Edible fungus anti-mite agglutinin protein PoLec2, and coding gene and application thereof

By introducing the anti-mite lectin protein PoLec2 and its encoding gene into edible fungi, the insecticidal activity of the protein is utilized to enhance the mite resistance of edible fungi, thus solving the problem of controlling Tyromitra saprophytica and achieving a green and efficient mite control effect.

CN115850411BActive Publication Date: 2026-07-21JIANGSU ACAD OF AGRI SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JIANGSU ACAD OF AGRI SCI
Filing Date
2022-11-07
Publication Date
2026-07-21

Smart Images

  • Figure CN115850411B_ABST
    Figure CN115850411B_ABST
Patent Text Reader

Abstract

The present application relates to edible mushroom pest control technical field, especially a kind of edible mushroom anti-mite agglutinin protein PoLec2 and its coding gene and application, the protein is any one in the following A1, A2 or A3: A1) the protein with the amino acid sequence as shown in SEQ ID NO:1;A2) the amino acid sequence as shown in SEQ ID NO:1 is substituted and / or deleted and / or added by one or several amino acid residues, and the protein with same function;A3) the fusion protein obtained by connecting label at the N terminal of A1 or A2 or / and C terminal.The edible mushroom insect resistance related protein PoLec2 and its coding gene of the present application can be used to regulate the insect resistance of edible mushroom, edible mushroom variety breeding and genetic improvement.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of pest control technology for edible fungi, specifically to an anti-mite lectin protein PoLec2 from edible fungi, its encoding gene, and its applications. Background Technology

[0002] Edible fungi refer to large, edible fungi that are visible to the naked eye and whose fruiting bodies are easily accessible by hand. As a high-quality food, edible fungi have gradually gained popularity and become a common sight on dining tables. With increasing consumer demand, China's edible fungi industry has experienced rapid development, with the number of cultivated varieties increasing daily. It has evolved from a few traditional major varieties such as oyster mushrooms, shiitake mushrooms, and black fungus to more than 30 species. Spawn production technology, cultivation management techniques, and equipment have also undergone a qualitative leap. The total output and value of edible fungi in China have risen sharply, accounting for more than 75% of the global total, becoming an important tool for promoting farmers' income, rural prosperity, and the adjustment of agricultural industrial structure.

[0003] The carrion mite is a significant pest of edible fungi. Its tiny size allows it to easily spread through ventilation systems; its semi-transparent body makes it extremely difficult to detect in the early stages of infestation, especially in shaded mushroom cultivation. It feeds on substrate and mycelium, reproduces at an alarming rate, and large-scale outbreaks can lead to a sharp decline in mushroom yields or even total crop failure. Furthermore, this mite hides in the substrate and exhibits high resistance to common chemical pesticides, often requiring multiple applications of high-dose pesticides to eradicate it, seriously impacting production and food safety.

[0004] Breeding disease- and pest-resistant edible fungi varieties is widely recognized as the most economical and effective method for pest control. Therefore, researching and utilizing the genes of edible fungi resistant to Tyromitra saprophyta, and modifying edible fungi through genetic engineering to give them their own resistance to pests, is a more efficient, green, and safe way to fundamentally solve pest problems.

[0005] Edible fungi have evolved various defense strategies to compete for nutrients with other microorganisms and protect themselves from predation by animals. Similar to plants, the primary defense strategy of edible fungi is chemical defense, which involves producing substances that impair the development, growth, or reproduction of predators. These defensive effects include proteins and secondary metabolites with insecticidal, antifeedant, or repellent properties. Insecticidal toxins include lectins, α-matoxins, and hemolysins (such as aegerolysins and pleurotolysins). Although these toxins are widely distributed throughout the fungal kingdom and have been reported to kill nematodes and mosquitoes, similar insecticidal lectin proteins have not yet been found in oyster mushrooms. Summary of the Invention

[0006] The purpose of this invention is to provide an anti-mite lectin protein PoLec2 from edible fungi, its encoding gene, and its applications. The inventors discovered through research that oyster mushrooms possess an anti-mite lectin protein, PoLec2, which has potential application value in the control of pests in edible fungi.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] An edible fungus anti-mite lectin protein, PoLec2, is any one of the following: A1, A2, or A3:

[0009] A1) A protein with the amino acid sequence shown in SEQ ID NO: 1;

[0010] A2) A protein having the same function as the amino acid sequence shown in SEQ ID NO: 1, by substitution and / or deletion and / or addition of one or more amino acid residues.

[0011] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1 or A2.

[0012] The tags include any one of Poly-Arg, His, HA, FLAG-tag, AviTag, Strep-tag II, and c-Myc.

[0013] Wherein, the amino acid sequence of the protein A2 has ≥75% identity with the amino acid sequence of the protein shown in SEQ ID NO: 1. Specifically, it can be 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

[0014] The protein of A2 can be obtained by artificial synthesis or by first synthesizing its encoding gene and then expressing it heterologously.

[0015] The gene encoding a fungal anti-mite lectin protein PoLec2 has the sequence shown in SEQ ID NO: 2; or, the gene can be obtained by deleting one or more amino acid residues from the DNA sequence shown in SEQ ID NO: 2, and / or by performing a missense mutation on one or more base pairs, and / or by attaching a tag encoding sequence to its 5′ end and / or 3′ end.

[0016] The tags include any one of Poly-Arg, His, HA, FLAG-tag, AviTag, Strep-tag II, and c-Myc, and their sequences are shown in the table below.

[0017]

[0018]

[0019] The encoding gene of the edible fungus anti-mite lectin protein PoLec2 described in this invention can be used in the preparation of recombinant vectors, gene expression cassettes, recombinant microorganisms, transgenic edible fungus cells, and transgenic edible fungus tissues containing the encoding gene. Specifically, it may include the application of any of the following biomaterials:

[0020] 1) Nucleic acid molecules encoding PoLec2;

[0021] 2) Recombinant vectors containing the above-mentioned nucleic acid molecules;

[0022] 3) Expression cassettes containing the above-mentioned nucleic acid molecules

[0023] 4) Recombinant microorganisms containing the above-mentioned nucleic acid molecules;

[0024] 5) Transgenic edible fungi cells containing the above-mentioned nucleic acid molecules;

[0025] 6) Transgenic edible fungi cells containing the above expression cassettes;

[0026] 7) Transgenic edible fungi cells containing the above-mentioned recombinant vector;

[0027] 8) Transgenic edible fungi tissues containing the above-mentioned nucleic acid molecules;

[0028] 9) Transgenic edible fungi tissues containing the above expression cassettes;

[0029] 10) Transgenic edible fungi tissues containing the above-mentioned recombinant vectors;

[0030] In the above applications, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0031] Those skilled in the art can use known methods, such as directed evolution and point mutation, to mutate the nucleotide sequence encoding the PoLec2 protein of this invention. Any artificially modified nucleotides that have 75% or higher identity with the nucleotide sequence of the PoLec2 protein isolated according to this invention, as long as they encode and function the PoLec2 protein, are derived from and equivalent to the nucleotide sequence of this invention.

[0032] "Identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of SEQ ID NO:2 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0033] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0034] In the above applications, the expression cassette (PoLec2 gene expression cassette) containing a nucleic acid molecule encoding the PoLec2 protein refers to DNA capable of expressing the PoLec2 protein in a host cell. This DNA may include not only a promoter that initiates the transcription of the PoLec2 gene, but also a terminator that terminates the transcription of the PoLec2 gene.

[0035] Furthermore, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to, constitutive promoters, tissue- and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to, T7, gpdA, tub, act, cbh1, glaA, etc.

[0036] Recombinant vectors containing the PoLec2 gene expression cassette can be constructed using existing expression vectors. These edible fungi expression vectors include Agrobacterium tumefaciens vectors and vectors suitable for particle bombardment, polyethylene glycol (PEG)-mediated, liposome-mediated, electrostimulation, and microinjection methods. Examples include pET-28a, pET-28b, pCAMBIA1303, pEGFP-N1, pSilent-1, pCT74, pBARGPE1, pCAMBIA1302, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb.

[0037] The edible fungus expression vector may also contain the 3' untranslated region of the exogenous gene, i.e., containing the polyadenylated signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated DNA to the 3' end of the mRNA precursor. When constructing the edible fungus expression vector using the gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, may also be used. These enhancer regions may be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signal and start codon are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic edible fungi cells or tissues, the expression vectors used can be processed. For example, genes encoding enzymes that produce color changes or luminescent compounds (such as GUS genes and luciferase genes) or antibiotic marker genes can be added. These marker genes include nptII genes conferring resistance to kanamycin and related antibiotics, hph genes conferring resistance to hygromycin, and mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose. From a safety perspective, no selective marker genes may be added, and transformed strains can be directly screened under stress.

[0038] In the above applications, the vector can be a plasmid, granule, bacteriophage, or viral vector. The plasmid can be the pCAMBIA1303 vector.

[0039] Furthermore, the recombinant vector may be pCAMBIA1303-PoLec2. pCAMBIA1303-PoLec2 can express the PoLec2 protein shown in SEQ ID No:1, and the expression of this protein is driven by the constitutive promoter gpdA of *Aspergillus nidulans*. pCAMBIA1303-PoLec2 is a recombinant vector obtained by inserting the DNA fragment shown in SEQ ID No:2 into the multiple cloning site of the pCAMBIA1303 vector.

[0040] Furthermore, the pCAMBIA1303-PoLec2 is specifically a recombinant vector obtained by replacing the small fragment between the NcoI and BstEII recognition sequences of the pCAMBIA1303 vector with the DNA fragment shown in sequence 2 of the sequence listing.

[0041] In the above applications, the microorganisms can be yeast, bacteria, algae, or fungi. Bacteria can be from genera such as *Escherichia*, *Erwinia*, *Agrobacterium* (e.g., GV3101), *Flavobacterium*, *Alcaligenes*, *Pseudomonas*, and *Bacillus*. Fungi can be from genera such as *Schizosaccharomyces*, *Saccharomyces*, and *Pichia*.

[0042] The edible fungi may be edible fungi under the Basidiomycota or large edible or medicinal fungi under the Ascomycota.

[0043] Increasing the content of PoLec2 in recipient edible fungi can be achieved by introducing the nucleic acid molecule B1 into the recipient edible fungi.

[0044] In the above method, the gene encoding PoLec2 can be modified as follows before being introduced into the recipient edible fungi to achieve better expression:

[0045] 1) Modify and optimize according to actual needs to enable efficient gene expression; for example, the codons of the PoLec2 coding gene described in this invention can be changed to conform to the preferences of edible fungi, while maintaining the amino acid sequence of the gene. During the optimization process, it is best to maintain a certain GC content in the optimized coding sequence to achieve the best high-level expression of the introduced gene in edible fungi. The GC content can be 35%, more than 45%, more than 50%, or more than about 60%.

[0046] 2) Modify the gene sequence adjacent to the initiation methionine to enable efficient translation initiation; for example, use a sequence known to be effective in edible fungi for modification;

[0047] 3) Linked to promoters of various edible fungi to facilitate their expression in edible fungi; the promoters may include constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-selective, and tissue-specific promoters; the selection of promoters will vary with the time and space requirements of expression, and also depends on the target species; for example, tissue or organ-specific expression promoters, depending on the stage of the recipient's development; although it has been shown that many promoters derived from Ascomycetes are functional in Basidiomycetes and vice versa, ideally, promoters from Ascomycetes are selected for expression in Ascomycetes, and promoters from Basidiomycetes are selected for expression in Basidiomycetes.

[0048] 4) Connecting the gene to a suitable transcription terminator can also improve the expression efficiency of the gene in this invention;

[0049] The gene encoding PoLec2 can be introduced into recipient edible fungi using a recombinant expression vector containing the gene encoding PoLec2. Specifically, the recombinant expression vector can be pCAMBIA1303-PoLec2.

[0050] The term "target edible fungus" should be understood to include not only first-generation edible fungi in which the PoLec2 protein or its encoding gene has been altered, but also its tissue isolates and progeny. For the target edible fungus, the gene can be propagated within the species, or it can be transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. The target edible fungus includes isolated tissues, basidiospores, complete strains, and cells.

[0051] In the above method, the recipient edible fungus can be an edible fungus under the Basidiomycota phylum or a macrofungus under the Ascomycota phylum that is edible or medicinal;

[0052] The gene encoding the edible fungus anti-mite lectin protein PoLec2 or the edible fungus anti-mite lectin protein PoLec2 described in this invention can be used to regulate the insect resistance of edible fungi, breed selection and genetic improvement of edible fungi, and may specifically include any of the following applications:

[0053] 1) Regulating the insect resistance of edible fungi;

[0054] 2) Preparation of products that regulate the insect resistance of edible fungi: including PoLec2 or the above-mentioned biomaterials of this invention;

[0055] 3) Cultivate susceptible and insect-resistant edible fungi;

[0056] 4) Prepare and cultivate susceptible and insect-resistant edible fungi products;

[0057] 5) Cultivating edible fungi with increased or decreased lectin content;

[0058] 6) Prepare edible fungi products with increased or decreased lectin content;

[0059] The product for regulating the insect resistance of edible fungi can use PoLec2 or the above-mentioned biological materials as its active ingredients, or it can combine PoLec2 or the above-mentioned biological materials with substances having the same function as its active ingredients.

[0060] Compared with the prior art, the beneficial effects of the present invention are:

[0061] (1) The lectin PoLec2 gene identified in this invention can regulate the mite resistance of oyster mushrooms; introducing the mite-resistant PoLec2 lectin protein into oyster mushrooms can improve the mite resistance of susceptible varieties.

[0062] (2) The insect resistance-related protein PoLec2 and its encoding gene of the present invention can regulate the insect resistance of edible fungi; introducing the encoding gene of the insect resistance-related protein of edible fungi into edible fungi can increase the insect resistance of edible fungi.

[0063] (3) The insect resistance-related protein PoLec2 of edible fungi and its encoding gene of the present invention can be applied to the breeding and genetic improvement of edible fungi varieties. Attached Figure Description

[0064] Figure 1 Detection of relative expression levels of pCAMBIA1303-PoLec2-transformed wild-type strain 389;

[0065] Figure 2 The population changes of *Typhonium saprophyticum* after 21 days of rearing in positive transgenic strains and wild-type strains;

[0066] Figure 3 Anti-mite identification of positive transgenic strains. Detailed Implementation

[0067] The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention.

[0068] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials, reagents, and instruments used in the following examples are commercially available.

[0069] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.

[0070] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.

[0071] Oyster mushroom strains 389 and 45 are available to the public from the Vegetable Research Institute of Jiangsu Academy of Agricultural Sciences.

[0072] Example 1: Application of PoLec2 protein and its encoding gene in regulating insect resistance in oyster mushrooms

[0073] This embodiment provides a lectin protein derived from anti-mite strain-45, named PoLec2, and the amino acid sequence of PoLec2 in the lectin is shown in SEQ ID No:1.

[0074] I. Cloning of the full-length cDNA sequence of PoLec2

[0075] The genome of Pleurotus ostreatus 389 (PRJNA327267) was analyzed using the UniLectin online lectin gene prediction software (https: / / www.unilectin.eu / mycolec / ), and more than 10 genes were predicted. Based on the structural characteristics of β-sandwich insecticidal lectins reported by Bleuler-Martinez et al. (Bleuler-Martinez, S. et al. Structure-function relationship of a novel fucoside-binding fruiting body lectin from Coprinopsis cinerea exhibiting nematotoxic activity. Glycobiology, 2022, 32, 600-615; Pohleven, J. et al. Basidiomycete Clitocybe nebularis is rich in lectins with insecticidal activities. Appl Microbiol Biotechnol 2011, 91, 1141-1148), other predicted candidate genes were eliminated, and the remaining protein sequence was listed as a candidate gene for resistance to nematotoxic mites in Pleurotus ostreatus, tentatively named "PoLec2".

[0076] Based on the results of genomic and bioinformatics analysis, a pair of primers (SEQ ID No: 9-10) were designed, lec2F: 5'ATGCATGACATTAGTACTTAT 3' and lec2R: 5'CTATGCGAGAGGGATGACTAC 3', to clone and obtain the full-length cDNA sequence of Pleurotus ostreatus strain 45, which is resistant to Tyrofoam. After sequencing to verify the accuracy of the sequence, the next step of the experiment was carried out.

[0077] II. Construction of the Recombinant Carrier

[0078] The small fragment between the NcoI and BstEII recognition sequences of the pCAMBIA1303 vector was cloned using the seamless cloning kit from Qingke Biotechnology. SoSoo Cloning Kit Ver.2 was used to replace lecF:5'ccgcttgagcagacatcaccATGCATGACATTAGTACTTAT 3' and lecR:5'aattcgagctggtcaccaatCTACGCGAGCGGGATCACCG3', as shown in SEQ ID No: 3-4. The resulting cDNA molecules were amplified to obtain the recombinant vector. The recombinant vector with the correct sequence was designated as pCAMBIA1303-PoLec2.

[0079] pCAMBIA1303-PoLec2 contains the DNA fragment shown in SEQ ID No: 2 and the constitutive promoter gpdA of Aspergillus nidulans, and can express the PoLec2 protein shown in SEQ ID No: 1. The expression of this protein is driven by the constitutive promoter gpdA of Aspergillus nidulans.

[0080] III. Construction and Identification of PoLec2 Gene-Transgenic Oyster Mushrooms

[0081] After pCAMBIA1303-PoLec2 was transformed into Escherichia coli DH5α, plasmids were prepared and preserved. The plasmids were then transformed into Agrobacterium GV3101 and transformed into Pleurotus ostreatus 389 mycelium via Agrobacterium-mediated transformation.

[0082] Mycelial transformation:

[0083] (1) Inoculate the oyster mushroom blocks into PDA medium and incubate at 28°C for 5 days;

[0084] (2) Punch holes with a 5mm punch, and inoculate every two plates of mycelium into 100ml of CYM liquid medium. Incubate at 28℃ in the dark for 2 days.

[0085] (3) Agrobacterium carrying the target plasmid was streaked on LB solid medium containing antibiotics (Rif and Kan) and incubated upside down at 28°C for two days;

[0086] (4) Pick a single colony and inoculate it into 10 ml of LB liquid medium containing antibiotics (Rif and Kan), and culture at 28°C and 180 rpm for 2 days;

[0087] (5) Take 0.7 mL of the above bacterial culture into 100 mL of LB liquid medium containing antibiotics (Rif and Kan) and culture at 28 °C and 180 rpm for 18 h with shaking.

[0088] (6) Collect the bacterial cells by centrifugation at 4500 rpm and 4℃ for 15 min, resuspend the bacterial cells in 12 ml IM medium in an Erlenmeyer flask, and induce culture at 28℃ and 90 rpm in the dark for 5 h.

[0089] (7) Rinse the Pleurotus ostreatus blocks in CYM liquid medium with sterile water, pour them into Agrobacterium tumefaciens solution after induction culture, and incubate at 28°C for 5 hours.

[0090] (8) Take the co-cultured bacterial block and pour it into a 50ml centrifuge tube. Remove the IM medium and transfer the bacterial block to an IM plate lined with cellophane. Incubate at 28℃ for 3-5 days. Then transfer the cellophane along with the bacterial block to CYM solid medium (containing 90μg / mL Hyg and 300μg / mL Cef). Incubate for about 20 days. The growth of resistant mycelia can be seen.

[0091] (9) Transfer the above hyphae to a new solid CYM medium (containing 90 μg / mL Hyg), and transfer the hyphae that can continue to grow to PDA medium for culture, for DNA extraction and detection of the expression level of the target gene.

[0092] Transformant gDNA extraction was performed according to the kit instructions. Primers were designed based on the hygromycin sequence on the overexpression plasmid for PCR verification. The primer sequences (SEQ ID No: 5-6) are as follows:

[0093] Hyg-F CGACAGATCCGGTCGGCATCTACTCTATTTCTT(5'-3')

[0094] Hyg-R TCTCGTGCTTTCAGCTTCGATGTAGGAGGG(5'-3')

[0095] The PCR verification primers for the PoLec2 gene (SEQ ID No:7-8) are as follows:

[0096] PoLec2-Q1F GAGCACCGACACCTTCATCA(5'-3')

[0097] PoLec2-Q1R AATCCCCACTTGCTGTCGTC(5'-3')

[0098] The β-actin gene was selected as the internal reference gene.

[0099] The RT-PCR procedure is as follows:

[0100] Pre-denaturation at 95℃ for 2 min, followed by 30 cycles of (denaturation at 95℃ for 10 s, annealing at 58℃ for 30 s, and extension at 72℃ for 30 s). Melting curves were generated by reading the plate every 2.2℃ / s from 60℃ to 95℃.

[0101] The PCR products were subjected to agarose gel electrophoresis. Positive transformants were initially screened by comparing the results with the amplification results of the corresponding plasmids. The amplified products were then sequenced for verification.

[0102] The results of the relative expression level detection of positive strains are as follows: Figure 1 As shown.

[0103] IV. Identification of the insecticidal effect of PoLec2 overexpression

[0104] Tested strains: strain 389 (wild type, WT), T5 generation positive transgenic strains of PoLec2 gene (L1, L6).

[0105] 1. Effects of positive transgenic strains on mite growth, development, and population growth

[0106] The wheat grains of the above-mentioned test strains were placed in 25 mL culture flasks, with 0.3 g in each flask. Each strain constituted one experimental group, and each group was replicated five times. Before starting, adult Tyrofoetida mites were rinsed through a 100-mesh standard sieve and placed in new culture flasks for oviposition at 26°C and 80% RH for 24 hours. Subsequently, one-day-old mite eggs were collected using a No. 0 brush and placed on the wheat grains in the culture flasks under a microscope. Thirty eggs of the same age were collected in each culture flask and cultured at 26°C and 80% RH. The hatching status of eggs and the number of mites at each developmental stage in all culture flasks were recorded in detail daily under a microscope for 21 days. The records of dead immature and mature individuals were used to calculate the mortality rate.

[0107] 2. Evaluation of the resistance of positive transgenic strain mycelium to Tyromitra saprophytica.

[0108] The test strain was inoculated into a 6-plate bacterial culture dish and allowed to grow fully before use. Mites were collected and starved for 24 hours. Approximately 1500 mites were placed in the dish, which was then sealed with a lid and sealed with sealing film. After feeding for 48 hours, the degree of damage was observed, and the mites' resistance was analyzed and statistically determined.

[0109] The results are shown in Table 1. Figure 2 and Figure 3 As shown. The results indicate that, compared with the wild type, the population growth of *Typhonium saprophyticum* on positive transgenic strains of the PoLec2 gene was significantly reduced (e.g., ...). Figure 2 As shown), and the insect resistance of positive transgenic strains is enhanced (e.g. Figure 3 As shown, the expression of PoLec2 increased from high susceptibility to high resistance, indicating that, in practice, overexpression of PoLec2 also endowed oyster mushrooms with insect resistance.

[0110] Table 1. Developmental stages of *Tyromitra saprophytica* in positive transgenic strains and wild-type strains.

[0111]

[0112]

[0113] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A fungal anti-mite lectin protein, PoLec2, characterized in that, The protein has the amino acid sequence shown in SEQ ID NO:

1.

2. A gene encoding a fungal anti-mite lectin protein, PoLec2, characterized in that: Its sequence is shown in SEQ ID NO:

2.

3. A recombinant expression vector or expression cassette containing the encoding gene for the edible fungus anti-mite lectin protein PoLec2 as described in claim 2.

4. The use of the recombinant expression vector or expression cassette according to claim 3 in constructing transgenic oyster mushroom cells or tissues.

5. A recombinant microorganism containing the encoding gene for the edible fungus anti-mite lectin protein PoLec2 as described in claim 2.

6. The application of the gene encoding the edible fungus anti-mite lectin protein PoLec2 as described in claim 1 or the edible fungus anti-mite lectin protein PoLec2 as described in claim 2 in regulating the insect resistance of oyster mushrooms to Tyromitra esculenta, and in the breeding and genetic improvement of oyster mushroom varieties resistant to Tyromitra esculenta.