Wheat molecular marker AX-111083649 and its application in improving gluten aggregation properties

Abstract

The present invention discloses a molecular marker AX-111083649 genetically associated with wheat gluten aggregation characteristics, as well as a group of KASP primer sets related to the molecular marker and its application. The molecular marker is located on the long arm of wheat chromosome 3A. There is a T / C allele mutation at the 36th base of the molecular marker sequence. When the 36th base is TT, it is a genotype with strong gluten aggregation characteristics. When the 36th base is CC, it is a genotype with weak gluten aggregation characteristics. Using the KASP primer set as a primer, PCR amplification of the KASP marker is performed using the wheat genome to be tested as a template. Wheat varieties with strong gluten aggregation characteristics can be screened out, which is conducive to using genetic means to change wheat gluten aggregation characteristics. At the same time, positioning and analyzing potential excellent sites significantly associated with gluten aggregation characteristics have important theoretical significance for understanding the molecular mechanism of wheat gluten aggregation characteristics and developing corresponding functional markers.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers of wheat gluten aggregation properties and relates to a wheat molecular marker AX-111083649 and an application thereof in improving gluten aggregation properties. Background Art

[0002] With the development of my country's national economy, the improvement of people's living standards, and changes in consumption patterns, the market demand for high-quality wheat is rapidly increasing. Wheat quality is primarily determined by glutenins and alcohol-soluble proteins, which together impart elasticity and extensibility to dough. Dough rheological properties are key parameters for evaluating protein quality. Traditional methods for testing wheat rheological properties primarily utilize instruments such as glutenometers, farinographs, and extensometers. However, these instruments require wheat samples to undergo moisture adjustment, milling, and post-ripening, resulting in large sample volumes and lengthy measurement cycles. The Glutopeak instrument, based on high shear forces, rapidly measures gluten strength and reflects gluten quality. It features a short measurement time (10 minutes), minimal consumables (10 grams), and high repeatability. Using this instrument significantly shortens testing cycles, improves the efficiency of wheat quality assessment, and provides technical support for early selection in wheat breeding.

[0003] Wheat dough quality is largely influenced by gluten aggregation properties. While extensive research has examined the correlation between various wheat gluten aggregation traits and quality traits, relatively few studies have examined the genetics of wheat gluten aggregation, and its molecular mechanisms remain unclear. Studies have shown that wheat gluten aggregation is primarily determined by genetic factors and is less influenced by environmental factors. Therefore, identifying key genetic loci controlling wheat gluten aggregation and screening for resources containing superior alleles can provide a theoretical basis and material support for high-quality wheat breeding. Summary of the Invention

[0004] To overcome the shortcomings of the existing technology, the present invention utilized previously constructed natural populations and combined them with 660K SNP chip genotype data to initially screen and obtain 224,706 valid SNPs. Simultaneously, gluten aggregation characteristics were phenotypicly determined using Glutopeak in 207 wheat varieties from natural populations across three environments over three years. A genome-wide association study of gluten aggregation characteristics in wheat grains was conducted using a "Q+K" mixed linear model. The results revealed a significant marker, AX-111083649, on the long arm of chromosome 3A, among the SNP markers identified in the aforementioned screening.

[0005] In the first aspect, the present invention provides the application of wheat molecular marker AX-111083649 in improving wheat gluten aggregation characteristics. The wheat molecular marker AX-111083649 is located on the long arm of wheat chromosome 3A, and its 36th base is a T / C polymorphic site. The sequence of the wheat molecular marker AX-111083649 is: TCACAAGCATAATATAGAGTACTTCACAGGTTGATRGAGGTCTCATCGTCCTCACTTCTTCCTACCTCAAA (SEQ ID NO.1), wherein R represents the base T / C; when the 36th base is TT, it is a genotype with strong gluten aggregation characteristics, and when the 36th base is CC, it is a genotype with weak gluten aggregation characteristics.

[0006] In a second aspect, the present invention also provides a substance for detecting the aggregation characteristics of wheat gluten, which is a set of primers for detecting the 36th genotype of the molecular marker AX-111083649 shown in SEQ ID No. 1 on chromosome 3A in the wheat genome, or a detection reagent or kit containing the set of primers.

[0007] Furthermore, the primer set contains two upstream primers and one downstream primer;

[0008] The upstream primers are designed based on the 36th deoxyribonucleotide of the sequence shown in SEQ ID No. 1 on chromosome 3A in the wheat genome and its upstream sequence, and the 3'-terminal deoxyribonucleotide of one of the upstream primers is T, and the 3'-terminal deoxyribonucleotide of the other upstream primer is C;

[0009] The downstream primer is designed according to the downstream sequence of the 36th deoxyribonucleotide of the sequence shown in SEQ ID No. 1 on chromosome 3A in the wheat genome.

[0010] Furthermore, the upstream primers are AX-111083649-F1 and AX-111083649-F2, whose sequences are shown in SEQ ID No. 2 and SEQ ID No. 3, respectively; the downstream primer is AX-111083649-R12, whose sequence is shown in SEQ ID No. 4.

[0011] In a third aspect, the present invention provides the use of the above-mentioned substance in any of the following:

[0012] (A) Identifying or assisting in identifying the aggregation characteristics of wheat gluten;

[0013] (B) Comparison of the strength of the aggregation properties of the wheat gluten tested;

[0014] (C) breeding or selecting wheat plants, lines, varieties or cultivars with relatively strong gluten aggregation properties;

[0015] (D) breeding or selecting wheat plants, lines, strains or varieties with relatively weak gluten aggregation properties;

[0016] (E) preparing a product for identifying or assisting in identifying or comparing the strength of the aggregation properties of wheat gluten to be tested;

[0017] (F) preparing a product for breeding or screening wheat plants, lines, strains or varieties with relatively strong gluten aggregation properties;

[0018] (G) preparing a product for breeding or screening wheat plants, lines, strains or varieties with relatively weak gluten aggregation properties.

[0019] In a fourth aspect, the present invention further provides any of the following methods:

[0020] Method A: A method for comparing the aggregation properties of wheat gluten to be tested, comprising the following steps (A1) or (A2):

[0021] (A1) detecting the genotype of the 36th position of the molecular marker represented by SEQ ID No. 1 on chromosome 3A of the wheat genome;

[0022] (A2) determining the aggregation strength of the wheat gluten to be tested as follows: if the 36th deoxyribonucleotide of the molecular marker shown in SEQ ID No. 1 on chromosome 3A in the genome is a homozygous T, the wheat gluten to be tested has the strongest aggregation strength; if the 36th deoxyribonucleotide of the molecular marker shown in SEQ ID No. 1 on chromosome 3A in the genome is a homozygous C, the wheat gluten to be tested has the weakest aggregation strength;

[0023] Method B: A method for breeding or screening wheat plants, lines, strains, or varieties with relatively strong gluten aggregation properties, comprising the following steps:

[0024] (B1) detecting the genotype of the 36th position of the molecular marker represented by SEQ ID No. 1 on chromosome 3A of the wheat genome;

[0025] (B2) selecting a wheat plant to be tested that is homozygous for T at the 36th deoxyribonucleotide as a parent for breeding, and selecting a wheat plant that is homozygous for T at the 36th deoxyribonucleotide in each breeding generation, ultimately obtaining a wheat plant, plant line, strain, or variety with relatively strong gluten aggregation properties;

[0026] Method C: A method for breeding or screening wheat plants, lines, strains, or varieties with relatively weak gluten aggregation properties, comprising the following steps:

[0027] (C1) detecting the genotype of the 36th position of the molecular marker represented by SEQ ID No. 1 on chromosome 3A of the wheat genome;

[0028] (C2) selecting a wheat plant to be tested in which the 36th deoxyribonucleotide is homozygous for C as a parent for breeding, and selecting a wheat plant in which the 36th deoxyribonucleotide is homozygous for C in each breeding generation, and ultimately obtaining a wheat plant or plant line or line or variety with relatively weak gluten aggregation characteristics.

[0029] Furthermore, the specific operations of (A1)(B1)(C1) are:

[0030] The aforementioned detection reagent or kit is used to perform PCR amplification on the wheat genomic DNA to be tested, the amplified product is subjected to fluorescence signal scanning, the scan data is analyzed, and then the 36th deoxyribonucleotide shown in SEQ ID No. 1 on chromosome 3A in the wheat gene to be tested is determined as follows:

[0031] If the fluorescent signal data of the amplified product of the wheat to be tested is displayed as orange, the 36th deoxyribonucleotide of the molecular marker represented by SEQ ID No. 1 on chromosome 3A in the genome of the wheat to be tested is a homozygous T;

[0032] If the fluorescent signal data of the amplified product of the wheat to be tested is blue, the 36th deoxyribonucleotide of the molecular marker shown by SEQ ID No. 1 on chromosome 3A in the genome of the wheat to be tested is a homozygous C.

[0033] Furthermore, the PCR reaction system was designed as follows: 2×KASP Master Mix, 2.5 μl; Primer Mix, 0.7 μl; MgCl 2 , 0.04 μl; 100 ng / μl DNA, 1 μl; and water, 0.76 μl.

[0034] Compared to existing technologies, the present invention has obtained a significant marker, AX-111083649, on the long arm of chromosome 3A. This molecular marker is associated with the gluten aggregation properties of wheat. Sequence analysis shows that the 36th base of the marker sequence is a T / C allele mutation. The present invention has designed and developed a KASP marker based on the AX-111083649 marker. Genotyping analysis is performed using the polymorphism of this site. PCR amplification of the KASP marker using the wheat genome to be tested is performed, allowing the selection of wheat varieties with strong gluten aggregation properties (TT), facilitating the use of genetic means to modify the gluten aggregation properties of wheat. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the specific embodiments.

[0036] Figure 1 Manhattan plot of the BLUP values ​​of gluten aggregation characteristics in different environments and the SNP distribution on the wheat chromosome group: the red dotted line is -log 10 Threshold line for P = 4;

[0037] Figure 2 This is the KASP marker genotyping diagram; among them: FAM orange fluorescence (lower right circle) shows that the genotype is TT; HEX blue fluorescence (upper left square) shows that the genotype is CC; black fluorescence (lower left square) is a blank control without template DNA;

[0038] Figure 3 The histogram of the gluten aggregation characteristics of the common wheat KASP marker genotype: the orange box shows the gluten aggregation characteristics of the wheat material with the TT genotype; the blue box shows the gluten aggregation characteristics of the wheat material with the CC genotype;

[0039] Figure 4 Box plot of the distribution of gluten aggregation characteristics of common wheat KASP marker genotyping: orange indicates that the genotype is TT, with strong gluten aggregation characteristics; blue indicates that the genotype is CC, with weak gluten aggregation characteristics; ** indicates P < 0.01. DETAILED DESCRIPTION

[0040] The following embodiments of the technical solution of the present invention are described in detail with reference to the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present invention and are therefore only provided as examples and are not intended to limit the scope of protection of the present invention. It should be noted that, unless otherwise specified, the technical terms or scientific terms used in this application should have the common meanings understood by those skilled in the art to which the present invention belongs.

[0041] It should be noted that as a professional agricultural research institution, the applicant has preserved relevant germplasm materials for a long time, and the relevant wheat varieties are publicly available on the market or in existing germplasm banks.

[0042] In preliminary research, the inventors constructed a natural population based on different wheat varieties grown in two locations (Yuanyang (YY) and Shangqiu (SQ)) over three years. After sowing, management, and harvesting according to normal management practices, the inventors used 660K SNP chip genotyping data to preliminarily screen and identify effective SNPs in this natural population, obtaining a total of 224,706 loci. The relevant marker loci in this application fall within this screening range.

[0043] Using Glutopeak, the inventors measured the gluten aggregation phenotypes of 207 wheat varieties in a natural population. Based on these measurement results and the aforementioned SNPs site screening results, the inventors used a "Q+K" mixed linear model to conduct a genome-wide association analysis of the gluten aggregation characteristics in wheat grains, in order to screen for potential excellent sites and genes that are significantly correlated with wheat gluten aggregation characteristics.

[0044] Example 1

[0045] During the screening process, STRUCTURE was used to calculate the population structure of wheat varieties, the Bayesian model was used to divide the population structure, and TASSEL was used to perform population linkage disequilibrium analysis. 10 When P=4, the SNP sites detected in different environments are regarded as significant sites. Some research results are summarized as follows: Figure 1 、 Figure 2 shown.

[0046] Analysis revealed a significant association with the AX-111083649 locus (718,755,069 bp) on the long arm of chromosome 3A, explaining 9.54-11.65% of the phenotypic variation. The marker sequence contained a T / C allele mutation at position 36, with the following nucleotide sequence:

[0047] TCACAAGCATAATATAGAGTACTTCACAGGTTGAT[T / C]GAGGTCTCATCGTCCTCACTTCTTCCTACCTCAAA (SEQ ID NO. 1). Wherein, R is the base T / C; when the 36th base is TT, it is a genotype with strong gluten aggregation properties, and when the 36th base is CC, it is a genotype with weak gluten aggregation properties.

[0048] Example 2

[0049] Based on the nucleotide sequence of the SNP site AX-111083649 identified in Example 1, the inventors further designed a KASP marker. Combined with the genotyping analysis results of some common wheat varieties collected by the inventors and the gluten aggregation phenotypic traits of wheat materials with different genotypes, they screened for wheat materials containing superior alleles, thus laying a foundation for wheat quality improvement. The specific experimental process is briefly described below.

[0050] (1) Primer design

[0051] The primers designed for the marker (AX-111083649) sequence are as follows:

[0052] AX-111083649-F1:

[0053] 5'-GAAGGTGACCAAGTTCATGCTGCATAATATAGAGTACTTCACAGGTTGATT-3'(SEQ IDNO.2),

[0054] AX-111083649-F2:

[0055] 5'-GAAGGTCGGAGTCAACGGATTGCATAATATAGAGTACTTCACAGGTTGATC-3' (SEQ IDNO.3),

[0056] AX-111083649-R12:

[0057] 5'-GAAATCAACAAATGGGATGAGAATTAACCA-3 (SEQ ID NO. 4).

[0058] (2) Genotyping

[0059] First, three primers with a concentration of 10 μmol / L were mixed with water at a volume ratio of 12 (AX-111083649-F1):12 (AX-111083649-F2):30 (AX-111083649-R12):46 (water) to prepare the Primer Mix.

[0060] Then, perform the PCR reaction. The 5 μl reaction system is designed as follows:

[0061] 2×KASP Master Mix, 2.5μl;

[0062] Primer Mix, 0.7 μl;

[0063] MgCl2, 0.04 μl;

[0064] DNA (100 ng / μl), 1 μl;

[0065] water, 0.76 μl;

[0066] The reaction program was as follows: 95°C, 15 min; 95°C, 20 s, 65°C-55°C, 1 min, 10 cycles (1°C lowered for each cycle); 95°C, 20 s, 57°C, 1 min, 30 cycles; 37°C for 1 min; genotyping analysis was performed after the reaction was completed.

[0067] The above KASP markers, reaction system and reaction procedure were used to perform genotyping on 207 common wheat materials collected by the inventors. The specific genotyping results, i.e., the gluten aggregation characteristics results, are as follows: Figure 3 As shown in Table 1 below.

[0068] Table 1. Genotyping of markers and distribution of gluten aggregation characteristics of wheat material AX-111083649 from natural population

[0069]

[0070]

[0071]

[0072]

[0073]

[0074] The Glutopeak test yields nine trait values: PMT (maximum peak time), BEM (maximum torque), AM (torque 15 seconds before BEM), PM (torque 15 seconds after BEM), A1 (area from the start of the test to the first maximum), A2 (area from the first maximum to the first minimum), A3 (area from the first minimum to AM), A4 (area from AM to BEM), and A5 (area from BEM to PM). Experiments have shown that gluten aggregation-related traits measured by the Glutopeak test are significantly correlated with wheat quality traits measured by other instruments. Glutopeak can be used to rapidly evaluate wheat quality and be used for early breeding material selection.

[0075] The results in Table 1 above were further statistically classified, and the results are shown in Table 2 below.

[0076] Table 2 Comparative analysis of gluten aggregation characteristics among different genotypes of AX-111083649 in wheat materials

[0077]

[0078] Combine Figure 3 It can be seen that the two alleles are clearly differentiated, indicating that this marker can effectively separate the allele types in different wheat materials.

[0079] Combining the statistical results in Tables 1 and 2, we can see that the wheat materials with the TT genotype accounted for approximately 58.94%, and the 29.95% of the wheat materials contained the CC genotype. The PMT and A3 values ​​of the wheat materials with the TT genotype ranged from 22.5 to 82 and from 56.5 to 1210.67, respectively, while the PMT and A3 values ​​of the wheat materials with the CC genotype ranged from 22.33 to 60.17 and from 101.83 to 830.83, respectively.

[0080] Combine Figure 4The statistical results show that the gluten aggregation characteristics of wheat materials with the marker genotype TT are stronger, while the gluten aggregation characteristics of wheat materials with the genotype CC are weaker, and the gluten aggregation characteristics between the two genotypes reach a significant difference level.

[0081] Based on the above results, the TT genotype showed significantly stronger gluten aggregation than the CC genotype. This suggests that the TT genotype is an excellent allele for enhancing gluten aggregation in wheat and can be used to screen wheat varieties with strong gluten aggregation properties and improve wheat quality traits.

[0082] Unless otherwise specified, the numerical value set forth in these embodiments does not limit the scope of the present invention. In all examples shown and described here, unless otherwise specified, any specific value should be interpreted as merely exemplary, rather than as restriction, and therefore, other examples of exemplary embodiments can have different values.

Claims

1. Application of a reagent for detecting wheat molecular marker AX-111083649 in identifying wheat gluten aggregation characteristics, characterized in that: The wheat molecular marker AX-111083649 is located on the long arm of wheat chromosome 3A, and its 36th base is a T / C polymorphic site. The sequence of the wheat molecular marker AX-111083649 is: TCACAAGCATAATATAGAGTACTTCACAGGTTGATRGAGGTCTCATCGTCCTCACTTCTTCCTACCTCAAA, wherein R represents the base T / C; when the 36th base is TT, it is a genotype with strong gluten aggregation characteristics, and when the 36th base is CC, it is a genotype with weak gluten aggregation characteristics.

2. A substance for detecting the aggregation characteristics of wheat gluten, characterized in that The substance is a set of primers for detecting the 36th genotype of the molecular marker AX-111083649 shown in SEQ ID No. 1 on chromosome 3A in the wheat genome, or a detection reagent or kit containing the set of primers. The upstream primers of the primer set are AX-111083649-F1 and AX-111083649-F2, whose sequences are shown in SEQ ID No. 2 and SEQ ID No. 3, respectively. The downstream primer is AX-111083649-R12, whose sequence is shown in SEQ ID No.

4.

3. Use of the substance according to claim 2 in any of the following: (A) Identifying or assisting in identifying the aggregation characteristics of wheat gluten; (B) Comparison of the strength of the aggregation properties of the wheat gluten tested; (C) breeding or selecting wheat plants, lines, varieties or cultivars with relatively strong gluten aggregation properties; (D) breeding or selecting wheat plants, lines, strains or varieties with relatively weak gluten aggregation properties; (E) preparing a product for identifying or assisting in identifying or comparing the strength of the aggregation properties of wheat gluten to be tested; (F) preparing a product for breeding or screening wheat plants, lines, strains or varieties with relatively strong gluten aggregation properties; (G) preparing a product for breeding or screening wheat plants, lines, strains or varieties with relatively weak gluten aggregation properties; If the 36th deoxyribonucleotide of the molecular marker shown in SEQ ID No.1 on chromosome 3A in the genome is a homozygous T, the gluten aggregation property of the wheat to be tested is the strongest; if the 36th deoxyribonucleotide of the molecular marker shown in SEQ ID No.1 on chromosome 3A in the genome is a homozygous C, the gluten aggregation property of the wheat to be tested is the weakest.

4. Use any of the following methods: Method A: A method for comparing the aggregation properties of wheat gluten to be tested, comprising the following steps: (A1) detecting the genotype of the 36th position of the molecular marker represented by SEQ ID No. 1 on chromosome 3A of the wheat genome; (A2) determining the aggregation strength of the wheat gluten to be tested as follows: if the 36th deoxyribonucleotide of the molecular marker shown in SEQ ID No. 1 on chromosome 3A in the genome is a homozygous T, the wheat gluten to be tested has the strongest aggregation strength; if the 36th deoxyribonucleotide of the molecular marker shown in SEQ ID No. 1 on chromosome 3A in the genome is a homozygous C, the wheat gluten to be tested has the weakest aggregation strength; Method B: A method for breeding or screening wheat plants, lines, strains, or varieties with relatively strong gluten aggregation properties, comprising the following steps: (B1) detecting the genotype of the 36th position of the molecular marker represented by SEQ ID No. 1 on chromosome 3A of the wheat genome; (B2) selecting a wheat plant to be tested that is homozygous for T at the 36th deoxyribonucleotide as a parent for breeding, and selecting a wheat plant that is homozygous for T at the 36th deoxyribonucleotide in each breeding generation, ultimately obtaining a wheat plant, plant line, strain, or variety with relatively strong gluten aggregation properties; Method C: A method for breeding or screening wheat plants, lines, strains, or varieties with relatively weak gluten aggregation properties, comprising the following steps: (C1) detecting the genotype of the 36th position of the molecular marker represented by SEQ ID No. 1 on chromosome 3A of the wheat genome; (C2) selecting a wheat plant to be tested in which the 36th deoxyribonucleotide is homozygous for C as a parent for breeding, and selecting a wheat plant in which the 36th deoxyribonucleotide is homozygous for C in each breeding generation, and ultimately obtaining a wheat plant or plant line or line or variety with relatively weak gluten aggregation characteristics.

5. The method according to claim 4, characterized in that (A1) or (B1) or (C1) The specific operation is: The detection reagent or kit according to claim 2 is used to perform PCR amplification on the wheat genomic DNA to be tested, the amplified product is scanned for fluorescence signals, the scan data is analyzed, and then the 36th deoxyribonucleotide shown in SEQ ID No. 1 on chromosome 3A in the wheat gene to be tested is determined as follows: If the fluorescent signal data of the amplified product of the wheat to be tested is displayed as orange, the 36th deoxyribonucleotide of the molecular marker represented by SEQ ID No. 1 on chromosome 3A in the genome of the wheat to be tested is a homozygous T; If the fluorescent signal data of the amplified product of the wheat to be tested is blue, the 36th deoxyribonucleotide of the molecular marker shown by SEQ ID No. 1 on chromosome 3A in the genome of the wheat to be tested is a homozygous C.

6. The method according to claim 5, characterized in that The PCR reaction system is designed as follows: 2×KASP Master Mix, 2.5µL; Primer Mix, 0.7µL; MgCl2, 0.04µL; 100ng / µL DNA, 1µL; Water, 0.76µL.

Images