Primer probe set, kit and method for detecting resistance of Aedes albopictus to pyrethroid insecticides

Abstract

The present invention relates to the field of molecular detection technology, and in particular to a primer probe set, a kit and a method for detecting the resistance of Aedes albopictus to pyrethroid insecticides. The primer probe set provided by the present invention for detecting the resistance of Aedes albopictus to pyrethroid insecticides comprises 2 pairs of primers and 7 probes; the nucleotide sequences of the 2 pairs of primers are shown in SEQ ID NO.1‑2 and SEQ ID NO.3‑4 respectively; the nucleotide sequences of the 7 probes are shown in SEQ ID NO.5‑11 respectively. The primer probe set can realize multiple PCR amplification in the same PCR reaction system, and after the mass probe extension reaction, the genotypes of all mutation sites of the kdr gene can be simultaneously detected in one mass spectrometry detection, which has the advantages of accuracy, high throughput, rapidity and simplicity, and is suitable for the detection and monitoring of the resistance of Aedes albopictus to commonly used pyrethroid insecticides.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular detection, and in particular to a primer probe set, a kit and a method for detecting the resistance of Aedes albopictus to pyrethroid insecticides. Background Art

[0002] Aedes albopictus is an important vector of arboviruses such as dengue fever, West Nile virus, yellow fever virus, chikungunya fever and Zika virus. It has now spread to more than 70 countries around the world and is considered the most invasive mosquito species in the world. It is characterized by daytime feeding, rapid reproduction and strong aggressiveness. In order to reduce the harm of Aedes albopictus to humans, the current prevention and control strategy still mainly relies on insecticides to control the number of mosquitoes. Pyrethroid insecticides are widely used in mosquito control because of their broad spectrum, high efficiency and low toxicity to mammals.

[0003] The voltage-gated sodium channel encoded by the VGSC (voltage-gated sodium channel) gene is the main target of pyrethroid insecticides. VGSC gene mutations can reduce the affinity of Aedes albopictus to insecticides, thereby producing knockdown resistance (kdr). The widespread use of insecticides has led to the development of corresponding resistance in Aedes albopictus. Currently, three mutation sites, 1016, 1532, and 1534, and 17 mutant types have been found in the kdr gene of Aedes albopictus, and all have been confirmed to be associated with knockdown resistance in Aedes albopictus. Developing simple and accurate detection technology to monitor the presence of kdr gene mutations in Aedes albopictus is crucial for effectively understanding the resistance of Aedes albopictus and guiding the sustainable use of pyrethroid insecticides in the future.

[0004] At present, the methods for detecting the kdr gene mutation of Aedes albopictus include genome sequencing and allele-specific PCR (AS-PCR) technology. Genome sequencing is the gold standard for detecting the kdr gene of Aedes albopictus and is the most widely used, but it requires two separate PCR reactions to amplify the target gene containing three sites, and then use the first-generation sequencing technology to detect the target gene. Finally, it is necessary to manually compare whether the three sites have gene mutations. The detection method is complicated, time-consuming and costly, and is not suitable for rapid detection and monitoring of a large number of samples. AS-PCR technology is currently also used for the detection of the kdr gene of Aedes albopictus, but this technology can only detect single sites and cannot detect 17 mutant types of three sites at the same time. It has low specificity and is easy to contaminate. Therefore, it is urgent to develop a rapid, accurate, economical, and multi-site detection method for the detection of kdr gene mutations in Aedes albopictus to meet the needs of detection, monitoring and rapid disposal of public health emergencies in Aedes albopictus. Summary of the invention

[0005] The object of the present invention is to provide a primer probe set, a kit and a method for detecting the resistance of Aedes albopictus to pyrethroid insecticides.

[0006] The present invention is based on multiplex PCR-mass spectrometry microsequencing technology that combines multiplex PCR technology with mass spectrometry technology, and provides primers, probes, kits and methods for detecting all resistance sites related to the resistance of Aedes albopictus to pyrethroid insecticides.

[0007] Specifically, the present invention provides the following technical solutions:

[0008] In a first aspect, the present invention provides a primer probe set for detecting the resistance of Aedes albopictus to pyrethroid insecticides, wherein the primer probe set comprises 2 pairs of primers and 7 probes;

[0009] The nucleotide sequences of the two pairs of primers are shown in SEQ ID NO.1-2 and SEQ ID NO.3-4 respectively; the nucleotide sequences of the seven probes are shown in SEQ ID NO.5-11 respectively.

[0010] In the above primer probe set, two pairs of primers can realize efficient multiplex PCR amplification of all three gene mutation sites related to the resistance of Aedes albopictus to pyrethroid insecticides (positions 1016, 1532, and 1534 of the kdr gene) in the same PCR amplification system; 7 probes can perform efficient mass probe extension (MPE) on the PCR amplification products, and further use mass spectrometry to detect the extension products, judge the mutation of the base by the mass difference, and realize multi-target and high-throughput detection of 17 mutant types. Mass spectrometry detection can analyze up to 40 targets at a time, with a throughput much higher than q-PCR technology, and the entire detection process can be completed within 7 hours, which is much lower than the time limit of at least 2 days for genome sequencing.

[0011] In a second aspect, the present invention provides use of the primer probe set described above in preparing a kit for detecting resistance of Aedes albopictus to pyrethroid insecticides.

[0012] In a third aspect, the present invention provides a kit, comprising the primer probe set described above.

[0013] Preferably, in the above kit, the primer pairs with nucleotide sequences as shown in SEQ ID NO.1-4 form a primer mixture, and the probes with nucleotide sequences as shown in SEQ ID NO.5-11 form a probe mixture, and the primer mixture and the probe mixture are packaged separately.

[0014] The above-mentioned kit is a kit for detecting the resistance of Aedes albopictus to pyrethroid insecticides based on multiplex PCR-mass spectrometry microsequencing technology.

[0015] To facilitate detection, the kit further comprises one or more selected from PCR reaction reagents, shrimp alkaline phosphatase reaction reagents, mass probe extension reaction reagents, nucleic acid purification reagents, mass spectrometry detection reagents, and nuclease-free water (Rnase / Dnase free water).

[0016] Preferably, the PCR reaction reagents include deoxynucleoside triphosphates, DNA polymerase, nuclease-free water, and the like.

[0017] The Shrimp Alkaline Phosphatase Reagent contains Shrimp Alkaline Phosphatase and Shrimp Alkaline Phosphatase Buffer.

[0018] The mass probe extension reaction reagents include dideoxynucleotide triphosphate, Taq enzyme and the like.

[0019] The nucleic acid purification reagent comprises an ion exchange resin.

[0020] The mass spectrometry detection reagent comprises a 3-hydroxypicolinic acid solution.

[0021] When the above kit is used to detect the resistance of Aedes albopictus to pyrethroid insecticides, a method comprising the following steps is adopted:

[0022] After the primer mixture and PCR reaction reagent are evenly mixed, 0.1-1 μg of template DNA is added according to the sample concentration, and nuclease-free water is added to make up to 20 μL to perform PCR amplification reaction, wherein the final concentration of each primer in the primer mixture in the PCR amplification reaction system is 0.4 μM;

[0023] After the PCR reaction is completed, shrimp alkaline phosphatase and nuclease-free water are added to the PCR reaction product, followed by a digestion reaction to obtain a digestion reaction product;

[0024] After uniformly mixing the mass probe extension reaction reagent and the probe mixture, the reagent is added to the digestion reaction product to perform a mass probe extension reaction to obtain a mass probe extension reaction product. In the mass probe extension reaction system, the final concentrations of the probes having nucleotide sequences such as those shown in SEQ I|NO.5-11 in the probe mixture are 7.15 μM, 8.30 μM, 9.22 μM, 10.12 μM, 6.87 μM, 8.91 μM, and 10.18 μM, respectively;

[0025] mixing a nucleic acid purification reagent with a mass probe extension reaction product to obtain a purified product;

[0026] The purified product was covered with 3-hydroxypicolinic acid solution and then subjected to mass spectrometry analysis;

[0027] The genotype and mutation type of the kdr gene of the sample to be tested are determined according to the mass-to-charge ratio of the characteristic peak, and the resistance to pyrethroid insecticides is determined according to the genotype and mutation type.

[0028] In a fourth aspect, the present invention provides any of the following uses of the primer probe set or the kit described above:

[0029] (1) Application in detecting the resistance of Aedes albopictus to pyrethroid insecticides;

[0030] (2) Application in detecting mutation sites of the kdr gene in Aedes albopictus;

[0031] (3) Application in detecting the genotype of the kdr gene in Aedes albopictus.

[0032] In a fifth aspect, the present invention provides a method for detecting the resistance of Aedes albopictus to pyrethroid insecticides, the method comprising:

[0033] Using the genomic DNA of the sample to be tested as a template and the primer pairs with nucleotide sequences such as SEQ ID NO.1-4 as examples, multiple PCR amplification is performed to obtain PCR amplification products.

[0034] The PCR amplification product is digested with shrimp alkaline phosphatase to obtain a digestion product,

[0035] Using the digestion product as a template, a mass probe extension reaction is performed using a probe with a nucleotide sequence such as SEQ ID NO. 5-11 to obtain an extension product.

[0036] After the extension product is purified, mass spectrometry is performed.

[0037] The genotype, mutation type and / or resistance to pyrethroid insecticides of the kdr gene of the sample to be tested are determined according to the mass-to-charge ratio of the characteristic peak.

[0038] Preferably, in the reaction system of the multiplex PCR amplification, the final concentration of the primers having nucleotide sequences as shown in SEQ ID NO. 1-4 is 0.4 μM.

[0039] The 25 μL reaction system for multiplex PCR amplification includes: 12.5 μL of 2×EasyTaq PCR SuperMix, 1 μL of each of the primers shown in SEQ ID NO. 1-4 at 10 μmol / L, a total of 4 μL, 5 μL of DNA template, and 8.5 μL of ddH2O.

[0040] The reaction procedure of the multiplex PCR amplification includes: 94° C., 5 min; 94° C., 30 s, 55° C., 30 s, 72° C., 30 s, for a total of 35 cycles; 72° C., 8 min.

[0041] Preferably, in the reaction system of the mass probe extension reaction, the final concentrations of the probes having nucleotide sequences as shown in SEQ ID NOs. 5-11 are 7.15 μM, 8.30 μM, 9.22 μM, 10.12 μM, 6.87 μM, 8.91 μM and 10.18 μM, respectively.

[0042] Preferably, the 11 μL reaction system of the mass probe extension reaction includes: 7 μL SAP digestion product, 4 μL MPE mixed solution (1 μL E-ddNTPmix, 1.4 μL MPE buffer, 0.6 μL MPE enzyme, 1 μL MPE probe mixture shown in SEQ ID NO.5-11).

[0043] Preferably, the reaction procedure of the mass probe extension reaction includes: (1) 95°C, 30s; (2) 95°C, 5s, followed by 52°C, 5s, 80°C, 5s, 5 cycles, steps (1) and (2) are performed for a total of 40 cycles; (3) 72°C, 3min.

[0044] Preferably, the reaction procedure of the digestion reaction is: 37° C., 40 min, 85° C., 5 min.

[0045] The reaction system of the digestion reaction includes: 0.3 μL SAP enzyme and 1.7 μL 1×SAP buffer.

[0046] The mass-to-charge ratios m / z of 14 marker peaks involved in mass spectrometry detection of 17 mutant types of the kdr gene detected by the primer probe set of the present invention are: 5375.4±1, 5444.4±1, 5526.4±1, 5566.4±1, 5595.4±1, 6197.8±1, 6221.8±1, 6655.2±1, 6793.2±1, 6817.2±1, 6833.2±1, 7552.8±1, 7459.6±1, 7475.6±1.

[0047] Preferably, judging the genotype, mutation type and / or resistance to pyrethroid insecticides of the kdr gene of the sample to be tested according to the mass-to-charge ratio of the characteristic peak is:

[0048] Among the characteristic peaks with mass-to-charge ratios of m / z 6221.8±1 and 6197.8±1, if the mass spectrum peak contains only the characteristic peak with a mass-to-charge ratio of m / z 6221.8±1, it is judged that the kdr gene at the 1016th position is a wild-type homozygous genotype GTA, which is sensitive to pyrethroid insecticides; if the mass spectrum peak contains the characteristic peak with a mass-to-charge ratio of m / z 6221.8±1 / 6197.8±1, it is judged that the kdr gene at the 1016th position is a wild-type / mutant heterozygous genotype GT / GA, which is resistant to pyrethroid insecticides; if the mass spectrum peak contains only the characteristic peak with a mass-to-charge ratio of m / z 6197.8±1, it is judged that the kdr gene at the 1016th position is a mutant homozygous genotype GGA, which is resistant to pyrethroid insecticides;

[0049] Among the characteristic peaks with mass-to-charge ratios of m / z 5444.4±1 and 5375.4±1, if the mass spectrum peak contains only the characteristic peak with a mass-to-charge ratio of m / z 5444.4±1, it is judged that the kdr gene at position 1532 is a wild-type homozygous genotype ATC, which is sensitive to pyrethroid insecticides; if the mass spectrum peak contains the characteristic peak with a mass-to-charge ratio of m / z 5444.4±1 / 5375.4±1, it is judged that the kdr gene at position 1532 is a wild-type / mutant heterozygous genotype AT / CC, which is resistant to pyrethroid insecticides; if the mass spectrum peak contains only the characteristic peak with a mass-to-charge ratio of m / z 5375.4±1, it is judged that the kdr gene at position 1532 is a mutant homozygous genotype ACC, which is resistant to pyrethroid insecticides;

[0050] Among the characteristic peaks with mass-to-charge ratios of m / z 7459.6±1, 6817.2±1, 5566.4±1, 6833.2±1, 6793.2±1, 5526.4±1, 7475.6±1, 5595.4±1, 6655.2±1, and 7552.8±1, if the mass spectrum peak contains a characteristic peak with a mass-to-charge ratio of m / z 7459.6±1 / 6817.2±1 / 5566.4±1 , it is judged that the kdr gene is a wild-type homozygous genotype TTC at position 1534, which is sensitive to pyrethroid insecticides. If the mass spectrum peak contains the special m / z of mass-to-charge ratios of 6817.2±1 / 6833.2±1, 6817.2±1 / 6793.2±1, 5566.4±1 / 5526.4±1, 7459.6±1 / 7475.6±1, 5566.4±1 / 5595.4±1 If the mass spectrum peak contains the mass-to-charge ratio m / z of 6833.2±1 / 6655.2±1, 6793.2±1 / 6655.2±1, 7475.6±1, 6655.2±1 / 75 If the mass spectrum peak contains a characteristic peak with a mass-to-charge ratio of m / z 6833.2±1 / 6793.2±1, it is judged that the kdr gene at the 1534th position is a mutant heterozygous TC / GC, which is resistant to pyrethroid insecticides.

[0051] The beneficial effect of the present invention is that the primer probe set for detecting the resistance of Aedes albopictus samples to pyrethroid insecticides provided by the present invention can realize multiple PCR amplification in the same PCR reaction system, and after the mass probe extension reaction, 17 mutant types of all three mutation sites of the kdr gene (all mutation sites and mutation types of the kdr gene of Aedes albopictus currently known) can be simultaneously detected in one mass spectrometry detection, with high accuracy and detection efficiency.

[0052] By using the detection method and detection kit of the present invention, the resistance detection of 48 samples of Aedes albopictus to pyrethroid insecticides can be completed within 7 hours, and the detection targets include all mutation sites and mutant types of the currently known Aedes albopictus kdr gene. The detection throughput far exceeds q-PCR, and the detection time is much shorter than the current genome sequencing method for resistance detection of Aedes albopictus, which takes at least 2 days. The detection cost is about 10 yuan / sample. It has the characteristics of accuracy, high throughput, rapidity, ease of use, and economy. It is suitable for the resistance detection and monitoring of Aedes albopictus to commonly used pyrethroid insecticides, as well as emergency response to public health events, and is easy to promote and apply. It can solve the current state that multi-site resistance detection of Aedes albopictus only relies on genome sequencing, and solve the problem of lack of commercial kits for rapid detection of pyrethroid insecticide resistance of Aedes albopictus, and provide new technical support for the detection and monitoring of insect-borne infectious diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0054] Figure 1 This is the mass spectrum of the resistance-related gene mutant 1534S / C (TC / GC) in Example 2 of the present invention.

[0055] Figure 2 This is the mass spectrum of the resistance-related gene mutant F1534C (TGC) in Example 2 of the present invention.

[0056] Figure 3 This is the mass spectrum of the resistance-related gene mutant F1534L (CTC) in Example 2 of the present invention.

[0057] Figure 4 This is the mass spectrum of the resistance-related gene mutant F1534L (T / CTC) in Example 2 of the present invention.

[0058] Figure 5 This is the mass spectrum of the resistance-related gene mutant F1534L (TTA) in Example 2 of the present invention.

[0059] Figure 6 This is the mass spectrum of the resistance-related gene mutant F1534L (TTC / A) in Example 2 of the present invention.

[0060] Figure 7 This is the mass spectrum of the resistance-related gene mutant F1534L (TTC / G) in Example 2 of the present invention.

[0061] Figure 8 This is the mass spectrum of the resistance-related gene mutant F1534S (TCC) in Example 2 of the present invention.

[0062] Fig. 9 This is the mass spectrum of the resistance-related gene mutant F1534S (TT / CC) in Example 2 of the present invention.

[0063] Fig.10 This is the mass spectrum of the resistance-related gene mutant I1532 (ATC) in Example 2 of the present invention.

[0064] Fig.11 This is the mass spectrum of the resistance-related gene mutant I1532T (ACC) in Example 2 of the present invention.

[0065] Fig.12 This is the mass spectrum of the resistance-related gene mutant I1532T (AT / CC) in Example 2 of the present invention.

[0066] Fig.13 This is the mass spectrum of the resistance-related gene mutant V1016G (GGA) in Example 2 of the present invention.

[0067] Fig.14 It is the mass spectra of the resistance-related gene mutants V1016G (GT / GA) and F1534C- (TT / GC) in Example 2 of the present invention.

[0068] Fig.15 It is the mass spectra of the resistance-related gene mutants V1016 (GTA) and F1534- (TTC) in Example 2 of the present invention. DETAILED DESCRIPTION

[0069] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0070] Example 1 Design of SNP-specific primers and mass probe sequences for the resistance gene of Aedes albopictus to pyrethroid insecticides

[0071] Three SNP Aedes albopictus kdr gene target sites (1016, 1532, 1534) were used as resistance detection target sites, and primers and probes were designed for these three sites. First, the gene sequence was aligned online using BLAST software, and the conserved fragments were selected and double PCR amplification primers were designed using multiple primer design software Primerplex. The 1532 and 1534 sites were amplified using the same set of primers, and the primer length was between 19-22bp. A 10bp fixed sequence acgttggatg was added to the 5 end of each primer to make the primer molecular weight greater than 9000Da, which exceeded the size range of the SNP mass extension probe. Multiple pairs of primers were designed for the 1016 site and the 1532 and 1534 sites. Multiple rounds of screening were performed based on the electrophoresis detection results of single-plex PCR amplification, the amplification effect of each pair of primers, the fragment length and distance, the position of the target gene being detected, the amplification effect of multiplex PCR, etc., and finally a primer pair for the 1016 site (named 1016F / R) and a primer pair for the 1532 and 1534 sites (named 3234F / R) were obtained.

[0072] The SNP site MALDI-TOFMS mass difference probe was designed using the gene site analysis design system (V2.0, IntelliBio, China). Multiple probes were designed for each SNP site. During the screening process, it was found that the probes of some SNP sites were inconsistent with the theoretical results. These probes were further optimized until their detection results were consistent with the theoretical results. In addition, there were problems with the failure of detection of individual probes. For example, considering the mutation of site 1532, the probe of site 1534 was designed from the R direction, but the probe system could not meet the extension requirements of pure and mutant types. Due to the mutation of the base at the 3' end of the extended probe, the probe could not match the template and the extension reaction could not be carried out. After continuous optimization, it was finally determined that two probes in the F direction of site 1534 were added so that the probe system could cover all mutant types.

[0073] The primers and probes were optimized and the best primer and probe sequences were screened. After multiple rounds of screening, two pairs of optimal primers for PCR amplification and seven probes for mass probe extension were determined. The sequences of primers and probes are shown in Tables 1 and 2.

[0074] Table 1 The sequences of the optimal primers determined by screening

[0075]

[0076] Table 2 The best quality probe extension primers determined after screening

[0077] Sequence number SNP_ID MPE_SEQ SEQ ID NO.5 fl15342 AGGGTGAAGAACGACCC SEQ ID NO.6 vg1016 GGCTAAGAAAAGGTTAAGT SEQ ID NO.7 sc1534 TTGAGGGTGAAGAACGACCCG SEQ ID NO.8 fl15341 GTTGAGGGTGAAGAACGACCCGA SEQ ID NO.9 it1532 CTACTTCGTGTTCTTCA SEQ ID NO.10 fl15341-2 TACTTCGTGTTCTTCATCATC SEQ ID NO.11 sc1534-2 TCTACTTCGTGTTCTTCATCATCT

[0078] Example 2 Determination of resistance characteristic peaks by mass spectrometry

[0079] In Example 1, two pairs of SNP amplification primers were screened, and an acgttggatg sequence was added to the 5' end of each primer to ensure that its molecular weight was not within the mass spectrometry detection range, and seven specific MPE probes were screened. The above seven specific MPE probes form molecular weight differences through length differences, and the extended characteristic peaks are determined by setting the original peak of the mass probe, the extended base of the non-mutant mass probe, and the extended base of the mutant mass probe: m / z 5375.4±1, 5444.4±1, 5526.4±1, 5566.4±1, 5595.4±1, 6197.8±1, 6221.8±1, 6655.2±1, 6793.2±1, 6817.2±1, 6833.2±1, 7552.8±1, 7459.6±1, 7475.6±1.

[0080] The corresponding relationship between the above characteristic peaks and the mutation sites of resistance-related genes is shown in Table 3. Figure 1 , Figure 2 , Figure 3 , Figure 4 , Figure 5 , Figure 6 , Figure 7 , Figure 8 , Fig. 9 , Fig.10 , Fig.11 , Fig.12 , Fig.13 , Fig.14 and Fig.15 shown.

[0081] Table 3 Characteristic peaks related to the resistance of Aedes albopictus to pyrethroid insecticides

[0082]

[0083] Example 3 Development of a kit for detecting resistance of Aedes albopictus to pyrethroid insecticides

[0084] This embodiment provides a kit for detecting resistance of Aedes albopictus to pyrethroid insecticides, the kit comprising reagent 1, reagent 2, reagent 3, reagent 4, reagent 5, reagent 6, reagent 7, and reagent 8;

[0085] Among them, reagent 1 is a multiplex PCR primer (nucleotide sequence is shown in SEQ ID NO.1-4); reagent 2 is a probe sequence primer (nucleotide sequence is shown in SEQ ID NO.5-11); reagent 3 is a PCR amplification system solution; reagent 4 is a shrimp alkaline phosphatase reaction system solution; reagent 5 is a mass probe extension system; reagent 6 is an ion exchange resin; reagent 7 is a 3-hydroxypicolinic acid solution; and reagent 8 is nuclease-free water.

[0086] The PCR amplification system solution is prepared from deoxynucleoside triphosphate, DNA polymerase and nuclease-free water; the mass probe extension system is prepared from dideoxynucleotide triphosphate and Taq enzyme; and the shrimp alkaline phosphatase reaction system solution is composed of SAP enzyme and SAP buffer.

[0087] Example 4 Establishment of a method for detecting resistance of Aedes albopictus to pyrethroid insecticides

[0088] First, the detection method of Aedes albopictus resistance to pyrethroid insecticides was optimized, mainly including:

[0089] (1) Optimization of template concentration: DNA extracted from the whole mosquito was subjected to PCR amplification. The gel running results showed that a faint band also appeared in the blank sample tube. Subsequently, the DNA was diluted 5 times, and the contamination of the blank group was eliminated.

[0090] (2) Primer system optimization: First, each pair of primers was extended by PCR separately, and then 1.5% agarose gel electrophoresis was performed to verify whether nonspecific bands were generated. After determining the specificity of each pair of primers, the primers were mixed and then multiplex PCR was performed to ensure that there was no interference between the primer pairs and that the amplification effect of the multiplex PCR was close to that of the single-reaction reaction.

[0091] The mass spectrometer used for data acquisition was the QuanTOF mass spectrometer of Rongzhi Biotechnology (Qingdao) Technology Co., Ltd. The data were collected in linear mode with a mass range of 4000-9000Da, a focus mass of 7000Da, a source voltage of 20.00kV, a detector voltage of 0.5kV, an extraction voltage of 3.53kV, and a laser pulse frequency of 2000Hz. The mass axis of the mass spectrometer was calibrated using the reference mass peak of the quality control point, and the average molecular mass deviation after calibration was less than 1000ppm.

[0092] Based on the above optimization results, this embodiment provides a method for detecting the resistance of Aedes albopictus to pyrethroid insecticides. The method uses the detection kit of Example 3 for detection, and comprises the following steps:

[0093] After mixing 2 μL of reagent 1 and 3.5 μL of reagent 3 in a 200 μL EP tube, add 0.1-1 μg of template DNA according to the sample concentration, add reagent 8 to make up to 20 μL, vortex gently to mix, centrifuge at 1000 rpm for 1 min, and perform PCR amplification reaction after mixing; wherein, the composition of the PCR amplification reaction system is as follows: a 25 μL system is used, including 2×EasyTaqPCR SuperMix 12.5 μL, 10 μmol / L forward primer and reverse primer (primers shown in SEQ ID NO.1-4) 1 μL each, a total of 4 μL, DNA template 5 μL, ddH2O 8.5 μL. Add in the above order to a 0.2mL PCR reaction tube and mark it. After oscillation and mixing, centrifuge briefly at low speed, flick off the bubbles in the tube and put it into the machine; the reaction program of PCR amplification is as follows: 94℃, 5min; 94℃, 30s, 55℃, 30s, 72℃, 30s, a total of 35 cycles; 72℃, 8min, and store at 4℃.

[0094] After the PCR reaction, add 0.5 μL of reagent 4 and 1.5 μL of reagent 8 to the reaction product, vortex gently to mix, centrifuge at 1000 rpm for 1 min, and then perform digestion reaction; wherein, the digestion reaction system contains 1.53 μL of water, 0.17 μL SAP buffer, and 0.3 μL SAP enzyme; the digestion reaction conditions are 37°C, 40 min, 85°C, 5 min, and storage at 4°C.

[0095] 3 μL of reagent 5 and 1 μL of reagent 2 were mixed evenly, and then added to the digestion reaction product. The mixture was gently vortexed and centrifuged at 1000 rpm for 1 min to perform mass probe extension reaction. The mass probe extension reaction system was composed of 11 μL of reaction system, 7 μL of SAP digestion product and 4 μL of MPE mixed solution (1 μL E-ddNTPmix, 1.4 μL MPE buffer, 0.6 μL MPE enzyme, 1 μL MPE probe). The nucleotide sequence in the reaction system was as shown in SEQ ID The final concentrations of the probes shown in NO.5-11 were 7.15 μM, 8.30 μM, 9.22 μM, 10.12 μM, 6.87 μM, 8.91 μM, and 10.18 μM, respectively; the reaction procedure was as follows: first 95°C, 30 s, then 95°C, 5 s, followed by 52°C, 5 s, 80°C, 5 s, 5 cycles, and then the whole process was repeated for 40 cycles, and finally 72°C, 3 min, and stored at 4°C;

[0096] Subsequently, after mixing equal volumes of reagent 6 and reagent 8, take 14 μL and add it to the reaction tube of the mass probe extension reaction. Place the sample in a flip mixer and mix at 100 rpm for 30 min. Take 1 μL of the reaction supernatant to spot the target, cover the reagent 7 solution and perform mass spectrometry analysis. Determine the genotype of the sample and determine the resistance based on the mass-to-charge ratio of the characteristic peak.

[0097] Example 5 Evaluation of the actual detection effect of the kit

[0098] 1. Sensitivity evaluation

[0099] The plasmid containing the DNA of the unmutated kdr gene of Aedes albopictus was synthesized and used to determine the minimum detection limit of the detection method of Aedes albopictus for pyrethroid insecticide resistance in Example 4. The initial concentration of the above-synthesized nucleic acid was quantified and diluted in 6 concentration gradients (2pg / μL, 200fg / μL, 20fg / μL, 2fg / μL, 200ag / μL, 20ag / μL), and the other reaction conditions were consistent with the detection method of Aedes albopictus for pyrethroid insecticide resistance in Example 4.

[0100] The results showed that the detection limits of the seven probes vg1016, it1532, fl15341, fl15341-2, sc1534, sc1534-2, and fl15342 were 200ag / μL, 200ag / μL, 2fg / μL, 200ag / μL, 2fg / μL, 200ag / μL, and 20fg / μL, respectively, and the overall detection limit of multiplex PCR-mass spectrometry microsequencing was 20fg / μL.

[0101] 2. Accuracy evaluation

[0102] 150 samples of Aedes albopictus collected at the monitoring point were tested using the detection kit in Example 3 of the present invention and the detection method in Example 4. The gold standard genome sequencing method was used as a control method. The sample DNA was extracted using the nucleic acid extraction reagent of Wuxi Biotech Biotechnology Co., Ltd.

[0103] The results showed that the method of the present invention completed the detection of all samples within 72 hours by a single person and a single machine, which was completely consistent with the gold standard control method, and the detection results were 100% accurate. Due to the advantages of detection throughput and detection time, the overall detection completion time was reduced by 5 times compared with genome sequencing.

[0104] The detection method of the present invention has the advantages of short analysis time, high accuracy, easy operation and low cost. This method is a practical and high-throughput detection technology for the resistance of Aedes albopictus to pyrethroid insecticides. It solves the bottleneck problem of the current rapid resistance detection kit for Aedes albopictus and provides a practical and applicable new technical support for the prevention and control of insect-borne biological epidemics.

[0105] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for detecting the resistance of Aedes albopictus to pyrethroid insecticides, characterized in that: The method comprises: Using the genomic DNA of the sample to be tested as a template and the primer pairs with nucleotide sequences such as SEQ ID NO.1-4 as examples, multiple PCR amplification is performed to obtain PCR amplification products. The PCR amplification product is digested with shrimp alkaline phosphatase to obtain a digestion reaction product, Using the digestion reaction product as a template, a mass probe extension reaction is performed using a probe with a nucleotide sequence such as SEQ ID NO. 5-11 to obtain an extension product. After the extension product is purified, mass spectrometry is performed. Determine the genotype, mutation type and / or resistance to pyrethroid insecticides of the kdr gene of the sample to be tested according to the mass-to-charge ratio of the characteristic peak; The method of judging the genotype, mutation type and / or resistance to pyrethroid insecticides of the kdr gene of the sample to be tested according to the mass-to-charge ratio of the characteristic peak is as follows: Among the characteristic peaks with mass-to-charge ratios of m / z 6221.8±1 and 6197.8±1, if the mass spectrum peak contains only the characteristic peak with a mass-to-charge ratio of m / z 6221.8±1, it is judged that the kdr gene at the 1016th position is a wild-type homozygous genotype GTA, which is sensitive to pyrethroid insecticides; if the mass spectrum peak contains the characteristic peak with a mass-to-charge ratio of m / z 6221.8±1 / 6197.8±1, it is judged that the kdr gene at the 1016th position is a wild-type / mutant heterozygous genotype GT / GA, which is resistant to pyrethroid insecticides; if the mass spectrum peak contains only the characteristic peak with a mass-to-charge ratio of m / z 6197.8±1, it is judged that the kdr gene at the 1016th position is a mutant homozygous genotype GGA, which is resistant to pyrethroid insecticides; Among the characteristic peaks with mass-to-charge ratios of m / z 5444.4±1 and 5375.4±1, if the mass spectrum peak contains only the characteristic peak with a mass-to-charge ratio of m / z 5444.4±1, it is judged that the kdr gene at position 1532 is a wild-type homozygous genotype ATC, which is sensitive to pyrethroid insecticides; if the mass spectrum peak contains the characteristic peak with a mass-to-charge ratio of m / z 5444.4±1 / 5375.4±1, it is judged that the kdr gene at position 1532 is a wild-type / mutant heterozygous genotype AT / CC, which is resistant to pyrethroid insecticides; if the mass spectrum peak contains only the characteristic peak with a mass-to-charge ratio of m / z 5375.4±1, it is judged that the kdr gene at position 1532 is a mutant homozygous genotype ACC, which is resistant to pyrethroid insecticides; Among the characteristic peaks with mass-to-charge ratios of m / z 7459.6±1, 6817.2±1, 5566.4±1, 6833.2±1, 6793.2±1, 5526.4±1, 7475.6±1, 5595.4±1, 6655.2±1, and 7552.8±1, if the mass spectrum peak contains a characteristic peak with a mass-to-charge ratio of m / z 7459.6±1 / 6817.2±1 / 5566.4±1 , it is judged that the kdr gene is a wild-type homozygous genotype TTC at position 1534, which is sensitive to pyrethroid insecticides. If the mass spectrum peak contains the special m / z of mass-to-charge ratios of 6817.2±1 / 6833.2±1, 6817.2±1 / 6793.2±1, 5566.4±1 / 5526.4±1, 7459.6±1 / 7475.6±1, 5566.4±1 / 5595.4±1 If the mass spectrum peak contains the mass-to-charge ratio m / z of 6833.2±1 / 6655.2±1, 6793.2±1 / 6655.2±1, 7475.6±1, 6655.2±1 / 75 If the mass spectrum peak contains a characteristic peak with a mass-to-charge ratio of m / z 6833.2±1 / 6793.2±1, it is judged that the kdr gene at the 1534th position is a mutant heterozygous TC / GC, which is resistant to pyrethroid insecticides.

2. The method according to claim 1, characterized in that In the multiplex PCR amplification reaction system, the final concentration of the primers with nucleotide sequences as shown in SEQ ID NO.1-4 is 0.4 μM; And / or, the reaction procedure of the multiplex PCR amplification includes: 94°C, 5 min; 94°C, 30 s, 55°C, 30 s, 72°C, 30 s, for a total of 35 cycles; 72°C, 8 min.

3. The method according to claim 1 or 2, characterized in that: In the reaction system of the mass probe extension reaction, the final concentrations of the probes having nucleotide sequences as shown in SEQ ID NO. 5-11 are 7.15 μM, 8.30 μM, 9.22 μM, 10.12 μM, 6.87 μM, 8.91 μM, and 10.18 μM, respectively; And / or, the reaction procedure of the mass probe extension reaction includes: (1) 95°C, 30s; (2) 95°C, 5s, followed by 52°C, 5s, and 80°C, 5s, for 5 cycles, steps (1) and (2) are performed for a total of 40 cycles; (3) 72°C, 3min.

4. The method according to claim 1 or 2, characterized in that: The reaction procedure of the digestion reaction is: 37° C., 40 min, 85° C., 5 min.

Images