Banana fusarium wilt gene knockout mutant back complementation vector constructed by in vitro recombination technology and application thereof

Abstract

The application discloses a banana fusarium wilt gene knockout mutant back-donation vector constructed by using an in-vitro recombination technology and application thereof, and the construction steps of the back-donation vector are as follows: 1) replacing resistance genes on an initial vector with HYG resistance genes or NEO resistance genes respectively to construct an intermediate vector; 2) amplifying a ptef1 promoter sequence, a 3GFP sequence and a terminator sequence; and 3) after double enzyme digestion of the intermediate vector into a linearized vector, in-vitro recombination is carried out on the linearized vector, the ptef1 promoter sequence, the 3GFP sequence and the terminator sequence to construct the back-donation vector. The back-donation vector constructed by the application does not need in-vivo recombination transformation of yeast, avoids the cumbersome in-vivo recombination step of yeast, is simple to operate and reduces time. The back-donation vector is higher in gene expression, the back-donation strain can express a more intense fluorescent signal, and is more favorable for subcellular localization observation.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a method for constructing a complementation vector for a gene knockout mutant of Fusarium wilt of banana using in vitro recombination technology and its application. Background Technology

[0002] Banana wilt is a devastating soil-borne disease that damages the vascular bundles of banana plants, leading to plant death. The pathogen is *Fusarium oxysporum* f. sp. cubense (Foc), with race 4 (Foc4) being the most virulent. Its pathogenic mechanism and control measures are crucial issues for the banana industry. Therefore, studying the pathogenic mechanism of Foc4 is an important research topic in tropical regions, primarily using reverse genetics for gene function analysis. Gene knockout and complementation techniques in filamentous fungi are important approaches to gene function research. Constructing complementation vectors using recombination technology to obtain complementation transformants is one feasible method for studying the gene function of filamentous fungi.

[0003] Several key issues were identified during the construction of the complementation vector for the Foc4 gene knockout mutant of banana:

[0004] (1) Most gene knockout mutants of filamentous fungi are replaced by yeast gene replacement vectors, but the recombination process in yeast is complicated.

[0005] (2) Currently, the most commonly used screening resistance gene for constructing gene knockout mutant complementation vectors for filamentous fungi is the bleomycin resistance gene. However, we have found that knockout mutants carrying HYG or NEO selection marker genes exhibit certain cross-resistance to bleomycin, interfering with subsequent complementation transformant screening. This makes the broad-spectrum selection marker bleomycin resistance gene unsuitable for use in Fusarium wilt gene knockout complementation vectors. Therefore, it is necessary to select other resistance genes to construct new Fusarium wilt gene knockout mutant complementation vectors.

[0006] (3) There are currently few promoters that can be used for labeling filamentous fungi, and the initiation effect of promoters on the expression of green fluorescent protein gene in the genetic transformation of Fusarium wilt may be affected by the growth stage of the strain. Therefore, it is necessary to find promoters that can enable efficient expression of green fluorescent protein and are not affected by the Foc4 growth period.

[0007] (4) The expression levels of some functional genes knocked out by Foc4 are not high. Using the Native promoter, the C-terminal eGFP fluorescence signal fused in the transformant is too weak, which makes subcellular localization difficult. Summary of the Invention

[0008] In view of the shortcomings of the prior art, the present invention provides a vector for constructing a gene knockout mutant of Fusarium wilt of banana using in vitro recombination technology and its application.

[0009] The present invention includes:

[0010] The complementation vector for the gene knockout mutant of Fusarium wilt of banana, constructed using in vitro recombination technology, includes the following construction steps:

[0011] (1) Replace the resistance gene on the initial vector with the HYG resistance gene or the NEO resistance gene to construct the intermediate vector pCTZN-HYG or pCTZN-NEO;

[0012] (2) Amplify the ptef1 promoter sequence, 3GFP sequence and terminator sequence respectively;

[0013] (3) After the intermediate vector pCTZN-HYG or pCTZN-NEO is double-digested into a linearized vector, it is recombined in vitro with the ptef1 promoter sequence, 3GFP sequence and terminator sequence to construct the complement vector pCTHyg1 or pCTNeo1.

[0014] Further, step (1) is as follows: after the initial vector is linearized by double digestion with Nco I / Hind III, it is subjected to in vitro recombination reaction with the HYG resistance gene or the NEO resistance gene amplification fragment to obtain the intermediate vector pCTZN-HYG or pCTZN-NEO.

[0015] Furthermore, the initial vector is a pCTZN vector; the pCTZN vector is obtained by replacing the fluorescent protein gene on the pCT74 plasmid with the bleomycin resistance gene and removing the hygromycin resistance gene.

[0016] Furthermore, the 3GFP consists of: inserting a homologous arm sequence before the first GFP; adding a linker sequence between each GFP; and also introducing a linker sequence between the third GFP and the terminator.

[0017] Furthermore, the homologous arm sequence is: GAATTC CCTGCACTTGCCAACCTTAAT; the linker sequence between the first GFP and the second GFP is: GACTACAAGGACGAC; the linker sequence between the second GFP and the third GFP is: AGCGCTGGCGCTTAC; and the linker sequence between the third GFP and the terminator is: GAGCTCGGTCTCAGCAGACCACAAGTCAAGCTTTAA.

[0018] Furthermore, the 3GFP sequence is shown in SEQ ID NO:2.

[0019] Furthermore, the in vitro recombination reaction is carried out at 50°C for 15 min.

[0020] Furthermore, the double digestion in step (3) is EcoRI / SpeI double digestion.

[0021] This invention also relates to the application of Fusarium wilt gene knockout mutant complementation vectors in the functional identification of Fusarium wilt genes. The gene includes the Fusarium wilt FCC1 gene.

[0022] Compared with the prior art, the beneficial effects of the present invention are:

[0023] The in vitro recombinant vector constructed in this invention eliminates the need for in vivo yeast recombination transformation, avoiding the cumbersome steps of in vivo yeast recombination. The complement sequence is directly introduced into the resistance selection vector under the catalysis of in vitro recombinase, completing the complement vector construction. This simplifies the operation and reduces time. Furthermore, the gene complement vector constructed in this invention is approximately 8 kb in size, significantly smaller than the yeast complement vector. The in vitro recombination technology used is mature and reliable, with high transformation efficiency, and has broader application prospects in filamentous fungi.

[0024] The complementation vectors pCTHyg1 and pCTNeo1 constructed in this invention use HYG or NEO resistance to replace the bleomycin resistance gene Zeocin to screen and identify complementation transformants, which is more consistent with the actual situation of Fusarium wilt of banana. Through promoter screening and identification, it was determined that the Ptef1 promoter expression is more stable. The constructed complementation vectors adopt an optional promoter strategy, that is, the native promoter or the constitutive Ptef1 promoter can be selected to start the expression of the target gene. Combined with the C-terminal fusion 3GFP expression method, subcellular localization observation of complementation strains with better phenotypes can be obtained. Especially for genes with low abundance expression, the use of constitutive promoters is more conducive to subcellular localization observation. Attached Figure Description

[0025] Figure 1 Colony phenotypes of five bacterial strains were observed after 7 days of growth on PSB plates containing different concentrations of bleomycin.

[0026] Figure 2 Observation of fluorescence expression in conidia and hyphae after eGFP expression was initiated by different promoters.

[0027] Figure 3 : Schematic diagram of the pCTZN vector, which was kindly provided by Professor Li Yunfeng of South China Agricultural University.

[0028] Figure 4 Schematic diagram of the process of constructing the complementation vector for the banana wilt gene knockout mutant. Figure 4-1, Figure 4-2 , Figure 4-3 for Figure 4 A magnified view of a portion of the image. In the image, A: a schematic diagram of the pCT74 plasmid; B: the vector pCTZN, which is derived from the pCT74 plasmid by replacing the GFP gene with a bleomycin resistance gene and removing the hygromycin resistance gene; C and D: the intermediate vectors pCTZN-HYG and pCTZN-NEO, respectively, were constructed by replacing the bleomycin resistance gene with the HYG and NEO resistance genes; E: pCTZN-HYG was constructed by in vitro recombination with ptef1, artificially synthesizing a 3GFP sequence, and then double-digesting the intermediate vector pCTZN-HYG with SpeI / EcoRI; F: pCTNeo1 was constructed by in vitro recombination with ptef1, artificially synthesizing a 3GFP sequence, and then double-digesting the intermediate vector pCTZN-NEO with SpeI / EcoRI.

[0029] Figure 5 : 3GFP synthesis diagram.

[0030] Figure 6 : A schematic diagram of the construction process from intermediate vector to final complement vector during the construction of the banana wilt disease gene complement vector (vector pCTHyg1). The gene complement vector pCTHyg1 carries two expression cassettes: ToxA-HYG-Nos terminator and Ptef1-3GFP-Nos terminator.

[0031] Figure 7 : A schematic diagram of the construction process from intermediate vector to final complementation vector during the construction of the banana wilt disease gene complementation vector (vector pCTNeo1). The gene complementation vector pCTNeo1 carries two expression cassettes: ToxA-NEO-Nos terminator and Ptef1-3GFP-Nos terminator.

[0032] Figure 8 Image of the complementation vector pCTZN-Ptef1-HYG-3GFP (pCTHyg1) carrying HYG resistance. The gene complementation vector pCTHyg1 carries two expression cassettes: ToxA-HYG-Nos terminator and Ptef1-3GFP-Nos terminator.

[0033] Figure 9 Image of the complementation vector pCTZN-Ptef1-NEO-3GFP (pCTNeo1) carrying NEO resistance. The gene complementation vector pCTNeo1 carries two expression cassettes: ToxA-NEO-Nos terminator and Ptef1-3GFP-Nos terminator.

[0034] Figure 10 : Complementary mutant Δfcc1 - PCR detection and identification of the Com / native promoter complemented mutant strain. Crossover indicates cross-detection analysis using primers M13F on the vector and inside-R primers of FCC1; Inside indicates detection of endogenous genes of FCC1; GFP indicates detection of eGFP fusion with FCC1; HYG indicates the HYG resistance gene of the vector.

[0035] Figure 11 : Complementary mutant Δfcc1 - PCR detection and identification of the Com / Ptef1 promoter complementation mutant strain. Crossover indicates cross-detection analysis using the Ptef1 promoter-specific primer 157F on the vector and the inside-R primer of FCC1. Inside indicates detection of endogenous FCC1 genes. GFP indicates detection of eGFP fusion with FCC1. HYG indicates the HYG resistance gene of the vector.

[0036] Figure 12 : Δfcc1 -Com fluorescence expression intensity was analyzed using the native promoter and the constitutive promoter Ptef1, respectively. Foc4 itself showed no fluorescence; Δfcc1 The -Com / native promoter complementation mutant strain expressed fluorescent signals in different developmental stages, including sporozoites and hyphae; similarly... Δfcc1 The -Com / Ptef1 promoter complementation mutant strain also expressed strong fluorescence at different developmental stages.

[0037] Figure 13 Different types of promoters use the native promoter and the constitutive promoter Ptef1, respectively. Δfcc1- Quantitative analysis of FCC1 expression in the Com complement strain. Results showed that... Δfcc1 -Com / native promoter complementation mutant FCC1 expression level was significantly weaker than Δfcc1 -Com / Ptef1 promoter. Detailed Implementation

[0038] To better understand the technical content of this invention, specific embodiments are provided below to further illustrate the invention.

[0039] Example 1: Screening for gene knockout complementation mutants of bleomycin resistance unsuitable for Fusarium wilt of banana

[0040] Currently, the most commonly used selection criterion for constructing gene knockout mutant complementation vectors from filamentous fungi is the bleomycin resistance gene (Zeocin), also known as the bleomycin-resistance gene (BleoR), such as the selection marker pYF11. In resistance selection experiments, it was found that Fusarium wilt of banana Foc4 itself is resistant to bleomycin (Bleomycin... R While the gene knockout mutation is highly sensitive, the presence of HYG or NEO in the mutant leads to cross-resistance to bleomycin, interfering with subsequent complementation transformant selection. Therefore, bleomycin resistance genes are unsuitable for Fusarium wilt gene knockout complementation vectors.

[0041] Using the Foc4 strain preserved in our laboratory (Foc4-CF2020, revitalized in 2020), the Guangzhou isolate Foc4-XJZ2, knockout mutants of two reporter genes FCC1 and carS, and a gene-edited mutant of carS, bleomycin (Invitrogen, Zeocin) was administered. TM Resistance analysis of bleomycin (cat. #R250-05) was performed. Fresh, stable Foc4 wild-type strains and transformant strains cultured for 3-5 days were selected. 5 mm mycelial discs were inoculated onto PSB plates resistant to bleomycin at concentrations of 0 μg / mL, 200 μg / mL, 400 μg / mL, and 600 μg / mL, respectively. After incubation at 28 ℃ for 7 days, colony diameters were measured and phenotypic images were taken. Three replicates were performed each time. Results are shown below. Figure 1 The results showed:

[0042] 1. Bleomycin has a good inhibitory effect on wild-type Foc4. A concentration of bleomycin (Zeocin) of 200 μg / mL can inhibit the growth of wild-type Foc4, and a concentration of 600 μg / mL can completely inhibit the growth of wild-type strains.

[0043] 2. Cross-resistance exists. In positive transformants after gene knockout, the resistance gene replaces the reporter gene position. Gene knockout transformants carrying hygromycin B and neomycin resistance genes could not completely inhibit the growth of the strain at concentrations from 200 μg / mL to 600 μg / mL. In addition, gene-edited transformants carrying neomycin resistance genes at non-reporter gene positions showed the same results as the knockout mutants, and bleomycin (Zeocin) concentrations up to 600 μg / mL could not completely inhibit the growth of the gene-edited strains.

[0044] Furthermore, to further verify the inhibitory effect of bleomycin (Zeocin) on Foc4, spore suspensions were spread onto PSB plates containing bleomycin, and the inhibitory effect of bleomycin on different strains was observed. The results were consistent with those of the PSB plate mycelium disc experiment above. In summary, whether inoculated onto resistance plates with mycelium discs or spread with spore suspensions, transformants carrying HYG or NEO resistance exhibited cross-resistance to bleomycin, and its growth could not be completely inhibited.

[0045] Example 2: Promoter Screening

[0046] This experiment evaluated and analyzed four fungal promoters. Each promoter was fused with eGFP and introduced into Foc4 via PEG-mediated transformation. Confocal microscopy analysis was used to analyze the distribution and intensity of GFP green fluorescence, combined with qPCR quantitative analysis, to screen for suitable promoters for Foc4. Promoters that ensure stable expression at different stages (spore, hyphae, etc.) and exhibit diffuse fluorescence signal distribution were selected to facilitate subsequent subcellular localization analysis of candidate genes.

[0047] These four promoters are ToxA promoters (fungi). Pyrenophora tritici-repentis ToxA promoter), glyceraldehyde 3-phosphate dehydrogenase gene PgpdA promoter (Glyceraldehyde 3-phosphate dehydrogenase, PgpdA promoter), eukaryotic translation elongation factor 1α promoter Ptef1 (Translation elongation factor EF-1alpha promoter, Ptef1 promoter), pyroxenia ribosomal protein RP27 promoter (… Magnaporthe oryzae (ribosomal protein 27 promoter, RP27 promoter).

[0048] See results Figure 2The results showed that the ToxA promoter generated the highest GFP expression level and the strongest fluorescence signal, exhibiting strong fluorescence in both hyphae and conidia. Other promoters tested showed significant differences in the expression level of the target gene at different fungal growth stages. The RP27 promoter generated strong fluorescence in hyphae, but weaker than the ToxA promoter. In conidia, it showed two bright spots with punctate fluorescence, also weaker than the ToxA promoter. The Ptef1 promoter, similar to the PR27 promoter, showed strong fluorescence at different hyphal stages and diffused fluorescence spots in conidia, but both were weaker than the ToxA promoter. The PgpdA promoter expressed GFP diffusely in conidia without obvious fluorescent spots. Furthermore, the fluorescence signal was very stable at different hyphal developmental stages, although weaker than the ToxA promoter.

[0049] Both Ptef1 and PgpdA meet the conditions for diffuse distribution of conditional fluorescence signals, but the PgpdA promoter contains a 116nt intron sequence and the sequence is relatively large; while the Ptef1 sequence is small and has no intron sequence. Therefore, we chose the Ptef1 promoter.

[0050] Example 3: Construction of the replenishment carrier

[0051] The first step is to replace the resistance gene.

[0052] 1) Primer design

[0053] HYG primer design:

[0054] HYG-Nos-terminator-Mlu I-SnaBI-F:

[0055] Ttgccaaatgtttgaacgatc ACGCGT TACGTACTATTCCTTTGCCCTCGGACG

[0056] HYG-ToxA-EcoRV-R:

[0057] gctgacaatgaatgaatataggcc GATATC ATGAAAAAGCCTGAACTCACC

[0058] NEO primer design:

[0059] NEO-Nos-terminator-MluI-SnaBI-F:

[0060] Ttgccaaatgtttgaacgatc ACGCGTTACGTATCAGAAGAACTCGTCAAGAAG

[0061] NEO-ToxA-EcoRV-R:

[0062] gctgacaatgaatgaatataggcc GATATC ATGATTGAACAAGATGGATTG

[0063] 2) Amplification template: rice blast fungus gene knockout vector pKOV21, donated by Professor Peng Youliang's laboratory at China Agricultural University.

[0064] PCR was performed using Phanta ® High-fidelity DNA Polymerase (HS Super-Fidelity DNA Polymerase, China, Vazyme, P502) was used for amplification. A 50 µl PCR reaction system was prepared, and the reaction program was as follows: 94℃, 5 min; 95℃, 40 s; 55℃, 45 s; 72℃, 2 min; 72℃, 5 min; 16℃, 5 min, 30 cycles. The target fragment in the amplified vector was then amplified using the primers listed above until the corresponding PCR band was obtained. The reaction was then performed according to Omega EZNA... ® The instructions for the Gel Extraction Kit complete the gel cutting and recycling process.

[0065] 3) Obtaining intermediate vectors through in vitro recombination

[0066] The pCTZN vector was linearized by double digestion with Nco I / Hind III, and then recombined in vitro with HYG and NEO amplified fragments to obtain the intermediate vectors pCTZN-HYG and pCTZN-NEO, respectively. In vitro recombination was performed using ClonExpress. ® The Ultra OneStep Cloning Kit (China, Vazyme, C115) is used for multi-fragment recombination reactions.

[0067] Multi-fragment in vitro recombination:

[0068] Before multi-fragment recombination, calculate the amount of DNA required for the recombination reaction using the formula. Optimal cloning vector usage = [0.02 × number of base pairs in the cloning vector] ng (0.03 pmol), optimal usage for each fragment = [0.02 × number of base pairs per fragment] ng (0.03 pmol). Gently pipette and mix (do not shake), then briefly centrifuge to collect the reaction solution at the bottom of the tube. Initiate the multi-fragment recombination reaction at 50°C for 15 min; cool to 4°C or immediately on ice.

[0069] Transformation and sequencing analysis of recombinant products:

[0070] Thaw the chemocompetent cells used for cloning on ice (e.g., DH5α Competent Cell, Vazyme #C502).

[0071] Add 5-10 μl of recombinant product to 100 μl of competent cells, gently tap the tube wall to mix (do not shake), and incubate on ice for 30 min. The transformation volume of the recombinant product should not exceed 1 / 10 of the volume of competent cells used. After heat shock in a 42°C water bath for 45 sec, immediately cool on ice for 2-3 min. Add 900 μl of SOC or LB liquid medium (without antibiotics), and incubate at 37°C for 1 h (200-250 rpm). Preheat LB solid medium plates of the appropriate antibiotic in a 37°C incubator. Centrifuge at 5,000 rpm (2,500 × g) for 5 min, and discard 900 μl of supernatant. Resuspend the bacterial cells in the remaining medium and spread using a sterile spreader.

[0072] Spread the solution evenly onto a plate containing the correct antibiotic. Incubate upside down at 37°C for 12-16 hours. Pick clones, shake the plate, and sequence. Preserve the bacterial culture of correctly sequenced positive transformants and follow the Omega EZNA protocol. ® Extract plasmids from the Plasmid Mini kit instructions and store them for later use.

[0073] The second step is to construct the Ptef1-3GFP-Nos expression framework.

[0074] 1. Ptef1 promoter import vector sequence

[0075] 1) Ptef1 amplification primer design

[0076] pCTZN-tef1-F:

[0077] accgcggtggcggccgctctagaactagt AGCAAACGGTGGTCAAAGGAT

[0078] pCTZN-tef1-R:

[0079] gaattcggatccGGTGGCCAATTGAGGCCTGGTTTGACGGTGATGTATGG

[0080] 2) Amplification template: pTefc-NEO vector containing Tef promoter (a gift from Researcher Guo Huishan, Institute of Microbiology, Chinese Academy of Sciences)

[0081] The Ptef1 amplification sequence is shown in SEQ ID NO:1.

[0082] 2.3GFP construction

[0083] In our previous study, the complement mutant constructed using the pYF11 yeast in vivo recombination method carried a single eGFP fluorescent gene. However, the fluorescence intensity was weak during subcellular localization confocal observation, causing some difficulties for subcellular analysis. Therefore, our laboratory aimed to construct a 3x GFP fluorescence signal to enhance the fluorescence intensity of the target gene in the complement strain through a dose-effect relationship. Furthermore, to avoid interference with GFP folding and subsequent fluorescence signal loss, we employed the following methods: First, a 5aa linker protein sequence was added between each GFP molecule to ensure GFP protein folding and normal function; second, a 21nt homologous arm sequence was inserted before the 3GFP molecule to facilitate in vitro recombination; third, a protein linker sequence was also introduced at the junction of the 3GFP molecule and the Nos terminator to facilitate the amplification of the entire 3GFP sequence.

[0084] 1) The protein linker sequence is as follows:

[0085] 1 st Homologous arm sequence preceding GFP, nt: GAATTC CCTGCACTTGCCAACCTTAAT,aa:EFPALAN,

[0086] 1 st GFP-2 nd GPF: nt: GACTACAAGGACGAC, aa: DYKDD)

[0087] 2 nd GPF-3 rd GFP, nt: AGCGCTGGCGCTTAC, aa: SAGAY)

[0088] 3 rd GFP-Terminator, nt: GAGCTCGGTCTCAGCAGACCACAAGTCAAGCTTTAA, aa: ELGLSRPQVKL*.

[0089] 2) Primer design for amplifying 3GFP

[0090] 3GFP-1 / 2-OL-F1:

[0091] TCACCGTCAAACCACATCCAGGTCTgaattcCCTGCACTTGCCAACCTTAAT

[0092] 3GFP-R1:

[0093] gACTTGTGGTCTGCTGAGACCgagctccttgtacagctcgtccatgccg

[0094] 3) Amplification template

[0095] The sequence was artificially synthesized by Beijing BGI and can then be directly amplified onto a plasmid.

[0096] The 3GFP amplification sequence is shown in SEQ ID NO: 2.

[0097] 3. Nos-terminator amplification

[0098] 1) Primer design for amplifying the Nos-terminator:

[0099] 3GFP-Terminator-F2:

[0100] GGTCTCAGCAGACCACAAGTCAAGCTTTAAATCATTCCACTCAACATTCAG

[0101] pCTZN-pYF11-Terminator-R:

[0102] GATGATAAGCTGTCAAACATGAGGATCCGCATAGTACCGAGAAACTAGGC

[0103] 2) Amplification template: The amplification template is the pCTZN plasmid, which contains the Nos terminator sequence.

[0104] The Nos-terminator amplification sequence is shown in SEQ ID NO: 3.

[0105] 4. Construction of the Ptef1-3GFP-Nos terminator expression cassette using in vitro recombination methods

[0106] Ptef1-3GFP-Nos terminator is introduced into pCTZN-HYG and pCTZN-NEO:

[0107] After introducing the Ptef1-3GFP-Nos terminator sequence into the intermediate vector via in vitro recombination, gene complementation vectors pCTHyg1 and pCTNeo1 were constructed, respectively. The complete genome sequence of pCTHyg1 is shown in SEQ ID NO:4, and the complete genome sequence of pCTNeo1 is shown in SEQ ID NO:5.

[0108] Intermediate vectors pCTZN-HYG and pCTZN-NEO were linearized by double digestion with EcoRI / SpeI, and then recombined in vitro with recovered fragments of Ptef1, 3GFP, and Nos terminator, respectively, to construct in vitro recombinant vectors pCTZN-Ptef1-HYG-3GFP (pCTTHyg1) and pCTZN-Ptef1-NEO-3GFP (pCTNeo1). Figure 6 , 7 )

[0109] The specific steps are as follows: First, PCR is performed using Phanta ® High-fidelity DNA Polymerase (China, Vazyme, P502) was used for amplification. A 50 µl PCR reaction system was prepared, and the reaction program was as follows: 94℃, 5 min; 95℃, 40 s; 55℃, 45 s; 72℃, 2 min; 72℃, 5 min; 16℃, 5 min, 30 cycles. The target fragment in the amplified vector was then amplified using the primers listed above until the corresponding PCR band was obtained. The reaction was then performed according to Omega EZNA... ® The gel extraction kit instructions were followed to complete the gel cutting and recovery. Then, in vitro recombination was performed using ClonExpress. ® The Ultra One Step Cloning Kit (China, Vazyme, C115) is used for multi-fragment recombination reactions.

[0110] 1) Multi-fragment in vitro recombination:

[0111] Before multi-fragment recombination, calculate the amount of DNA required for the recombination reaction using the formula. Optimal cloning vector usage = [0.02 × number of base pairs in the cloning vector] ng (0.03 pmol), optimal usage for each fragment = [0.02 × number of base pairs per fragment] ng (0.03 pmol). Gently pipette and mix (do not shake), then briefly centrifuge to collect the reaction solution at the bottom of the tube. Initiate the multi-fragment recombination reaction at 50°C for 15 min; cool to 4°C or immediately on ice.

[0112] 2) Transformation and sequencing analysis of recombinant products:

[0113] Thaw the chemocompetent cells used for cloning on ice (e.g., DH5α Competent Cell, Vazyme #C502).

[0114] Add 5-10 μl of recombinant product to 100 μl of competent cells, gently tap the tube wall to mix (do not shake), and incubate on ice for 30 min. The transformation volume of the recombinant product should not exceed 1 / 10 of the volume of competent cells used. After heat shock in a 42°C water bath for 45 sec, immediately cool on ice for 2-3 min. Add 900 μl of SOC or LB liquid medium (without antibiotics), and incubate at 37°C for 1 h (200-250 rpm). Preheat LB solid medium plates of the appropriate antibiotic in a 37°C incubator. Centrifuge at 5,000 rpm (2,500 × g) for 5 min, and discard 900 μl of supernatant. Resuspend the bacterial cells in the remaining medium and spread them on a sterile spreader.

[0115] Spread the solution evenly onto a plate containing the correct antibiotic. Incubate upside down at 37°C for 12-16 hours. Pick clones, shake the plate, and sequence. Preserve the bacterial culture of correctly sequenced positive transformants and follow the Omega EZNA protocol. ® Extract plasmids from the Plasmid Mini kit instructions and store them for later use.

[0116] pCTHyg1 full genome sequence

[0117] Example 4: Practical application and broad-spectrum analysis of the replenishment carrier

[0118] 1. Selection and identification of reporter genes.

[0119] Cyclin C1 ( Fusarium Cyclin C1 (FCC1) was first discovered in 2001 in Fusarium verticillatum (…). Fusarium verticillioides For the first time, it was discovered that *Fusarium graminearum* contains C-type cyclin, which participates in the biosynthesis of the secondary metabolite fumonisin B1 (FB1) and the spore formation of *Fusarium verticillatum*. *Fusarium graminearum* is the pathogen of rice seedling blight. Fusarium fujikuroi )middle FCC1 Gene knockout mutants exhibit a red or purple colony phenotype, which is significantly different from the white colony phenotype of the wild type. The success of the knockout can be directly determined by the color. FCC1 As an endogenous reporter gene, it can be used to assess the efficiency of gene knockout. We analyzed the Foc4 strain using the bioinformatics functional domain analysis software SMART (Simple Modular Architecture Research Tool), and found that it contains the Cyclin Box functional domain. FCC1 Homologous gene (FOIG_04434) was used as the target gene for gene knockout and phenotypic analysis to validate Foc4. FCC1 The knockout mutation produces typical red colonies, serving as an endogenous reporter gene.

[0120] In addition to containing a typical cyclin box, the FCC1 protein from *Fusarium wiltii* (banana wilt fungus) also contains an RQKL domain (the destruction box-like motif) and a PEST-Rrich domain, and is highly homologous to the FCC1 protein sequences of other fungi. Knockout FCC1 After genes, Δfcc1 The strain grows slowly, sporulation decreases, pathogenicity decreases, and colonies exhibit a typical red or reddish-brown phenotype, similar to... F. fujikuroi Consistent with previous reports, these results indicate that FCC1 exhibits high sequence and functional conservation during evolution. We have now obtained an FCC1 gene knockout mutant with a neomycin NEO resistance selection marker.

[0121] 2. Primer design for replacement

[0122] FCC1 knockout mutant Δfcc1 Since the sample contains a NEO resistance screening marker, the subsequent replenishment uses the HYG resistance marker. In this part, we use the pCTHyb1 replenishment vector for subsequent experiments.

[0123] pCTHyb1 adopts Stu I / EcoR The I enzyme digestion combination and FCC1 complement primer design are as follows:

[0124] FCC1-Native-1F: gactcactatagggcgaattg AGTATGGCTCAATCAACGACGCCA

[0125] FCC1-pTef1-1F: GTCAAACCACATCCAGGTCTATGTCAGCCAATTATTGGCAATCG

[0126] FCC1-2609R:ATTAAGGTTGGCAAGTGCAGG CTTATCTAAGCCTCTTGCCTTAAC

[0127] Genomic DNA with Foc4 as the template was amplified. When using the native promoter, the Ptef1 promoter sequence was removed by double digestion with Stu I / EcoRI, and a 2608 bp FCC1 sequence containing the upstream promoter was amplified using primers FCC1-Native-1F / FCC1-2609R for in vitro recombination experiments. When using the Ptef1 promoter, the pCTHyb1 vector was digested with EcoRI, and a 1017 bp FCC1 ORF region sequence was amplified using primers FCC1-pTef1-1F / FCC1-2609R.

[0128] 3. Construction of gene complementation vector and detection of complementation transformants

[0129] A 2608 bp FCC1 sequence containing the upstream promoter and a 1017 bp FCC1 ORF region sequence were amplified using primers and then mixed with the pCTHyb1 complementation vector in Stu I / EcoRI and EcoRI linearized vectors, respectively. The mixtures were then processed according to ClonExpress. ® Multi-fragment recombination reactions were performed using the Ultra One Step Cloning Kit (China, Vazyme, C115) according to its instructions. After completion, DH5α competent cells were transformed and sequenced. Positive transformants with correct sequencing were preserved in bacterial culture and processed according to the Omega EZNA protocol. ® The Plasmid Mini kit instructions state that the plasmids were extracted and stored for later use, and named pCTHyb1-FCC1-Com-Native and pCTHyb1-FCC1-Com-Ptef1, respectively.

[0130] FCC1 knockout transformants Δfcc1 Protoplasts were prepared, and the constructed complementation vector was linearized using restriction enzymes, then transformed into gene knockout protoplasts. Complementation transformants were screened using RM plates containing hygromycin at a final concentration of 100 g / mL. Δfcc1 -Com-Native Δfcc1 -Com-Ptef1.

[0131] Table 1. List of primer sequences for detecting complementary transformants

[0132]

[0133] 4. Results Analysis

[0134] The native promoter and the constitutive promoter Ptef1 promoter were used to obtain the results respectively. Δfcc1 -Com mutants were reintroduced, and phenotypic analysis and PCR detection were performed for identification. Figures 10-11 ),result Δfcc1 -Com / native promoter complementation mutant Δfcc1 -Com / Ptef1 promoter colonies all returned to white color, and... Δfcc1The knockout mutants showed a clear difference in color intensity. Furthermore, there were no significant differences between the two groups in terms of colony growth rate. These results demonstrate that both the native promoter and the constitutive promoter Ptef1 can successfully obtain gene knockout complement mutants. This further indicates the success of the optional promoter strategy for the constructed complement vector pCTHyg1, especially for genes with low abundance expression, where the Ptef1 promoter is more advantageous for subcellular localization observation.

[0135] Subsequently, the Ptef1 promoter, which was obtained using both the native promoter and the constitutive promoter, was used to obtain... Δfcc1 -Observe the GFP fluorescence signal after the Com complement mutant is restored ( Figures 12-13 ),result Δfcc1 -Com / native promoter complementation mutant Δfcc1 Both the -Com / Ptef1 promoter and other reinjected strains expressed fluorescence in conidia and hyphae, while FCC1 was diffusely distributed in the cytoplasm. Furthermore, Δfcc1 -Com / native promoter complementation mutant GFP fluorescence is significantly weaker than Δfcc1 -Com / Ptef1 promoter fluorescence signal.

[0136] These results demonstrate that both the native promoter and the Ptef1 promoter can successfully obtain gene knockout complement mutants, but the Ptef1 promoter can express a stronger fluorescent signal, which facilitates subsequent confocal observation and subcellular localization.

[0137] In summary, the gene complementation vector constructed in this experiment utilizes in vitro recombination technology, avoiding the cumbersome steps of in vivo yeast recombination, and the entire process is simple to operate. Furthermore, this vector has a smaller molecular weight than yeast vectors, and combined with the reliable and mature in vitro recombination technology, it significantly improves transformation efficiency and has broader application prospects in filamentous fungi.

[0138] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of Fusarium wilt gene knockout mutant complementation vector in the functional identification of Fusarium wilt gene, characterized in that, The gene is the *Fusarium wiltii* FCC1 gene FOIG_04434. The *Fusarium wiltii* gene knockout mutant complementation vector was constructed using in vitro recombination technology, and the construction steps included: (1) Replace the resistance gene on the initial vector with the HYG resistance gene or the NEO resistance gene to construct the intermediate vector pCTZN-HYG or pCTZN-NEO; the initial vector is the pCTZN vector; the pCTZN vector is obtained by replacing the fluorescent protein gene on the pCT74 plasmid with the bleomycin resistance gene and removing the hygromycin resistance gene. (2) Amplify the ptef1 promoter sequence, 3GFP sequence and terminator sequence respectively; The 3GFP consists of: a homologous arm sequence inserted before the first GFP; a linker sequence inserted between each GFP; and a linker sequence also inserted between the third GFP and the terminator; the ptef1 promoter sequence is shown as the nucleotide sequence from 26bp to 853bp in SEQ ID NO.

1. The homologous arm sequence is: GAATTC CCTGCACTTGCCAACCTTAAT; the linker sequence between the first GFP and the second GFP is: GACTACAAGGACGAC; the linker sequence between the second GFP and the third GFP is: AGCGCTGGCGCTTAC; the linker sequence between the third GFP and the terminator is: GAGCTCGGTCTCAGCAGACCACAAGTCAAGCTTTAA. (3) After the intermediate vector pCTZN-HYG or pCTZN-NEO is double-digested into a linearized vector, it is recombined in vitro with the ptef1 promoter sequence, 3GFP sequence and terminator sequence to construct the complementation vector pCTHyg1 or pCTNeo1. The banana wilt fungus is Fusarium oxysporum Cuban variant (… Fusarium oxysporum f. sp. cubense ).

2. The application according to claim 1, characterized in that, Step (1) is as follows: after the initial vector is linearized by double digestion with Nco I / HindIII, it is subjected to in vitro recombination reaction with the HYG resistance gene or the NEO resistance gene amplification fragment to obtain the intermediate vector pCTZN-HYG or pCTZN-NEO.

3. The application according to claim 1, characterized in that, The 3GFP sequence is shown in SEQ ID NO:

2.

4. The application according to claim 1, characterized in that, The in vitro recombination reaction was carried out at 50°C for 15 min.

5. The application according to claim 1, characterized in that, The double digestion mentioned in step (3) is EcoRI / SpeI double digestion.

Images