L-tyrosine production related protein yedz and its biomaterials and applications

CN115850406BActive Publication Date: 2026-06-26NINGXIA EPPEN BIOTECH CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NINGXIA EPPEN BIOTECH CO LTD
Filing Date
2022-12-16
Publication Date
2026-06-26

Smart Images

  • Figure BDA0004003218270000091
    Figure BDA0004003218270000091
  • Figure BDA0004003218270000101
    Figure BDA0004003218270000101
  • Figure BDA0004003218270000102
    Figure BDA0004003218270000102
Patent Text Reader

Abstract

The application discloses L-tyrosine yield related protein yedZ and a biological material and application thereof, and belongs to the technical field of biotechnology. The application aims to regulate the L-tyrosine yield of microorganisms. The protein is any one of the following proteins: the protein is any one of the following proteins: A1) the protein is yedZ protein or the yedZ protein has a valine residue at the 180th alanine residue in the amino acid sequence, and the yedZ protein is a protein with the amino acid sequence of sequence 2; A2) a protein obtained by substitution, deletion and / or addition of amino acid residues of the protein in A1) and having more than 80% identity with the protein in A1) and having the function of regulating the L-tyrosine yield of microorganisms; A3) a fusion protein obtained by connecting a tag to the N terminal and / or C terminal of the protein in A1) or A2) and having the function of regulating the L-tyrosine yield of microorganisms. The substance for regulating the expression of the yedZ protein gene can be used for regulating the L-tyrosine yield of microorganisms or breeding of the L-tyrosine yield strain.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of biotechnology, and in particular relates to the L-tyrosine production-related protein yedZ, its biomaterials, and applications. Background Technology

[0002] L-tyrosine (Tyr) is an essential amino acid that plays a vital role in the metabolism, growth, and development of humans and animals, and is widely used in the food, feed, pharmaceutical, and chemical industries. It is commonly used as a nutritional supplement for patients with phenylketonuria (PKU) and as a raw material in the preparation of pharmaceutical and chemical products such as polypeptide hormones, antibiotics, L-DOPA, melanin, p-hydroxycinnamic acid, and p-hydroxystyrene. Furthermore, with the discovery of more high-value-added L-tyrosine derivatives such as tanshinone, resveratrol, and hydroxytyrosol in organisms, L-tyrosine is increasingly developing towards platform-type compounds. Summary of the Invention

[0003] This application provides the L-tyrosine production-related protein yedZ, its biomaterials, and applications. The technical problem addressed by this application is how to regulate or increase the L-amino acid production of microorganisms, especially L-tyrosine.

[0004] To address the aforementioned issues, this application provides a protein.

[0005] The protein provided in this application is any one of the following:

[0006] The protein is any one of the following:

[0007] A1) A protein, wherein the protein is a yedZ protein or a yedZ mutant protein obtained by replacing the 180th alanine residue of the amino acid sequence of the yedZ protein with any of the following amino acid residues:

[0008] The yedZ protein contains arginine residues, cysteine ​​residues, phenylalanine residues, leucine residues, isoleucine, methionine residues, valine residues, serine residues, proline residues, threonine residues, tyrosine residues, histidine residues, glutamine residues, asparagine residues, lysine residues, aspartic acid residues, glutamic acid residues, tryptophan residues, serine residues, or glycine residues; the yedZ protein is a protein with the amino acid sequence of sequence 2.

[0009] A2) The protein of A1) obtained by substituting and / or deleting and / or adding amino acid residues, has more than 80% identity with the protein shown in A1) and has the function of regulating microbial L-tyrosine production.

[0010] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2) to regulate the production of microbial L-tyrosine.

[0011] The above-mentioned protein is the yedZ protein or the 180th alanine residue of the amino acid sequence of the yedZ protein is replaced with any of the following:

[0012] The amino acid residues are valine residues, tryptophan residues, phenylalanine residues, leucine residues, isoleucine residues, or methionine residues; the yedZ protein is a protein with the amino acid sequence of sequence 2.

[0013] In the above text, the amino acid sequence of the protein obtained by mutating the alanine residue at position 180 of sequence 2 to a valine residue is sequence 6.

[0014] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0015] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting Gapexistencecost, Perresiduegapcost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.

[0016] In the aforementioned proteins, the 80% or more identity can be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.

[0017] In the above protein, sequence 2 (SEQ ID No. 2) consists of 211 amino acid residues.

[0018] To address the aforementioned issues, this application provides biological materials.

[0019] The biomaterial is any one of the following:

[0020] B1) Nucleic acid molecules that encode the above proteins;

[0021] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0022] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0023] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0024] B5) Inhibit or reduce or downregulate the expression of nucleic acid molecules that encode the protein;

[0025] B6) expresses the gene encoding the RNA molecule described in B5);

[0026] B7) contains an expression cassette containing the gene described in B6);

[0027] B8) A recombinant vector containing the gene described in B6), or a recombinant vector containing the expression cassette described in B7;

[0028] B9) Recombinant microorganisms containing the gene described in B6), or recombinant microorganisms containing the expression cassette described in B7), or recombinant microorganisms containing the recombinant vector described in B4).

[0029] In the above-mentioned biological materials, the nucleic acid molecule described in B1) is any one of the following:

[0030] The coding sequence of Z1 is the DNA molecule shown in SEQ ID No. 1;

[0031] The coding sequence for Z2 is the DNA molecule shown in SEQ ID No. 5;

[0032] The Z3) coding sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide residue at position 538 of SEQ ID No. 1 with a thymine deoxyribonucleotide residue, the cytosine deoxyribonucleotide residue at position 539 with a guanine deoxyribonucleotide residue, and the thymine deoxyribonucleotide residue at position 540 with a guanine deoxyribonucleotide residue.

[0033] The Z4) coding sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide residue at position 538 of SEQ ID No. 1 with a thymine deoxyribonucleotide residue and the cytosine deoxyribonucleotide residue at position 539 with a thymine deoxyribonucleotide residue.

[0034] The Z5 coding sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide residue at position 538 of SEQ ID No. 1 with a cytosine deoxyribonucleotide residue and the cytosine deoxyribonucleotide residue at position 539 with a thymine deoxyribonucleotide residue.

[0035] The Z6) coding sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide residue at position 538 of SEQ ID No. 1 with an adenine deoxyribonucleotide residue and the cytosine deoxyribonucleotide residue at position 539 with a thymine deoxyribonucleotide residue.

[0036] The Z7 coding sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide residue at position 538 of SEQ ID No. 1 with an adenine deoxyribonucleotide residue, the cytosine deoxyribonucleotide residue at position 539 with a thymine deoxyribonucleotide residue, and the thymine deoxyribonucleotide residue at position 540 with a guanine deoxyribonucleotide residue.

[0037] The Z8 nucleotide sequence is the DNA molecule shown in SEQ ID No. 1;

[0038] The nucleotide sequence of Z9 is the DNA molecule shown in SEQ ID No. 5;

[0039] The Z10 nucleotide sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide residue at position 538 of SEQ ID No. 1 with a thymine deoxyribonucleotide residue, the cytosine deoxyribonucleotide residue at position 539 with a guanine deoxyribonucleotide residue, and the thymine deoxyribonucleotide residue at position 540 with a guanine deoxyribonucleotide residue.

[0040] The Z11 nucleotide sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide residue at position 538 of SEQ ID No. 1 with a thymine deoxyribonucleotide residue and the cytosine deoxyribonucleotide residue at position 539 with a thymine deoxyribonucleotide residue.

[0041] The Z12 nucleotide sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide residue at position 538 of SEQ ID No. 1 with a cytosine deoxyribonucleotide residue and the cytosine deoxyribonucleotide residue at position 539 with a thymine deoxyribonucleotide residue.

[0042] The Z13 nucleotide sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide residue at position 538 of SEQ ID No. 1 with an adenine deoxyribonucleotide residue and the cytosine deoxyribonucleotide residue at position 539 with a thymine deoxyribonucleotide residue.

[0043] The Z14 nucleotide sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide residue at position 538 of SEQ ID No. 1 with an adenine deoxyribonucleotide residue, the cytosine deoxyribonucleotide residue at position 539 with a thymine deoxyribonucleotide residue, and the thymine deoxyribonucleotide residue at position 540 with a guanine deoxyribonucleotide residue.

[0044] To address the aforementioned problems, this application also provides the following uses:

[0045] The following materials are used in regulating microbial L-tyrosine production, preparing materials for regulating microbial L-tyrosine production, or in microbial breeding:

[0046] C1) Protein, wherein the protein is the protein described above;

[0047] C2) Substances that regulate the expression of genes encoding the proteins described in C1);

[0048] C3) Substances that regulate the activity or content of the proteins described in C1).

[0049] In the above-described uses, the substance regulating the expression of the protein-coding gene is any one of the following:

[0050] D1) Nucleic acid molecules encoding the above proteins;

[0051] D2), an expression cassette containing the nucleic acid molecules described in D1);

[0052] D3), ​​a recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2);

[0053] D4) Recombinant microorganisms containing the nucleic acid molecules described in D1), or recombinant microorganisms containing the expression cassette described in D2), or recombinant microorganisms containing the recombinant vector described in D3);

[0054] D5) Inhibit, reduce, or downregulate the expression of nucleic acid molecules encoding the genes of the above proteins;

[0055] D6) expresses the gene encoding the RNA molecule described in D5);

[0056] D7) contains an expression cassette containing the gene described in D6);

[0057] D8) A recombinant vector containing the gene described in D6), or a recombinant vector containing the expression cassette described in D7;

[0058] D9) Recombinant microorganisms containing the gene described in D6), or recombinant microorganisms containing the expression cassette described in D7), or recombinant microorganisms containing the recombinant vector described in D4).

[0059] In the nucleic acid molecules described in D1) or D5), those skilled in the art can easily mutate the nucleotide sequence encoding the protein yedZ of the present invention using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides that have 80% or more of the same nucleotide sequence as the protein yedZ isolated in the present invention, as long as they encode protein yedZ and have the function of protein yedZ, are all derived from and equivalent to the nucleotide sequence of the present invention.

[0060] The aforementioned 80% or higher identity can be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0061] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting Gapexistencecost, Perresiduegapcost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, a search can be performed to calculate the identity of amino acid sequences, and then the identity value (%) can be obtained.

[0062] In the above-mentioned biological materials, the nucleic acid molecule described in D1) or D5) may be the gene encoding the protein.

[0063] The protein with the sequence shown above, where the alanine at position 180 of sequence 2 is mutated to valine, is shown in sequence 6. Its encoding gene is shown in sequence 5.

[0064] In the above text, the gene encoding the protein in which the alanine residue at position 180 of sequence 2 is mutated to a tryptophan residue is obtained by replacing the guanine deoxyribonucleotide residue at position 538 of sequence 1 with a thymine deoxyribonucleotide residue, the cytosine deoxyribonucleotide residue at position 539 with a guanine deoxyribonucleotide residue, and the thymine deoxyribonucleotide residue at position 540 with a guanine deoxyribonucleotide residue.

[0065] In the above text, the gene encoding the protein in which the alanine residue at position 180 of sequence 2 is mutated to a phenylalanine residue is obtained by replacing the guanine deoxyribonucleotide residue at position 538 of sequence 1 with a thymine deoxyribonucleotide residue and the cytosine deoxyribonucleotide residue at position 539 with a thymine deoxyribonucleotide residue.

[0066] In the above text, the gene encoding the protein in which the alanine residue at position 180 of sequence 2 is mutated to a leucine residue is obtained by replacing the guanine deoxyribonucleotide residue at position 538 of sequence 1 with a cytosine deoxyribonucleotide residue, and replacing the cytosine deoxyribonucleotide residue at position 539 with a thymine deoxyribonucleotide residue.

[0067] In the above text, the gene encoding the protein in which the alanine residue at position 180 of sequence 2 is mutated to isoleucine residue is obtained by replacing the guanine deoxyribonucleotide residue at position 538 of sequence 1 with an adenine deoxyribonucleotide residue and the cytosine deoxyribonucleotide residue at position 539 with a thymine deoxyribonucleotide residue.

[0068] In the above text, the gene encoding the protein in which the alanine residue at position 180 of sequence 2 is mutated to a methionine residue is obtained by replacing the guanine deoxyribonucleotide residue at position 538 of sequence 1 with an adenine deoxyribonucleotide residue, replacing the cytosine deoxyribonucleotide residue at position 539 with a thymine deoxyribonucleotide residue, and replacing the thymine deoxyribonucleotide residue at position 540 with a guanine deoxyribonucleotide residue.

[0069] In this document, the vectors described are known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, they may be the vectors pEASY-Blunt and / or pCAMBIA-139;

[0070] In the aforementioned biological materials, the expression cassette described in D2) or D7) refers to DNA capable of expressing the gene in a host cell. This DNA may include not only a promoter to initiate gene transcription but also a terminator to terminate gene transcription. Furthermore, the expression cassette may also include an enhancer sequence.

[0071] In the above-mentioned biological materials, the nucleic acid molecule described in D1) or D5) can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0072] In the nucleic acid molecule described in D5), those skilled in the art can easily mutate the nucleotide sequence encoding the protein yedZ of the present invention using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides that have 75% or more identity with the nucleotide sequence of the protein yedZ isolated in the present invention, as long as they encode protein yedZ and have the function of protein yedZ, are all derived from and equivalent to the nucleotide sequence of the present invention.

[0073] The aforementioned 75% or higher identity can be 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0074] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting Gapexistencecost, Perresiduegapcost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, a search can be performed to calculate the identity of amino acid sequences, and then the identity value (%) can be obtained.

[0075] To address the aforementioned issues, this application also provides a method for regulating microbial L-tyrosine production.

[0076] The method for regulating microbial L-tyrosine production includes regulating microbial L-tyrosine production by controlling the expression of the coding gene of the above-mentioned protein or the activity or content of the protein in the target microorganism.

[0077] To address the aforementioned problems, this application also provides a method for constructing recombinant microorganisms.

[0078] The method for constructing recombinant microorganisms includes regulating the expression of the coding gene of the above-mentioned protein or the activity or content of the protein in the target microorganism to obtain recombinant microorganisms with changes in amino acid production, wherein the L-tyrosine production of the recombinant microorganisms is higher or lower than that of the target microorganisms.

[0079] In the above text, the regulation can be increased or enhanced, or decreased or weakened.

[0080] Upregulating or enhancing the expression of the gene encoding the protein or increasing the activity or content of the protein can upregulate or enhance or increase the production of microbial amino acids.

[0081] Downregulating or weakening the expression of the gene encoding the protein or reducing the activity or content of the protein can downregulate or weaken or reduce the production of microbial amino acids.

[0082] In the above text, the expression of the gene encoding the protein (hereinafter referred to as the gene) can be regulated by at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) post-transcriptional regulation of the gene (i.e., regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0083] In the above methods, the expression of the gene encoding the protein in the target microorganism is regulated by any of the following methods:

[0084] E1) Introduce the above-mentioned protein-coding gene expression cassette into the target microorganism;

[0085] E2) Knock out, downregulate, weaken, or reduce the expression of the encoding gene described in E1) in the target microorganism.

[0086] In the above text, E1)) can be achieved by inserting the coding gene into a chromosome. The insertion site on the chromosome can specifically be the yai T coding region. E1)) can also be achieved by introducing a recombinant plasmid expressing the coding gene into the target microorganism, whereby the recombinant plasmid can exist as an extrachromosomal genetic factor. In the recombinant plasmid, the nucleotide sequence of the coding gene can be at least one of sequence 1 and sequence 5.

[0087] In the above text, the knockout can refer to gene knockout technology. The gene knockout vector can be a pGRB vector.

[0088] In the above method, the regulation of the activity or content of the aforementioned protein in the target microorganism is achieved by mutating the yedZ gene in the genome of the target microorganism, wherein the mutation is to change the codon at position 180 (alanine) of the amino acid sequence encoded by the yedZ gene to a valine codon; the yedZ gene encodes any one of the following proteins:

[0089] The amino acid sequence of M1 is the same as that of sequence 2 in the protein.

[0090] M2) is a protein obtained by substituting and / or deleting and / or adding amino acid residues to the protein of M1), which has more than 80% identity with the protein shown in M1) and has the ability to regulate the production of microbial amino acids.

[0091] The method described above for obtaining the protein can be through site-directed mutagenesis in genetic engineering. Alternatively, it can be obtained through random mutagenesis.

[0092] In the above text, the nucleotide sequence of the gene encoding the protein with the amino acid sequence of sequence 2 can be sequence 1. The nucleotide sequence of the gene encoding the protein with the amino acid sequence of sequence 6 can be obtained by mutating cytosine (C) at position 539 of sequence 1 to thymine (T), while keeping the other nucleotides of sequence 1 unchanged.

[0093] To address the aforementioned problems, this application also provides a method for preparing L-amino acids.

[0094] The method for preparing L-amino acids includes producing L-amino acids using the proteins or biological materials described above or the recombinant microorganisms described in claim 3 or 4.

[0095] In the above-described biological materials, uses, or methods, the microorganism is any one of the following:

[0096] C1) Kingdom Bacteria;

[0097] C2) Enterobacteriaceae;

[0098] C3) Escherichia coli;

[0099] C4) Escherichia coli.

[0100] The Escherichia coli may be W3110 or CGMCC No. 25231.

[0101] In this application, the amino acid may be at least one of L-threonine, L-tryptophan, L-arginine, and L-valine.

[0102] The recombinant microorganisms described above can be used to produce a variety of products, including but not limited to lysine, glutamic acid, and valine in the examples. The products produced may also include glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutarate, citric acid, ornithine, citrulline, etc.

[0103] The present invention also provides a method for producing amino acids, the method comprising: introducing the above-mentioned biological material into biological cells capable of synthesizing the target amino acid to obtain recombinant biological cells, culturing the recombinant biological cells to obtain the target amino acid.

[0104] In the above method, the biological cell can be yeast, bacteria, algae, fungi, plant cells, or animal cells capable of synthesizing the target amino acid. The biological cell can be any biological cell capable of synthesizing the target amino acid. The bacteria can be *Escherichia coli*, *Corynebacterium glutamicum*, *Brevibacterium flavum*, *Corynebacterium pekinense*, *Brevibacterium ammonia-eating*, *Corynebacterium obliterans*, or *Pantoea*.

[0105] In this application, Escherichia coli is preferred, but any type of Escherichia coli can be used. The strains selected in the examples are only representative strains and have general applicability to Escherichia coli.

[0106] Beneficial effects

[0107] This invention discloses the L-tyrosine production-related protein yedZ, its biomaterials, and applications, belonging to the field of biotechnology.

[0108] This application constructed the pGRB-sgRNA-1 plasmid and Up-yedZ. A180V The -Down fragment was introduced into CGMCCNo.25231 and Escherichia coli W3110, resulting in L-tyrosine-producing strains CGMCCNo.25231 and Escherichia coli W3110 containing the mutant gene yedZ A180V (the cytosine (C) in the coding region of the yedZ gene was mutated to thymine (T) at position 539). These strains were named YPTyr-yedZ-01 and W3110-yedZ-01, respectively. Fermentation results showed that the mutant strains produced increased L-tyrosine.

[0109] Simultaneously, the pGRB-sgRNA-2 plasmid and the Up-yedZ-Down fragment were constructed and introduced into CGMCCNo.25231 and E. coli W3110, resulting in the replacement of the yaiT coding region with yedZ in the genome. A180V The gene and its promoter, along with other nucleotides in their genome, were preserved. The strains CGMCC No. 25231 and Escherichia coli W3110 were named recombinant strains YPTyr-yedZ-02 and W3110-yedZ-02.

[0110] Simultaneously, pGRB-sgRNA-2 plasmid and Up-yedZ were also constructed. A180V The -Down fragment was inserted into CGMCCNo.25231 and E. coli W3110, and the yaiT coding region on the genome was replaced with yedZ. A180V The gene and its promoter, along with other nucleotides in their genome, were preserved in strain CGMCC No. 25231 and Escherichia coli W3110, and were named recombinant strains YPTyr-yedZ-03 and W3110-yedZ-03, respectively. Fermentation results showed that both yedZ and yedZ were double copies of the yaiT partial coding region. A180V The CGMCC No. 25231 strain encoding the gene, as well as Escherichia coli W3110, showed increased L-tyrosine production.

[0111] Simultaneously, the pGRB-sgRNA-3 plasmid and the ΔyedZ-Up-Dwon fragment were constructed and introduced into CGMCCNo.25231 and Escherichia coli W3110, respectively, to obtain CGMCCNo.25231 strain and wild-type Escherichia coli W3110 strains with the yedZ gene deleted from their genomes, named YPTyr-yedZ-04 and W3110-yedZ-04. Fermentation results showed that the L-tyrosine production of both the yedZ gene-deleted CGMCCNo.25231 strain and wild-type Escherichia coli W3110 was reduced.

[0112] At the same time, pET28a-yedZ was also constructed. A180V pET28(a)-yedZ A180W pET28(a)-yedZ A180F pET28(a)-ye dZ A180L pET28(a)-yedZ A180I pET28(a)-yedZ A180M It was introduced into wild-type Escherichia coli W3110 to obtain W3110-pET28(a)-yedZ A180V W3110-pET28(a)-yedZ A180WW3110-pET28(a)-yedZ A180F W3110-pET28(a)-yedZ A180L W3110-pET28(a)-yedZ A180I and W3110-pET28(a)-yedZ A180M The W3110-yedZ mutant strain has the ability to produce some L-amino acids. Meanwhile, the W3110-pET28(a)-yedZ mutant strain... A180V W3110-pET28(a)-yedZ A180W W3110-pET28(a)-yedZ A180F W3110-pET28(a)-yedZ A180L W3110-pET28(a)-yedZ A180I and W3110-pET28(a)-yedZ A180M All of them have the ability to produce L-tyrosine, especially W3110-pET28(a)-yedZ A180V It has the strongest ability to produce L-tyrosine.

[0113] Simultaneously, pET28a-yedZ plasmid and pET28a-yedZ were constructed. A180V The plasmid was introduced into strain CGMCC No. 25231 to obtain strain YPTyr-yedZ-05, which overexpresses the yedZ encoding gene, and strain YPTyr-yedZ-05, which overexpresses yedZ. A180V The gene-encoding strain is YPTyr-yedZ-06.

[0114] Simultaneously, pET28a-yedZ plasmid and pET28a-yedZ were constructed. A180V The plasmid was introduced into wild-type Escherichia coli W3110 to obtain strain W3110-yedZ-05, which overexpresses the yedZ encoding gene, and strain W3110-yedZ-05, which overexpresses yedZ. A180V The gene-encoding strain is W3110-yedZ-06. Fermentation results indicate that regardless of overexpression of the yedZ gene or yedZ... A180V The CGMCC No. 25231 strain encoding the gene is still wild-type Escherichia coli W3110, and its L-tyrosine production is increased.

[0115] The above results indicate that, for both the high-L-tyrosine-producing strain CGMCC No. 25231 and the type strain W3110, substitution of alanine at position 180 of the yedZ gene with valine, tryptophan, phenylalanine, leucine, isoleucine, or methionine contributes to increased L-tyrosine production, especially valine. For high-L-tyrosine-producing strains, both the wild-type and mutant yedZ genes... A180V Mutant yedZ A180W Mutant yedZ A180F Mutant yedZ A180L Mutant yedZ A180I and mutant yedZ A180M Overexpression of these genes all contribute to increased L-tyrosine production, especially the mutant yedZ. A180V Knocking out the yedZ gene reduces L-tyrosine production.

[0116] Preservation Instructions

[0117] Bacterial species name: Escherichia coli;

[0118] Latin name: Escherichiacoli;

[0119] Strain number: YP052-1;

[0120] Preservation institution: China General Microbiological Culture Collection Center, China Committee on the Preservation and Management of Microbial Cultures;

[0121] The abbreviation for the depository institution is CGMCC.

[0122] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing;

[0123] Date of deposit: July 4, 2021;

[0124] Registered with the China National Collection Center (CGMCC) No. 25231. Detailed Implementation

[0125] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0126] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0127] The following examples used SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0128] The *Escherichia coli* W3110 used in the following examples is *Escherichia coli str. K-12substr. W3110* as described in the following literature: NCBI Reference Sequence: NC_007779.1 (17-MAY-2022). This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose. *Escherichia coli* W3110 was purchased from CGMCC (China General Microbiological Culture Collection Center), catalog number CGMCC1.7052.

[0129] Example 1: Construction of W3110 strain containing the yedZ gene mutant

[0130] I. Construction of yedZ gene mutant plasmid

[0131] For ease of study, the wild-type yedZ gene (sequence as SEQ ID No. 1) and its promoter were first cloned into the expression vector pET28a. Using the Escherichia coli W3110 genome sequence published by NCBI as a template, PCR amplification was performed using primers yedZ-F / yedZ-R to obtain the wild-type yedZ promoter and coding region fragment (sequence as SEQ ID No. 3). After recovery, the fragment was ligated with the expression vector pET28a (purchased from TaKaRa, containing kanamycin resistance) recovered by EcoRI and HindIII digestion using NEBuilder enzyme (purchased from NEB) at 50°C for 30 min. The ligation product was transformed into DH5α competent cells and plated onto 2-YT agar plates containing kanamycin (50 mg / L) and cultured at 37°C for 12 h. The single clones that grew were identified by PCR using primers T7:5'-GCTAGTTATTGCTCAGCGG-3' and T7t:5'-TAATACGACTCACTATAGGGGGAAT-3'. The positive transformant pET28a-yedZ, which amplified a 1348 bp fragment (sequence as shown in SEQ ID No. 4), was identified as containing the yedZ promoter and coding region sequence.

[0132] To obtain a mutant encoding the yedZ gene, a yedZ mutant gene plasmid was prepared using a random mutagenesis kit (Agilent Technologies, USA). Using the constructed plasmid pET28a-yedZ as a template, PCR amplification was performed with primers yedZ-F / yedZ-R, yielding a fragment containing the yedZ gene coding region and promoter region with random point mutations (sequence shown in SEQ ID No. 3, but the yedZ coding region contains random point mutations).

[0133] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10 μL, dNTP Mixture (10 mM) 1.5 μL, primers (10 pM) 1.6 μL each, KAPA HiFi HotStart (1 U / μL) 0.5 μL, add ddH2O to a total volume of 50 μL.

[0134] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 56℃ annealing for 15 s; 72℃ extension for 60 s; 30 cycles), 72℃ over-extension for 5 min.

[0135] The recovered DNA fragments were ligated with the expression vector pET28a (purchased from TaKaRa, containing kanamycin resistance) recovered by EcoRI / HindIII digestion using NEBuilder enzyme (purchased from NEB) at 50°C for 30 min. The ligation product was transformed into DH5α and plated onto 2-YT agar plates containing kanamycin (50 mg / L) and incubated at 37°C for 12 h. The resulting single clones were identified by PCR using T7 (5'-GCTAGTTATTGCTCAGCGG-3') / T7t (5'-TAATACGACTCACTATAGGGGGAAT-3'). PCR amplification of a 1348 bp fragment (sequence as shown in SEQ ID No. 4, but with random point mutations in the yedZ coding region) indicated a pET28a-yedZ-MT positive transformant containing a random mutation in the yedZ gene.

[0136] PCR amplification system: 2×PremixrTaq 12.5μL, primers (10pM) 1μL each, add ddH2O to a total volume of 25μL.

[0137] PCR amplification program: 94℃ pre-denaturation for 15 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0138] The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0139] yedZ-F:5'- GACTGGTGGACAGCAAATGGGTCGCGGATCC TGTTTATG

[0140] GCAAGGCGTTAC-3' (the underlined nucleotide sequence is the pET28(a) homologous arm sequence)

[0141] yedZ-R:5'- CAGTGGTGGTGGTGGTGGTTGCTCGAGTGCGGCCGC CCTG

[0142] ATGCGATCTGTGTATG-3' (The underlined nucleotide sequence is the pET28(a) homologous arm sequence).

[0143] II. Construction of strains containing mutant yedZ gene plasmid

[0144] To determine the L-tyrosine production performance of the mutant vector pET28a-yedZ-MT constructed in step one, specifically, different random mutant plasmids of yedZ constructed in step one were transformed into *E. coli* strain W3110 (transformation and identification were the same as in step one). Positive transformants were passaged three times on 2-YT agar plates containing kanamycin (50 mg / L), and then inoculated into 500 mL Erlenmeyer flasks containing 30 mL of rich culture medium. Fermentation was carried out at 37°C for 24 h, until the bacterial cells reached OD0.05. 600 IPTG was added at a final concentration of 0.1 mM when the concentration of L-amino acids was 0.1 mM to induce overexpression of yedZ protein. After fermentation, the concentration of L-amino acids was detected by high performance liquid chromatography (HPLC), as shown in Table 1. Strains with superior L-amino acid production capacity compared to the W3110 control were selected, which were designated as W3110-yedZ mutant strains 1-5.

[0145] Enriched culture medium: The solvent is water, and the solutes and their concentrations are as follows: glucose 30 g / L, (NH4)2SO4 2 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.05 g / L, MnSO4·H2O 0.05 g / L, FM902 yeast extract 1.5 g / L, corn steep liquor 5 g / L, molasses 17 g / L, betaine 0.5 g / L, citric acid 2 g / L, vitamin H2 0 mg / L, vitamin B1 1.5 mg / L, vitamin B3 1.5 mg / L. 12 1.5 g / L, pH adjusted to 7.0 with sodium hydroxide.

[0146] Table 1. Results of L-amino acid analysis by high performance liquid chromatography in the W3110-yedZ mutant strain.

[0147]

[0148]

[0149] As shown in Table 1, the Escherichia coli W3110-yedZ mutant strain of this disclosure has the ability to produce some L-amino acids, among which the W3110-yedZ mutant strain 3 has a superior ability to produce L-tyrosine, indicating that the yedZ mutant strain 3 has the activity to synthesize L-tyrosine.

[0150] Plasmids were extracted from W3110-yedZ mutant strain 3, and the yedZ gene was sequenced. The results confirmed that cytosine (C) at position 539 of the nucleotide sequence of the yedZ gene coding region was mutated to thymine (T) (sequence shown in SEQ ID No. 5), and alanine (A) at position 180 of the corresponding amino acid sequence was mutated to valine (V) (sequence shown in SEQ ID No. 6). The mutant protein was designated as yedZ. A180V .

[0151] III. Construction of the yedZ gene mutant vector

[0152] The W3110-yedZ mutant strain 3 was obtained from wild-type Escherichia coli W3110 using a random mutation approach. To obtain more yedZ mutants and improve their L-tyrosine production capacity, mutants with the same yedZ mutation location but different amino acids were constructed. Specifically, the plasmid pET28a-yedZ sequenced in step two was used... A180V Using this as a template, five mutants were constructed by substituting different amino acids at position 180 of yedZ. All substituted amino acids were hydrophobic. The names of the substituted amino acids and the primers used in each mutant are shown in Table 2.

[0153] Table 2 shows the substituted amino acids in the yedZ mutant and the names of the primers used in each mutant.

[0154]

[0155]

[0156] The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0157] W-PR-1:5'-aagcagtacagccagcccccagtagatgagcggctgcggtg-3',

[0158] W-PR-2:5'-caccgcagccgctcatctactgggggctggctgtactgctt-3',

[0159] F-PR-1:5'-aagcagtacagccagcccaaagtagatgagcggctgcggtg-3',

[0160] F-PR-2:5'-caccgcagccgctcatctactttgggctggctgtactgctt-3',

[0161] L-PR-1:5'-aagcagtacagccagcccaaggtagatgagcggctgcggtg-3',

[0162] L-PR-2:5'-caccgcagccgctcatctaccttgggctggctgtactgctt-3',

[0163] I-PR-1:5'-aagcagtacagccagcccaatgtagatgagcggctgcggtg-3',

[0164] I-PR-2:5'-caccgcagccgctcatctacattgggctggctgtactgctt-3',

[0165] M-PR-1:5'-aagcagtacagccagccctacgtagatgagcggctgcggtg-3',

[0166] M-PR-2:5'-caccgcagccgctcatctacatggggctggctgtactgctt-3',

[0167] Using the wild-type *Escherichia coli* W3110 genome as a template, PCR amplification was performed using primers yedZ-F / W-PR-1 and KAPAHiFi HotStart (Table 2) to obtain an 895bp Up DNA fragment with the yedZ mutation. PCR amplification was also performed using primers W-PR-2 / yedZ-R and KAPA HiFi HotStart to obtain a 201bp Down DNA fragment with the yedZ mutation. After PCR, the DNA fragments were recovered by agarose gel electrophoresis using a column DNA gel recovery kit. The recovered DNA fragments were ligated with the expression vector pET28(a) recovered from EcoRI / HindIII digestion using NEBuilder enzyme (NEB) at 50°C for 30 min. The ligation product was transformed into DH5α and plated onto 2-YT agar plates containing kanamycin (50 mg / L) and incubated at 37°C. The cultured single clones were identified by primer T7 / T7t PCR, and the positive transformant pET28(a)-yedZ containing a 1348bp fragment was amplified by rTaq PCR. This transformant is a mutation of alanine at position 180 of the yedZ gene to tryptophan. A180W The other four strains were constructed in the same manner. The five yedZ mutant vectors with the alanine at position 180 replaced by the amino acids listed in Table 2 were named as shown in Table 2.

[0168] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0169] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 56℃ annealing for 15 s; 72℃ extension for 60 s; 30 cycles), 72℃ over-extension for 5 min.

[0170] PCR amplification system: 12.5 μL of 2×Premix r Taq, 1 μL of each primer (10 pM), and 25 μL of ddH2O.

[0171] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0172] IV. Construction of yedZ mutant strain

[0173] To identify the L-tyrosine production performance of the mutant vector constructed in step three, specifically, the five plasmids constructed in step three were transformed into Escherichia coli strain W3110 (transformation and identification were the same as in step one). The positive transformants were passaged three times on 2-YT agar plates containing kanamycin (50 mg / L) and then inoculated into 500 mL Erlenmeyer flasks containing 30 mL of rich culture medium for shake-flask fermentation at 37 °C for 24 h.

[0174] After fermentation, the concentration of L-tyrosine was analyzed by high-performance liquid chromatography (HPLC), as shown in Table 3. The mutant strain W3110-pET28(a)-yedZ... A180V The ability to produce L-tyrosine is greater than that of W3110-pET28(a)-yedZ A180W W3110-pET28(a)-yedZ A180F W3110-pET28(a)-yedZ A180L W3110-pET28(a)-yedZ A180I and W3110-pET28(a)-yedZ A180M Superior.

[0175] Table 3. Results of L-tyrosine detection in the W3110-yedZ mutant strain using high performance liquid chromatography.

[0176]

[0177] Example 2: Constructing an engineered strain containing the mutant yedZ gene

[0178] Based on the genome sequence of Escherichia coli W3110 published by NCBI, point mutations were performed on the yedZ gene of the high-yielding L-tyrosine strain CGMCC No.25231 using CRISPR / Cas9 gene editing technology (sequencing confirmed that the wild-type yedZ gene is retained on the chromosome of the L-tyrosine-producing strain), thereby further enhancing the strain's ability to produce L-tyrosine.

[0179] A point mutation was introduced into the coding region of the yedZ gene (SEQ ID No. 1), wherein the point mutation was a mutation of cytosine (C) at position 539 of the nucleotide sequence of the yedZ gene coding region to thymine (T) (the sequence is shown in SEQ ID No. 5, named mutant yedZ). A180V Gene).

[0180] The DNA molecule shown in SEQ ID No. 1 encodes a protein with the amino acid sequence of SEQ ID No. 2 (the protein is named wild-type yedZ protein). The DNA molecule shown in SEQ ID No. 5 encodes a protein with the amino acid sequence of SEQ ID No. 6 (the mutant protein is named mutant yedZ). A180V (protein), the mutant protein yedZ A180V The valine (V) at position 180 in the amino acid sequence (SEQ ID No. 6) is derived from alanine (A) by mutation.

[0181] I. Construction of sgRNA

[0182] Based on the Escherichia coli W3110 genome sequence published by NCBI, sgRNA target sequences were designed using CRISPRRGEN Tools (http: / / www.rgenome.net / cas-designer / ). After selecting a suitable sgRNA target sequence, linearized pGRB cloning vector terminal sequences were added to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid through recombination.

[0183] Amplifying the sgRNA fragment requires no template; only a PCR annealing process is needed. The system and procedure are as follows: PCR reaction system: sgRNA-1F 10 μL, sgRNA-1R 10 μL; PCR reaction procedure: denaturation at 95℃ for 5 min, annealing at 50℃ for 1 min. After annealing, the target fragment is recovered using a DNA purification kit, its DNA concentration is determined, and the concentration is diluted to 100 ng / μL.

[0184] pGRB plasmid (Addgene, catalog number #71539) was extracted and digested with Spe I and dephosphorylated to prevent self-ligation. The digestion system consisted of 5 μL 10x Buffer, 2.5 μL Spe I, 3000-5000 ng pGRB plasmid DNA, and ddH2O to a final volume of 50 μL. After digestion at 37°C for 3 h, the DNA was recovered by agarose gel electrophoresis and then dephosphorylated. The dephosphorylation system consisted of 5 μL 10x Buffer, 1000-2000 ng linearized pGRB plasmid DNA, 2.5 μL CIAP, and ddH2O to a final volume of 50 μL. After treatment at 37°C for 1 h, the linearized pGRB plasmid was recovered using a DNA purification kit. Recombination of sgRNA and pGRB plasmid was then performed using a Gibson Assembly kit (New England Biotechnology). Recombinant system: 2.5 μL NEB assembly enzyme, 2 μL linearized cloning vector, and 0.5 μL sgRNA. After assembly at 50℃ for 30 min, the product was transformed into DH5α competent cells, plasmids were extracted, and identified by sequencing using sgRNA-PF / sgRNA-PR primers. The correctly sequenced plasmids were stored and named pGRB-sgRNA-1.

[0185] The primers used in this experiment were designed as follows (synthesized by Invitrogen Shanghai). Underlined bases are the homologous arm sequences of the pGRB cloning vector, and bases in lowercase are the sgRNA sequences:

[0186] sgRNA-1F:5'- TGACAGCTAGCTCAGTCCTAGGTATAATACTAGT cgcagccgctcatctacgct GT TTTAGAGC TAGAAATAGCAAGTTAAAATAAGG -3'

[0187] sgRNA-1R:

[0188] 5'- CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC agcgtagatgagcggctgcg ACTAGTATTAT ACCTAGGACTGAGCTAGCTGTCA -3''

[0189] sgRNA-PF:5'-GTCTCATGAGCGGATACATATTTG-3'

[0190] sgRNA-PR:5'-ACTGGCACTGCTGTGCGCCG-3'

[0191] II. Mutant gene yedZ A180V DNA amplification

[0192] Using W3110 genomic DNA as a template, PCR amplification was performed with primers P1 / P2, P3 / P4 and KAPA HiFi HotStart polymerase, respectively, yielding two yedZ lines with mutated bases, measuring 563 bp and 310 bp respectively. A180V DNA fragment (yedZ) A180V -Up and yedZ A180V -Down). After the PCR reaction, the fragments were extracted using a column-based DNA gel extraction kit. A180V -Up and yedZ A180V -Down was recovered by agarose gel electrophoresis. The recovered DNA fragment was then subjected to overlap PCR with primers P1 / P4 to obtain the DNA fragment Up-yedZ containing the integration homologous arm of the point mutation. A180V -Down(SEQ IDNo.7)742bp.

[0193] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0194] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 56℃ annealing for 15 s; 72℃ extension for 30 s; 30 cycles), 72℃ over-extension for 5 min.

[0195] The primers are designed as follows (synthesized by Invitrogen Shanghai). The bases in lowercase red bold text indicate the mutation positions:

[0196] P1:5'-ATCAATCACGGTGGACTGG-3',

[0197] P2:

[0198] P3:

[0199] P4:5'-GCAACAACTCTTAGGAAACGAG-3',

[0200] III. Preparation and Transformation of Competent Behaviors

[0201] The pREDCas9 plasmid (containing the spectinomycin resistance gene, purchased from Addgene, catalog number 371541) was extracted and transformed into L-tyrosine-producing bacteria CGMCC No. 25231 and Escherichia coli W3110 competent cells, respectively. The cells were plated on 2-YT agar plates containing spectinomycin (100 mg / L) and cultured at 32°C. Single colonies resistant to spectinomycin (100 mg / L) were selected and identified by PCR using primers pRedCas9-PF / pRedCas9-PR. The 943 bp (SEQ ID No. 8) transformed YPTyr-Cas9 and W3110-Cas9 containing the pREDCas9 plasmid were obtained.

[0202] L-tyrosine YPTyr-Cas9 and W3110-Cas9 competent cells were prepared. When the cells grew to OD... 600 =0.1mM IPTG was added to induce λ-Red-mediated homologous recombination. When OD 600 When the concentration was 0.4, bacterial cells were collected to prepare competent cells, which were then transformed into pGRB-sgRNA-1 plasmid and the point-mutated recombinant DNA fragment Up-yedZ, respectively. A180V -Down, spread onto 2-YT agar plates containing spectinomycin (100 mg / L) and ampicillin (100 mg / L), and incubate at 32°C for 12 h. Ten transformants were then picked and inoculated into 2-YT medium containing spectinomycin (100 mg / L) and a final concentration of 0.2% arabinose for incubation to eliminate plasmid pGRB-sgRNA-1. Colonies that grew on spectinomycin (100 mg / L) but not on ampicillin (100 mg / L) were selected and transferred to 2-YT medium for incubation at 42°C to eliminate pREDCas9 plasmid. Ten colonies that did not grow on spectinomycin (100 mg / L) but grew on antibiotic-free 2-YT were selected. PCR amplification and sequencing were performed using primers P1 / P4. The sequencing results were compared with the wild-type W3110 genome yedZ gene sequence. The yedZ gene with a mutation at position 539 (cytosine (C) to thymine (T)) in the coding region (sequence shown in SEQ ID No. 5) was identified as the mutant yedZ gene. A180V Positive transformants. Transformants containing the mutant gene yedZ A180V The L-tyrosine producing bacteria CGMCC No. 25231 and Escherichia coli W3110 were named YPTyr-yedZ-01 and W3110-yedZ-01, respectively.

[0203] The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0204] pRedCas9-PF:5'-GCAGTGGCGGTTTTCATG-3'

[0205] pRedCas9-PR:5'-CCTTGGTGATCTCGCCTTTC-3'

[0206] PCR amplification system: 12.5 μL of 2×Premix r Taq, 1 μL of each primer (10 pM), and 25 μL of ddH2O.

[0207] PCR amplification program: 94℃ pre-denaturation for 10 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0208] Example 3: Constructing a genome overexpressing the yedZ gene or yedZ A180V engineered strains of genes

[0209] Based on the genome sequence of Escherichia coli W3110 published by NCBI, the wild-type yedZ gene or the mutant yedZ gene was integrated into the coding region of the yaiT gene in L-tyrosine-producing strain CGMCC No. 25231 and Escherichia coli W3110, respectively, using CRISPR / Cas9 gene editing technology. A180V This will allow for a more in-depth study of the yedZ gene and its mutant forms. A180V The effect of genes on L-tyrosine synthesis.

[0210] I. Construction of sgRNA

[0211] Based on the Escherichia coli W3110 genome sequence published by NCBI, sgRNA target sequences were designed using CRISPRRGEN Tools (http: / / www.rgenome.net / cas-designer / ). After selecting a suitable sgRNA target sequence, linearized pGRB cloning vector terminal sequences were added to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid through recombination.

[0212] Amplifying the sgRNA fragment requires no template; only a PCR annealing process is needed. The system and procedure are as follows: PCR reaction system: sgRNA-2F 10 μL, sgRNA-2R 10 μL; PCR reaction procedure: denaturation at 95℃ for 5 min, annealing at 50℃ for 1 min. After annealing, the target fragment is recovered using a DNA purification kit, its DNA concentration is determined, and the concentration is diluted to 100 ng / μL.

[0213] pGRB plasmid was extracted and digested with Spe I and dephosphorylated to prevent self-ligation. The digestion system consisted of 5 μL 10x Buffer, 2.5 μL Spe I, 3000-5000 ng pGRB plasmid DNA, and ddH2O to a final volume of 50 μL. After digestion at 37°C for 3 h, the plasmid was recovered by agarose gel electrophoresis and then dephosphorylated. The dephosphorylation system consisted of 5 μL 10x Buffer, 1000-2000 ng pGRB plasmid DNA, 2.5 μL CIAP, and ddH2O to a final volume of 50 μL. After treatment at 37°C for 1 h, the linear pGRB plasmid was recovered using a DNA purification kit. Recombination of sgRNA and pGRB plasmid was then performed using a Gibson Assembly kit (New England Biotechnology). The recombination system consisted of 2.5 μL NEB assembly enzyme, 2 μL linearized cloning vector, and 0.5 μL sgRNA. After assembly at 50℃ for 30 min, the product was transformed into DH5α competent cells, plasmids were extracted, and identified by sequencing using sgRNA-PF / sgRNA-PR primers. The correctly sequenced plasmid was named pGRB-sgRNA-2.

[0214] The primers used in this experiment were designed as follows (synthesized by Invitrogen Shanghai). Underlined bases are the homologous arm sequences of the pGRB cloning vector, and bases in lowercase highlighted text are the sgRNA sequences:

[0215] sgRNA-2F:5'- TGACAGCTAGCTCAGTCCTAGGTATAATACTAGT ggcaactatgtaaactatag GT TTTAGAGC TAGAAATAGCAAGTTAAAATAAGG -3'

[0216] sgRNA-2R:5'- CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC ctatagtttacatagttgcc AC TAGTATTA TACCTAGGACTGAGCTAGCTGTCA -3''

[0217] sgRNA-PF:5'-GTCTCATGAGCGGATACATATTTG-3'

[0218] sgRNA-PR:5'-ACTGGCACTGCTGTGCGCCG-3'

[0219] II. PCR amplification of overexpressed genomic DNA sequences

[0220] Based on the Escherichia coli W3110 genome sequence published by NCBI, three pairs of amplified upstream and downstream homologous arm sequences and yedZ or yedZ were designed and synthesized. A180VPrimers for the gene coding region and promoter region were used to introduce yedZ or yedZ into the yaiT coding region of L-tyrosine-producing bacteria CGMCC No.25231 and Escherichia coli W3110, respectively, using CRISPR / Cas9 gene editing. A180V Gene.

[0221] The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0222] P7:5'-AAGAGAATGGAAGAGAGGCC-3',

[0223] P8:5'-GTAACGCCTTGCCATAAACACCCAATCAAGTGCTGTAACG-3',

[0224] P9:5'-CGTTACAGCACTTGATTGGGTGTTTATGGCAAGGCGTTAC-3',

[0225] P10:5'-CGGTAGTGTAGGTTTCGTTGCCTGATGCGATCTGTGTATG-3',

[0226] P11:5'-CATACACAGATCGCATCAGGCAACGAAACCTACACTACCG-3',

[0227] P12:5'-CGACCTGTAG TATCCCATTC-3'.

[0228] Using W3110 genomic DNA as a template, PCR amplification was performed using primers P7 / P8 and P11 / P12 and KAPA HiFi HotStart to obtain a 590bp upper homologous arm (SEQ ID No. 91-590) and a 605bp lower homologous arm (SEQ ID No. 91606-2210). Using W3110 genomic DNA as a template, PCR amplification of the yedZ promoter and coding region fragment (1095bp, SEQ ID No. 9551-1645) was performed using primers P9 / P10 and KAPA HiFi HotStart. The plasmid pET28a-yedZ was then used to amplify the yedZ gene. A180V Using primers P9 / P10 and KAPA HiFi HotStart PCR as templates, yedZ was amplified. A180VThe promoter and coding region fragment is 1095 bp (SEQ ID No. 10551-1645). After the PCR reaction, the DNA was recovered by agarose gel electrophoresis using a column DNA extraction kit. The recovered DNA was then used for overlap PCR with primers P7 and P12 to obtain the genome-overexpressing recombinant DNA fragments Up-yedZ-Down (SEQ ID No. 9) and Up-yedZ, respectively. A180V -Down(SEQ ID No.10)2210bp.

[0229] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0230] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 56℃ annealing for 15 s; 72℃ extension for 60 s; 30 cycles), 72℃ over-extension for 5 min.

[0231] III. Preparation and Transformation of Competent Behaviors

[0232] L-tyrosine YPTyr-Cas9 and W3110-Cas9 competent cells were prepared. When the cells grew to OD... 600 =0.1mM IPTG was added to induce λ-Red-mediated homologous recombination. When OD 600 When the concentration of the bacterial cell was 0.4, competent cells were collected and transformed into pGRB-sgRNA-2 plasmid and the genomic overexpression DNA fragment Up-yedZ-Down or Up-yedZ, respectively. A180V -Down, spread onto 2-YT agar plates containing spectinomycin (100 mg / L) and ampicillin (100 mg / L), and incubate at 32°C for 12 h. After subculturing single colonies, PCR identification was performed using primers P7 / P12. Positive transformants were those containing a 2210 bp fragment (sequence without point mutations as shown in SEQ ID No. 9, and sequence with point mutations as shown in SEQ ID No. 10).

[0233] Positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg / L) and arabinose to a final concentration of 0.2% to eliminate the pGRB-sgRNA-2 plasmid. Colonies that grew on spectinomycin (100 mg / L) but not on ampicillin (100 mg / L) were selected. These colonies were then transferred to 2-YT medium and cultured at 42°C to eliminate the pREDCas9 plasmid. Colonies that did not grow on spectinomycin (100 mg / L) but grew on antibiotic-free 2-YT were selected. PCR identification was performed again using primers P7 / P12. A 2210 bp amplified positive transformant was identified. The positive transformants were sequenced. Strains with correct sequencing results were named YPTyr-yedZ-02 (without mutation), YPTyr-yedZ-03 (with mutation), W3110-yedZ-02 (without mutation), and W3110-yedZ-03 (with mutation).

[0234] The recombinant bacteria YPTyr-yedZ-02 and W3110-yedZ-02 contain double copies of the yedZ gene shown in SEQ ID No. 1. Specifically, the recombinant bacteria YPTyr-yedZ-02 and W3110-yedZ-02 are obtained by replacing the yaiT coding region in the genomes of L-tyrosine-producing bacteria CGMCC No. 25231 and wild-type Escherichia coli W3110 with the yedZ gene and its promoter, while keeping other nucleotides in their genomes unchanged. The recombinant bacteria containing double copies of the yedZ gene can significantly and stably increase the expression level of the yedZ gene.

[0235] The recombinant bacteria YPTyr-yedZ-03 and W3110-yedZ-03 contain two copies of the yedZ strain shown in SEQ ID No. 5. A180V Specifically, the recombinant strains YPTyr-yedZ-03 and W3110-yedZ-03 are formed by replacing the yaiT coding region with yedZ in the genomes of L-tyrosine-producing strains CGMCC No. 25231 and wild-type Escherichia coli W3110. A180V Recombinant bacteria obtained by keeping the gene and its promoter unchanged, while maintaining other nucleotides in the genome. Contains two copies of yedZ. A180V Recombinant bacteria can significantly and stably increase the expression level of the yedZ gene.

[0236] PCR amplification system: 12.5 μL of 2×Premix r Taq, 1 μL of each primer (10 pM), and 25 μL of ddH2O.

[0237] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0238] Example 4: Constructing an engineered strain with the yedZ gene missing from its genome.

[0239] Based on the genome sequence of Escherichia coli W3110 published by NCBI, the yedZ gene in L-tyrosine-producing strain CGMCC No.25231 and wild-type Escherichia coli W3110 was knocked out using CRISPR / Cas9 gene editing technology (sequencing confirmed that these strains retained the complete yedZ gene on their chromosomes), thereby further investigating the impact of the Escherichia coli yedZ gene on L-tyrosine synthesis.

[0240] I. Construction of sgRNA

[0241] Based on the Escherichia coli W3110 genome sequence published by NCBI, sgRNA target sequences were designed using CRISPRRGEN Tools (http: / / www.rgenome.net / cas-designer / ). After selecting a suitable sgRNA target sequence, linearized pGRB cloning vector homologous arm sequences were added to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid through recombination.

[0242] Amplifying the sgRNA fragment requires no template; only a PCR annealing process is needed. The system and procedure are as follows: PCR reaction system: sgRNA-3F 10 μL, sgRNA-3R 10 μL; PCR reaction procedure: denaturation at 95℃ for 5 min, annealing at 50℃ for 1 min. After annealing, the target fragment is recovered using a DNA purification kit, its DNA concentration is determined, and the concentration is diluted to 100 ng / μL.

[0243] pGRB plasmid was extracted and digested with Spe I and dephosphorylated to prevent self-ligation. The digestion system consisted of 5 μL 10x Buffer, 2.5 μL Spe I, 3000-5000 ng pGRB plasmid DNA, and ddH2O to a final volume of 50 μL. After digestion at 37°C for 3 h, the DNA was recovered by agarose gel electrophoresis and then dephosphorylated. The dephosphorylation system consisted of 5 μL 10x Buffer, 1000-2000 ng linearized pGRB plasmid DNA, 2.5 μL CIAP, and ddH2O to a final volume of 50 μL. After treatment at 37°C for 1 h, the linearized pGRB plasmid was recovered using a DNA purification kit. Recombination of sgRNA and pGRB plasmid was then performed using a Gibson Assembly kit (New England Biotechnology). The recombination system consisted of 2.5 μL NEB assembly enzyme, 2 μL linearized cloning vector, and 0.5 μL sgRNA. After assembly at 50℃ for 30 min, the product was transformed into DH5α competent cells, plasmids were extracted, and identified by sequencing using sgRNA-PF / sgRNA-PR primers. The correctly sequenced plasmid was named pGRB-sgRNA-3.

[0244] The primers used in this experiment were designed as follows (synthesized by Invitrogen Shanghai). Underlined bases are the homologous arm sequences of the pGRB cloning vector, and bases in lowercase highlighted text are the sgRNA sequences:

[0245] sgRNA-3F:5'- TGACAGCTAGCTCAGTCCTAGGTATAATACTAGT cggtggactgggtgccgatc GT TTTAGAGCTAGA AATAGCAAGTTAAAATAAGG -3'

[0246] sgRNA-3R:5'- CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC gatcggcacccagtccaccg AC TAGTATTATACC TAGGACTGAGCTAGCTGTCA -3''

[0247] sgRNA-PF:5'-GTCTCATGAGCGGATACATATTTG-3'

[0248] sgRNA-PR:5'-GCGTCAGGTGCATAAACAGA-3'

[0249] II. PCR amplification of DNA recombination fragments missing from the genome

[0250] Based on the genome sequence of Escherichia coli W3110 published by NCBI, two pairs of primers were designed and synthesized to amplify the upstream and downstream homologous arm sequences. The yedZ gene in L-tyrosine-producing bacteria CGMCCNo.25231 and wild-type Escherichia coli W3110 was knocked out by CRISPR / Cas9 gene editing.

[0251] The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0252] P13:5'-ATCCGCTCACACTGATGAC-3',

[0253] P14:5'-GTGAACCTGCTTGCGTAACAGAAACGGCAACAATCCG-3',

[0254] P15:5'-CGGATTGTTGCCGTTTCTGTTACGCAAGCAGGTTCAC-3',

[0255] P16:5'-CCTCAATGCCAATCATCTC-3'.

[0256] Using W3110 genomic DNA as a template, PCR amplification was performed with primers P13 / P14, P15 / P16, and KAPA HiFi HotStart to obtain upper and lower homologous arm fragments of 433 bp and 627 bp, respectively. After the PCR reaction, the DNA was recovered by agarose gel electrophoresis using a column DNA gel recovery kit. The recovered DNA was then subjected to overlap PCR with primers P13 / P16 to obtain the recombinant DNA fragment ΔyedZ-Up-Dwon (SEQ ID No. 11) with a size of 1060 bp, which lacks the yedZ gene.

[0257] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0258] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 56℃ annealing for 15 s; 72℃ extension for 60 s; 30 cycles), 72℃ over-extension for 5 min.

[0259] III. Preparation and Transformation of Competent Behaviors

[0260] L-tyrosine YPTyr-Cas9 and W3110-Cas9 competent cells were prepared. When the cells grew to OD... 600 =0.1mM IPTG was added to induce λ-Red-mediated homologous recombination. When OD 600 When the concentration of bacteria reached 0.4, competent cells were collected and transformed into pGRB-sgRNA-3 plasmid and the recombinant DNA fragment ΔyedZ-Up-Dwon (with the yedZ genome deleted), respectively. These cells were then plated onto 2-YT agar plates containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) and incubated at 32°C for 12 h. Single colonies were passaged and identified by PCR using primers P13 / P16. Transformants amplifying a 1060 bp fragment (SEQ ID No. 11) were considered positive, while those amplifying a 1588 bp fragment were considered the original bacteria.

[0261] Positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg / L) and a final concentration of 0.2% arabinose to eliminate plasmid pGRB-sgRNA-3. Colonies that grew on spectinomycin (100 mg / L) but not on ampicillin (100 mg / L) were selected. These colonies were then transferred to 2-YT medium and cultured at 42°C to eliminate pREDCas9 plasmid. Colonies that did not grow on spectinomycin (100 mg / L) but grew on antibiotic-free 2-YT were selected. PCR identification was performed again using primers P13 / P16. Those that amplified a 1060 bp fragment were positive. Positive transformants were sent for sequencing. Strains with correct sequencing results were named YPTyr-yedZ-04 and W3110-yedZ-04, respectively.

[0262] The recombinant bacteria YPTyr-yedZ-04 and W3110-yedZ-04 contain a deleted yedZ gene; specifically, the recombinant bacteria YPTyr-yedZ-04 and W3110-yedZ-04 are obtained by knocking out part of the coding region of the yedZ gene in the genomes of L-tyrosine-producing bacteria CGMCC No.25231 and wild-type Escherichia coli W3110, while keeping other nucleotides in their genomes unchanged.

[0263] PCR amplification system: 12.5 μL of 2×Premix r Taq, 1 μL of each primer (10 pM), and 25 μL of ddH2O.

[0264] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0265] Example 5: Constructing plasmids to overexpress yedZ or yedZ A180V engineered strains

[0266] Based on the Escherichia coli (E. coli) W3110 genome sequence published by NCBI, the wild-type yedZ gene or the mutant yedZ gene was expressed using the E. coli expression vector pET28a (purchased from TaKaRa, containing kanamycin resistance). A180V The coding and promoter regions of the gene were introduced into L-tyrosine-producing bacteria CGMCC No. 25231 and wild-type Escherichia coli W3110, allowing for more in-depth research on multi-copy yedZ genes or mutant yedZ. A180V The influence of genes on L-tyrosine production.

[0267] L-tyrosine CGMCC No. 25231 and wild-type W3110 competent cells were prepared and transformed into plasmids pET28a-yedZ and pET28a-yedZ constructed in Example 1, respectively. A180V The culture was spread onto 2-YT agar plates containing kanamycin (50 mg / L) and incubated at 37°C. Single colonies produced were identified by PCR using primers T7t / T7. Positive transformants were those that amplified a 1348 bp fragment (the sequence without point mutations is shown in SEQ ID No. 4; the sequence with point mutations has an A at position 284, and the rest is as shown in SEQ ID No. 4); the original bacteria were those that could not amplify the fragment.

[0268] PCR amplification system: 12.5 μL of 2×Premix r Taq, 1 μL of each primer (10 pM), and 25 μL of ddH2O.

[0269] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0270] The wild-type yedZ gene and mutant yedZ gene were overexpressed in the L-tyrosine CGMCC No.25231 and wild-type E. coli W3110 plasmids. A180V The genes were named YPTyr-yedZ-05 (without mutation), YPTyr-yedZ-06 (with mutation), W3110-yedZ-05 (without mutation) and W3110-yedZ-06 (with mutation).

[0271] Recombinant bacteria YPTyr-yedZ-05 and W3110-yedZ-05 contain the yedZ gene (shown in SEQ ID No. 1) overexpressed with pET28a-yedZ, and were obtained by maintaining their genomic sequence unchanged. The pET28a-yedZ overexpression recombinant bacteria can significantly and stably increase the expression level of the yedZ gene.

[0272] Recombinant bacteria YPTyr-yedZ-06 and W3110-yedZ-06 contain pET28a-yedZ A180V Overexpression of yedZ as shown in SEQ ID No. 5 A180V Recombinant bacteria obtained by preserving the genome sequence of the gene. pET28a-yedZ A180V Overexpression of the recombinant bacteria can significantly and stably increase the expression level of the yedZ gene.

[0273] Example 6: L-Tyrosine Fermentation Experiment

[0274] The strains constructed in the above examples, the tyrosine-producing bacterium CGMCC No. 25231, and wild-type Escherichia coli W3110 were inoculated into a 5L fermenter (Shanghai Bailun Biotechnology Co., Ltd.) of model BLBIO-5GC-4-H and fermented using L-tyrosine fermentation medium (as shown in Table 4) and fermentation protocol (as shown in Table 5), with each strain being replicated three times. Among them, YPTyr-yedZ-05, YPTyr-yedZ-06, W3110-yedZ-05, and W3110-yedZ-06 were strains containing pET28a overexpression, requiring IPTG induction during fermentation. When the fermentation culture reached OD600 = 0.1, a final concentration of 0.1 mM IPTG was added to induce yedZ protein overexpression. After fermentation, the L-tyrosine content was detected by high-performance liquid chromatography (HPLC), and the results were the average of the three replicates, as shown in Table 6.

[0275] Table 4 L-Tyrosine Fermentation Medium

[0276] reagents Concentration (g / L) glucose 30 yeast powder 8 ammonium sulfate 6 Potassium dihydrogen phosphate 6 Magnesium sulfate heptahydrate 3 glutamic acid 2 Citric acid monohydrate 4 Methionine 0.5 Phenylalanine 0.8 Manganese sulfate monohydrate 20mg / L Ferrous sulfate heptahydrate 40mg / L VH 2mg / L VB1, 3, 5, 12 0.3 mg / L each MnSO4·H2O 3mg / L ZnSO4 4mg / L γ-aminobutyric acid 1g / L

[0277] Table 5 L-Tyrosine Fermentation Scheme

[0278]

[0279] Table 6. L-tyrosine production and significance analysis of the yedZ engineered strain.

[0280]

[0281]

[0282] The fermentation results above show that, for both the high-L-tyrosine-producing strain CGMCC No. 25231 and the model strain W3110, replacing alanine with valine at position 180 of the yedZ gene amino acid sequence contributes to increased L-tyrosine production. For high-L-tyrosine-producing strains, both the wild-type and mutant yedZ genes... A180V Overexpression of the gene helps increase L-tyrosine production, while knocking out the yedZ gene reduces L-tyrosine production.

[0283] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A protein, characterized in that, The protein is any one of the following: A1) A protein, wherein the protein is a mutant yedZ protein obtained by replacing the 180th alanine residue of the yedZ protein amino acid sequence with any of the following amino acid residues: The yedZ protein contains phenylalanine residues, leucine residues, isoleucine residues, methionine residues, valine residues, or tryptophan residues; the yedZ protein is a protein with the amino acid sequence of sequence 2. A2) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) to regulate the production of L-tyrosine in E. coli.

2. A biomaterial, characterized in that, The biomaterial is any one of the following: B1) A nucleic acid molecule encoding the protein of claim 1; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant Escherichia coli containing the nucleic acid molecule described in B1), or recombinant Escherichia coli containing the expression cassette described in B2), or recombinant Escherichia coli containing the recombinant vector described in B3).

3. The biomaterial as described in claim 2, characterized in that, B1) The nucleic acid molecule is any one of the following: The coding sequence of Z1 is the DNA molecule shown in SEQ ID No. 5; Z2) is a DNA molecule obtained by replacing the guanine deoxyribonucleotide at position 538 of SEQ ID No. 1 with thymine deoxyribonucleotide, the cytosine deoxyribonucleotide at position 539 with guanine deoxyribonucleotide, and the thymine deoxyribonucleotide at position 540 with guanine deoxyribonucleotide. Z3) The coding sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide at position 538 of SEQ ID No. 1 with thymine deoxyribonucleotide and the cytosine deoxyribonucleotide at position 539 with thymine deoxyribonucleotide. The Z4) coding sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide at position 538 of SEQ ID No. 1 with cytosine deoxyribonucleotide and the cytosine deoxyribonucleotide at position 539 with thymine deoxyribonucleotide. The Z5 coding sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide at position 538 of SEQ ID No. 1 with adenine deoxyribonucleotide and the cytosine deoxyribonucleotide at position 539 with thymine deoxyribonucleotide. The Z6 coding sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide at position 538 of SEQ ID No. 1 with adenine deoxyribonucleotide, the cytosine deoxyribonucleotide at position 539 with thymine deoxyribonucleotide, and the thymine deoxyribonucleotide at position 540 with guanine deoxyribonucleotide.

4. The biomaterial as described in claim 2, characterized in that, B1) The nucleic acid molecule is any one of the following: The nucleotide sequence of Z9 is the DNA molecule shown in SEQ ID No. 5; The Z10 nucleotide sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide at position 538 of SEQ ID No. 1 with thymine deoxyribonucleotide, the cytosine deoxyribonucleotide at position 539 with guanine deoxyribonucleotide, and the thymine deoxyribonucleotide at position 540 with guanine deoxyribonucleotide. The Z11 nucleotide sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide at position 538 of SEQ ID No. 1 with thymine deoxyribonucleotide and the cytosine deoxyribonucleotide at position 539 with thymine deoxyribonucleotide. The Z12 nucleotide sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide at position 538 of SEQ ID No. 1 with cytosine deoxyribonucleotide and the cytosine deoxyribonucleotide at position 539 with thymine deoxyribonucleotide. The Z13 nucleotide sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide at position 538 of SEQ ID No. 1 with adenine deoxyribonucleotide and the cytosine deoxyribonucleotide at position 539 with thymine deoxyribonucleotide. The Z14 nucleotide sequence is a DNA molecule obtained by replacing the guanine deoxyribonucleotide at position 538 of SEQ ID No. 1 with adenine deoxyribonucleotide, the cytosine deoxyribonucleotide at position 539 with thymine deoxyribonucleotide, and the thymine deoxyribonucleotide at position 540 with guanine deoxyribonucleotide.

5. The use of any of the following materials in increasing the L-tyrosine production of Escherichia coli or in the preparation of products that increase the L-tyrosine production of Escherichia coli: C1) Protein, wherein the protein is the protein according to claim 1; C2) A substance that enhances the expression of the gene encoding the protein described in C1); The substance that enhances the expression of the gene encoding the protein described in C1) is any one of the following: D1) A nucleic acid molecule encoding the protein of claim 1; D2), an expression cassette containing the nucleic acid molecules described in D1); D3), ​​a recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2).

6. A method for increasing the production of L-tyrosine by *Escherichia coli*, characterized in that, The method includes increasing the L-tyrosine production of *E. coli* by increasing the expression of the gene encoding the protein of claim 1 in the target *E. coli*.

7. A method for constructing recombinant Escherichia coli, the method comprising increasing the expression of the gene encoding the protein of claim 1 in a target Escherichia coli to obtain recombinant Escherichia coli with altered amino acid yields, wherein the L-tyrosine yield of the recombinant Escherichia coli is higher than that of the target Escherichia coli.

8. The method as described in claim 6 or 7, characterized in that, The enhancement of the expression of the protein-coding gene of claim 1 in the target Escherichia coli is achieved by introducing the expression cassette of the protein-coding gene of claim 1 into the target Escherichia coli.

9. A method for increasing the production of L-tyrosine by *Escherichia coli*, characterized in that, The method is achieved by mutating the gene encoding the yedZ protein in the genome of the target Escherichia coli. The mutation is to change the codon at position 180 (alanine) of the amino acid sequence of the yedZ protein to the codon for valine. The yedZ protein is a protein whose amino acid sequence is sequence 2.

10. A method for constructing recombinant Escherichia coli, the method being achieved by mutating the gene encoding the yedZ protein in the genome of the target Escherichia coli, wherein the mutation is to mutate the codon of alanine at position 180 of the amino acid sequence of the yedZ protein to the codon of valine; wherein the yedZ protein is a protein whose amino acid sequence is sequence 2.