, the experiment is invalid and needs to be repeated.
[0088] (9) Result Interpretation
[0089] 9.1 When the FAM channel shows an amplification curve and all Ct values are ≤38, the monkeypox virus nucleic acid is considered positive; when the VIC channel shows an amplification curve and all Ct values are ≤38, the Congo Basin branched monkeypox virus nucleic acid is considered positive; when the VIC channel shows no amplification curve and the Ct value is Undet or No Ct, the West African branched monkeypox virus nucleic acid is considered positive.
[0090] 9.2 When the FAM channel shows no amplification curve and the Ct value is Undet or No Ct, and the ROX channel shows an amplification curve and the Ct value is >38, the monkeypox virus nucleic acid can be determined to be negative.
[0091] 9.3 For positive samples, the internal standard test result is not required; when there is an amplification curve in the FAM channel and 38 < Ct value ≤ 40, it is recommended to repeat the experiment once. If the result is the same as above, it can be judged as monkeypox virus positive. If there is no amplification, it can be judged as monkeypox virus negative.
[0092] 9.4 If there are no amplification curves in the FAM, VIC, and ROX channels, and the Ct value is displayed as Undet or No Ct, the experiment is invalid, and it is recommended to replace the reagents and repeat the experiment.
[0093] The following detailed description of some embodiments of the present invention is provided in conjunction with the accompanying drawings. Unless otherwise specified, the following embodiments and features can be combined with each other. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in *Molecular Cloning: A Laboratory Manual* by Sambrook J. et al. (translated by Huang Peitang et al., Beijing: Science Press, 2002), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight. Unless otherwise specified, the experimental materials and reagents used in the following embodiments are commercially available.
[0094] Example 1: Design and Screening of Primers and Probes
[0095] This invention designs a set of primers for monkeypox virus, a common probe for the West African and Congo Basin clades of monkeypox virus, and a probe for the Congo Basin (Central Africa) clade, targeting the conserved regions of the monkeypox virus J1L or J3R gene. Due to the genomic characteristics of monkeypox virus, the J1L and J3R genes are palindromic gene sequences located at both ends of the whole genome, which means that this gene has the advantage of having two copies compared to the single copy of other genes.
[0096] In addition, such as Figure 1 As shown, for the West African clade, it can only bind to the MP-T probe at the left position; for the Congo Basin clade, it can bind to MP-T probes at both positions and the MP-G probe at the middle position. The MP-T probe selected in this invention has two consecutive repeats in the Congo Basin clade, thus exhibiting a significant performance advantage in detecting the Congo Basin clade. However, the homologous regions of other viruses cannot pair complementaryly with MP-T or MP-G, therefore other viruses cannot be detected.
[0097] In the design of the primers and probes described above, hairpin structures, internal primer dimers, inter-primer dimers, and mismatches were avoided as much as possible. The monkeypox virus-specific primer and probe sequences designed above were compared and analyzed using the NCBI Blast online database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to avoid non-specific binding and amplification with other pathogens or human genes.
[0098] The specific primer and probe sequences are shown in the table below:
[0099]
[0100]
[0101] To fully verify the performance advantages of the primers and probes designed in this invention, the primer and probe sequences published by Zhu Na in "Establishment of a Real-Time PCR Detection Method for Monkeypox Virus" (Zhu Na, Chen Guoqiang, Zhang Jingyou, et al. Establishment of a Real-Time PCR Detection Method for Monkeypox Virus [J]. Journal of Nanjing Agricultural University. 2009. 32(4): 165-168) are synthesized. The sequences are shown in the table below:
[0102]
[0103] To screen for the optimal target primer-probe combination, this invention synthesized target fragments of the target genes of the following representative strains, inserted these sequences into cloning vectors, and screened for purified plasmids containing positive fragments through single-clone cloning.
[0104] The sequence of the West African branched monkeypox virus (ON563414.2) is named MPXV-1:
[0105] GGGATTCCCTTTTACAACTTCTTCGGATAACCTCATCATCTTCGGTCTCTGTAACTTCCGTTACGGATTGTCGCGGGATACATCATCTATTATAGCATCAGCATCAGAATCTGTAGGCCGTGTATCAGCATCCATTGTCGTAGACC (SEQ ID NO: 10).
[0106] The sequence of monkeypox virus (KJ642613.1) from the Congo Basin (Central African Republic) is named MPXV-2:
[0107] GGGATCTCCTTTTACAACTTCTTCGGATAACCTCATCTTCGGATACCTCATCTTCGGTCTCTGTAACTTCCGTTACGGATTGTCGCGGGATACATCATCTATTATAGCATCAGCATCAGAATCTGTAGGCCGTGTATCAGCATCCATTGTCGTAGACC (SEQ ID NO: 11).
[0108] The sequence of smallpox virus Variola virus (LR800244.1) is named VAV:
[0109] AGGAGGATCTACATCCTCGACTGATGTGGAATCATCTTCTGATTCCACCTCGGGATCTGGATCTGACTCGGACTCTGTAATTTCCGTTACGGATTGTCGCGGGATACATCATCTATTATGACGTCAGCCATAGCATCAGCATCCGGCTTATCCGCCTCCGTTGTCATAAACC (SEQ ID NO: 12).
[0110] The sequence of vaccinia virus (MT227314.1) is named VCV:
[0111] GGGATCTCTTTTTACGACTTCTTCGGATAACCTCATCGTCTTTGGTCTCTGTAACTTCCGTTACGGATTGGCGGGATACATCATCTATTATGGCGTCAGCCATAACATCAGCATCCGGCTTATCCGCCTCCGTTGTCATAAACC (SEQ ID NO: 13).
[0112] The Cowpox virus (LT896732.2) sequence is named CoPV:
[0113] TAGGCATAATTATATCTGCTCCTAGTTCTATAAAATGTATCTATGATTGTTTCATTGTAATCTAGAAAATTGCTTCTTGTAAAACCATGTAAGTAATAATGTAACGGTGTTCTCGCGGGATACATCATCTATTATGATGTCAGTCATAGCATCAGCATCCGGCTTATCCGCCTCCGTTGTCATAAACC (SEQ ID NO: 14).
[0114] The camelpox virus (AF438165.1) sequence was named CaPV:
[0115] GGGATCTCCTTTTACGACTGATGTGGAACCATCTTCGGATACCTCATCGTCTCAGACTCTGTAACTTCCGTTACGGATTGTCGCGGGATACATCATCTATTATGGCGTCAGCCATAGCATCAGCATCCGGTTTATCCGCCTCCGTTGTCATAAACC (SEQ ID NO: 15).
[0116] The mousepox virus Ectromelia_virus (JQ410350.1) sequence is named EcV:
[0117] GGGATCTCCTTTTACGACTTCTTCGGATACCCCATCGTCTTCAGACTCTGTAACTTCGGTTACTGATTGTCGCGGGATACATCATCTATTATGGCATCCGCCATAGTATTAGTATCCGGCTTATCCGCCTCCGTTGTTATAAACC (SEQ ID NO: 16).
[0118] The horsepox virus (KY349117.1) sequence is named HoPV:
[0119] GGGATCTCTTTTTACAACTTCTTCGGATAACCTCATCGTCTTTGGTCTCTGTAACTTCCGTTACGGATTGTCGCGGGATACATCATCTATTATGACGTCAGCCATAGCATCAGCATCCGGCTTATCCGCCTCCGTTGTCATAAACC (SEQ ID NO: 17).
[0120] The rapid DNA polymerase (product number: RK1101) used in the amplification system is a self-developed amplification enzyme of Runpeng Biotechnology, the thermosensitive UDG enzyme (product number: MD029) is from Feipeng Biotechnology, and the primers and probes used are all synthesized by Sangon Biotech.
[0121] The templates used were the eight monkeypoxviruses constructed above, as well as plasmids from the closely related poxviridae family. The extracted nucleic acid products were diluted with molecularly purified water to a concentration of 1.0 × 10⁻⁶. 5 copies / mL. The negative control template was prepared using TE buffer.
[0122] Components This invention / μL Control / μL 5×PCR Buffer (Catalog No.: RK1101) 4 4 dNTPs (10mM) 0.5 0.5 <![CDATA[MgCl2(25mM)]]> 2 2 Upstream primers (MPXV-F / MPXV-F2) (10mM) 1 1 Downstream primers (MPXV-R / MPXV-R2) (10mM) 1 1 Probe 1 (MPXV-P1-1 / MPXV-P2) (10mM) 0.5 0.5 Probe 2 (MPXV-P1-2) (10mM) 0.5 / Rapid DNA Polymerase (Catalog No.: RK1101) 0.2 0.2 UDG enzyme (Catalog No.: MD029) 0.1 0.1 <![CDATA[H2O]]> 0.3 0.3 template 10 10
[0123] Note: The control only uses the primer and probe sequence information from Zhu Na's "Establishment of a Real-Time PCR Detection Method for Monkeypox Virus", and the system used is our company's amplification system.
[0124] The standard platform amplification procedure is shown in the table below:
[0125]
[0126] The amplification results are shown in the table below:
[0127]
[0128] Note: NoCt in the table indicates no amplification.
[0129] The amplification program for the ultra-fast qPCR platform is shown in the table below:
[0130]
[0131] The amplification results are shown in the table below:
[0132]
[0133] Note: NoCt in the table indicates no amplification.
[0134] The data above shows that, with the same number of templates, the primers and probes designed in this invention perform almost identically to the control system on conventional platforms such as ABI7500 in detecting West African clade-type monkeypox virus, and have a significant advantage in detecting Congo Basin clade-type monkeypox virus. Furthermore, the specific probes designed for the Congo Basin clade-type also outperform the control system in detection performance. The monkeypox virus-specific primers and probes designed in this invention showed no amplification or cross-reaction on plasmid templates constructed from sequences at the same positions as smallpox virus, vaccinia virus, vaccinia virus, horsepox virus, camelpox virus, and mousepox virus, demonstrating excellent specificity.
[0135] Example 2 Sensitivity Detection
[0136] The concentrations of plasmid samples MPXV-1 containing the target fragment of West African clade-type monkeypox virus and MPXV-2 containing the target fragment of Congo Basin clade-type monkeypox virus were determined, and then converted to copies / mL. The relevant positive plasmids were diluted to appropriate concentrations and then serially diluted 2-fold, ultimately controlling the sample concentrations at 1000 copies / mL, 500 copies / mL, 250 copies / mL, and 125 copies / mL. The constructed positive plasmids were then detected using the determined detection system, product form, and cycling parameters.
[0137] The optimized amplification program was used on a conventional ABI 7500 real-time PCR instrument, and the results are as follows:
[0138]
[0139]
[0140] The experimental data on the limit of detection (LOD) of the plasmid used to detect the Congo Basin clade of monkeypox virus on ABI 7500 are as follows:
[0141]
[0142] The experimental data for the limit of detection (LOD) of monkeypox cladistic probes from the Congo Basin on ABI 7500 for detecting Congo Basin cladistic plasmids are as follows:
[0143]
[0144] The results show that the detection method and kit of the present invention have high sensitivity. The limit of detection for West African clade-type monkeypox virus can reach 500 copies / mL on a conventional real-time PCR platform, and the limit of detection for Congo Basin clade-type monkeypox virus can reach 250 copies / mL. Considering that this gene has a double-copy characteristic in the monkeypox virus genome, the limit of detection for clinical samples has room for further reduction.
[0145] The optimized amplification program was used on an ultra-fast quantitative PCR instrument P810 for verification. The amplification curve was referenced. Figure 2 The amplification data are as follows:
[0146]
[0147] The following are the experimental data on the limit of detection (LOD) of the Congo Basin clade plasmid on the P810 platform using a shared primer and probe setup for the West African and Congo Basin clades of monkeypox virus:
[0148]
[0149] The following are the experimental data on the limit of detection (LOD) for monkeypox cladistic plasmids from the Congo Basin on the P810 platform:
[0150]
[0151]
[0152] The results show that the detection method and kit of the present invention have high sensitivity, and the detection performance on our company's ultra-fast qPCR platform is consistent with that of the conventional qPCR platform. Moreover, the detection speed is faster, and the entire detection process can be completed within 15 minutes.
[0153] Example 3 Specificity Detection - Real-time Quantitative PCR Analyzer Platform P810
[0154] This invention uses a mixture of influenza A virus strain (type: H1N1), influenza B virus strain (type Y), fowlpox virus, respiratory syncytial virus, respiratory adenovirus (type 3), Escherichia coli, Haemophilus influenzae, Staphylococcus aureus, Streptococcus pneumoniae, and saliva from healthy individuals as specific samples for detection. The detection results are as follows: Figure 3 As shown, the detection results of the specific reference material were all negative for the target channels, indicating that the kit of the present invention will not produce non-specific amplification for other common pathogens.
[0155] Example 4: Linear Amplification Detection - Real-time Quantitative PCR Analyzer Platform P810
[0156] This invention selects a series of gradient dilutions with concentrations of 1.0 × 10⁻⁶. 9 copies / mL~1.0×10 2 Cleavage plasmids from West Africa and the Congo Basin were amplified at copies / mL using the established detection system and amplification procedure, and linear amplification tests were performed. The results are shown in the table below. Figures 4-6 As shown, the linear correlation coefficient for detecting the West African clade monkeypox virus plasmid using the shared probe for both the West African and Congo Basin clades was 0.9979, with an amplification efficiency of 91%. The linear correlation coefficient for detecting the Congo Basin clade monkeypox virus plasmid using the shared probe for both the West African and Congo Basin clades was 0.998, with an amplification efficiency of 89%. The linear correlation coefficient for detecting the Congo Basin clade monkeypox virus plasmid using the Congo Basin clade probe was 0.9971, with an amplification efficiency of 90%. This indicates that the kit of the present invention has good amplification linearity on the P810 real-time quantitative PCR analyzer platform.
[0157] The linearity data for detecting West African clade monkeypox virus plasmid using a shared probe from the West African and Congo Basin clades are as follows:
[0158]
[0159] The linearity data for detecting the Congo Basin clade monkeypox virus plasmid using a shared probe between the West African and Congo Basin clades are as follows:
[0160]
[0161] The linearity data for detecting Congo Basin branched probes against Congo Basin branched monkeypox virus plasmids are as follows:
[0162]
[0163]
[0164] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. The application of a reagent for detecting monkeypox virus nucleic acid in a test sample in the preparation of a kit for diagnosing monkeypox virus infection-related diseases, characterized in that, The monkeypox virus includes West African branched monkeypox virus and / or Congo Basin branched monkeypox virus; The reagent includes probes and primer pairs, wherein the probes include probe 1 and probe 2; The nucleotide sequence of probe 1 is shown in SEQ ID NO: 1; The nucleotide sequence of probe 2 is shown in SEQ ID NO: 2; The nucleotide sequences of the primer pairs are shown in SEQ ID NO: 3~4.
2. The application according to claim 1, characterized in that, Both probe 1 and probe 2 are Taqman probes. The 5' ends of probe 1 and probe 2 are connected to different reporter fluorescent groups, and the 3' ends of probe 1 and probe 2 are connected to quencher fluorescent groups and / or MGB.
3. The application according to claim 2, characterized in that, The reporter fluorescent group is selected from FAM, NEX, ROX, TET, TAMRA, JOE, VIC, CY3, CY5 or Texas Red.
4. The application according to claim 3, characterized in that, The 5' end of probe 1 is connected to FAM, and the 5' end of probe 2 is connected to VIC or NEX.
5. The application according to claim 2, characterized in that, The quenching fluorescent group is selected from BHQ, TAMRA, Eclipse, Dabcyl, Lowa Black™ RQ or Lowa Black™ FQ.
6. A method for detecting monkeypox virus nucleic acid in a sample for non-diagnostic purposes, characterized in that, The method is a PCR amplification method using the reagents described in any one of claims 1 to 5, wherein the PCR amplification reaction conditions include condition 1 or condition 2: Condition 1: Preheat at 50℃ for 60s; after denaturation at 95℃, anneal at 55~62℃ for 15s; repeat denaturation to annealing for 40~45 cycles; Condition 2: Pre-denaturation at 94-96℃ for 1-10 min; denaturation at 94-96℃ for 10-15 s; annealing at 55-60℃ for 15-50 s; repeat denaturation to annealing for 40-45 cycles.
Citation Information
Patent Citations
Composition, kit and method for detecting and typing monkey pox virus and application of composition, kit and method
CN114752711A
Set of oligonucleotide primers and fluorescent-marked probes for species-specific instant identification of orthopoxvirus by real-time multiplex PCR
RU2427648C1