A molecular marker tightly linked to the white trait of celery petioles and its application
By developing a closely linked molecular marker W121X and using PCR amplification technology to identify the color of celery petioles, the problem of difficulty in distinguishing the color of celery petioles in the existing technology is solved, and the breeding efficiency and quality improvement effect is improved.
Patent Information
- Application Number
- CN202210979427.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-16
- Publication Date
- 2025-08-19
- Estimated Expiration
- 2042-08-16
AI Technical Summary
The prior art is difficult to effectively detect and control the color of celery petioles, especially the distinction between white petioles and green petioles, which affects the improvement of celery quality and breeding efficiency.
A primer pair shown in SEQ ID No.1 and SEQ ID No.2 was developed for PCR amplification, using PCR product size and sequence characteristics to distinguish celery petiole color, providing a tightly linked molecular marker W121X for identification of celery petiole color.
It has achieved high accuracy and improved celery petiole color identification, improved celery breeding efficiency, provided a reference for variety improvement, and is suitable for celery breeding and quality improvement.
Smart Images

Figure BDA0003799814900000051 
Figure BDA0003799814900000061 
Figure BDA0003799814900000062
Abstract
Description
Technical Field
[0001] The invention relates to the field of biotechnology, and relates to a molecular marker tightly linked to a white trait of celery petioles and an application thereof. Background Art
[0002] Celery (Apium graveolens L.), also known as dry celery and medicinal celery, is a biennial vegetable crop of the genus Apium in the family Apiaceae. Its chromosome number is 2n = 2x = 22, and it can be grown year-round. It has a long history of cultivation in China and is widely distributed throughout the country. Currently, the main celery varieties used in production in my country include celery root, celery root, and hybrids of celery root and celery root, as well as a smaller amount of root celery. In recent years, the promotion of high-quality, high-yield, disease-resistant, and specialized celery varieties has accelerated. While some local specialty varieties have seen a gradual increase in market share, the cultivation area of improved, widely promoted celery varieties has been declining.
[0003] In the past decade, my country's celery planting area has remained relatively stable at 550,000 hectares. 2 Shandong and Henan have the largest planting areas, reaching 71,000 hectares each. 2 and 55,000 hm 2 . With the improvement of cultivation technology and facilities in various regions of my country and the changes in market consumption demand, the cultivation method of celery has evolved from the initial open-field cultivation to plastic arch shed cultivation, and has now developed into solar greenhouse cultivation. Its production method mostly adopts the form of sowing seedlings and then transplanting. At present, among the existing celery varieties in my country, the petiole colors of celery can be divided into purple, yellow, light green, green and white. In terms of distribution, white petiole celery is mainly distributed in Yunnan, Sichuan, Guizhou, Guangxi and other places. It is characterized by short plants, slender petioles, most of which are hollow, with more fibers and a strong medicinal aroma.
[0004] The petiole is the main edible organ of celery, and its color affects its quality. However, to date, there are very few reports on genes controlling celery petiole color. The applicant previously constructed an F2 segregating population using celery with white and green petioles as parents and found that white petioles are dominant to green petioles and are controlled by a single gene. They developed an SRAP marker, E67M59, linked to white petioles. However, this marker is dominant and cannot distinguish between heterozygous and dominant homozygous white plants, and the linkage distance is relatively long. Therefore, developing a co-dominant molecular marker with a closer linkage distance to white petioles can not only improve celery breeding efficiency, but also provide a reference for improving celery petiole traits. Summary of the Invention
[0005] The technical problem to be solved by the present invention is how to detect the color of celery petioles.
[0006] To solve the above technical problems, the present invention first provides the use of a substance for detecting celery petiole color molecular markers in detecting or assisting in detecting the color traits of celery petioles, wherein the celery petiole color molecular markers are the DNA fragments shown in SEQ ID No.3 and the DNA fragments shown in SEQ ID No.4.
[0007] In the above application, the substance for detecting the molecular marker of celery petiole color can be a primer pair consisting of two single-stranded DNAs shown as SEQ ID No. 1 and SEQ ID No. 2 in the sequence listing.
[0008] The present invention also provides a method for detecting the color trait of celery petioles, which comprises: using the genomic DNA of the celery to be tested as a template, and performing PCR amplification using a primer pair consisting of two single-stranded DNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence list, wherein the petiole color of the homozygous celery with the obtained PCR product sequence being SEQ ID No. 3 is or is a candidate for green, the petiole color of the homozygous celery with the obtained PCR product sequence being SEQ ID No. 4 is or is a candidate for white, and the petiole color of the heterozygous celery with the obtained PCR product sequences being SEQ ID No. 3 and SEQ ID No. 4 is or is a candidate for white.
[0009] The present invention also provides a method for detecting the color trait of celery petioles, which comprises: using the genomic DNA of the celery to be tested as a template, and performing PCR amplification using a primer pair consisting of two single-stranded DNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence list; the petiole color of the homozygous celery with a PCR product size of 163 bp is green or a candidate color; the petiole color of the homozygous celery with a PCR product size of 159 bp is white or a candidate color; and the petiole color of the heterozygous celery with PCR products of 163 bp and 159 bp is white or a candidate color.
[0010] The present invention also provides a celery breeding method, which comprises: using the genomic DNA of the celery to be tested as a template, performing PCR amplification using a primer pair consisting of two single-stranded DNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence list, and selecting the celery to be tested whose PCR product contains SEQ ID No. 4 or whose PCR product contains SEQ ID No. 3 and SEQ ID No. 4 as a parent to complete breeding.
[0011] In the above, the reaction system for PCR amplification using a primer pair consisting of two single-stranded DNAs shown in SEQ ID No.1 and SEQ ID No.2 in the sequence table can be: 0.5 μL of the single-stranded DNA shown in SEQ ID No.1 with a concentration of 10 μmo1 / L; 0.5 μL of the single-stranded DNA shown in SEQ ID No.2 with a concentration of 10 μmo1 / L; 2 μL of genomic DNA; 10 μL of 2×Es TaqMasterMix (Dye); and ddH2O to make up the total volume to 20 μl.
[0012] The reaction conditions for PCR amplification using a primer pair consisting of two single-stranded DNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence listing can be: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, for 35 cycles; and extension at 72°C for 5 min.
[0013] The present invention also provides application of the substance for detecting molecular markers of celery petiole color in preparing a product for detecting the color trait of celery petioles.
[0014] The present invention also provides the use of the celery petiole color molecular marker in detecting or assisting in detecting the color traits of the celery petiole.
[0015] The present invention also provides application of the celery petiole color molecular marker in celery breeding.
[0016] Experiments of the present invention show that the celery petiole color molecular marker of the present invention can identify the color of celery petioles: using a primer pair consisting of two single-stranded DNAs shown in SEQ ID No.1 and SEQ ID No.2 for PCR amplification, celery petioles whose PCR products contain the DNA fragment shown in SEQ ID No.4 and do not contain the DNA fragment shown in SEQ ID No.3 are white, celery petioles whose PCR products contain both the DNA fragment shown in SEQ ID No.4 and the DNA fragment shown in SEQ ID No.3 are white, and celery petioles whose PCR products contain the DNA fragment shown in SEQ ID No.3 and do not contain the DNA fragment shown in SEQ ID No.4 are green. The celery petiole color molecular marker of the present invention has a high accuracy rate in identifying the color of celery petioles and has good application prospects.
[0017] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 Gel images of amplification using primer W121X in the white-petiole parent, the green-petiole parent, and the F1 hybrid of the two. Note: A: Upper band, CE82L, the green-petiole celery parent; B: Lower band, CE72W, the white-petiole celery parent; H: Heterozygous, F1 hybrid of the white-petiole parent and the green-petiole parent.
[0019] Figure 2 The genetic distance between W121X and the celery white petiole gene WH (0.4 cM).
[0020] Figure 3 Verification of W121X using 44 celery accessions with known petiole colors. Note: A: Upper band, green petiole; B: Lower band, white petiole; H: Heterozygous, white petiole. DETAILED DESCRIPTION
[0021] The experimental methods in the following examples, unless otherwise specified, are all conventional methods and are carried out in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels. The quantitative tests in the following examples were all repeated three times, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.
[0022] The celery white petiole parent CE72W and the celery green petiole parent CE82L in the following examples are both described in "Han Q, Wang S, Yang WC, Shen HL (2012). Inheritance of white petiole in celery and development of a tightly linked scar marker. Plant Breeding, 131(2): 340-344". The public can obtain the biological material from the applicant. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.
[0023] Example 1
[0024] 1. Acquisition of molecular marker W121X
[0025] 1. Construction of positioning groups
[0026] This experiment used the F2 population 21Q68, constructed from the white-petioled celery parent CE72W and the green-petioled celery parent CE82L. The population size was 461 plants. The petiole color of each plant was analyzed, and the number of plants with white petioles in the population was 345, while the number of plants with green petioles was 116. Celery genomic DNA was extracted using a modified CTAB method.
[0027] 2. Molecular marker development
[0028] BSA resequencing was performed on 30 individual plants with white petioles (CE72W), 30 individual plants with green petioles (CE82L), and 21Q68 F2 population, and relevant molecular markers were developed based on the resequencing results.
[0029] 3. Acquisition of molecular marker W121X
[0030] Based on the results of BSA resequencing association, primers were designed on chromosome 4. Polymorphic primer screening was performed using the celery white petiole parent CE72W, the green petiole parent CE82L, the white petiole mixed pool (30 white petioles were selected from the F2 population 21Q68 for the mixed pool), and the green petiole mixed pool (30 green petioles were selected from the F2 population 21Q68 for the mixed pool) as templates. After screening, it was found that the molecular marker W121X had stable polymorphism between the above parents and the mixed pool, and the bands amplified by PCR with the primers of this marker were clear and significantly different ( Figure 1 Specifically, the amplified product from the white parent's genomic DNA was a 159 bp fragment, the amplified product from the green petiole parent's DNA was a 163 bp fragment, the amplified products from the white petiole pooled DNA were both 159 bp and 163 bp fragments, and the amplified product from the green petiole pooled DNA was a 163 bp fragment. Sequencing revealed that the sequences of the 163 bp amplified products were all (SEQ ID No. 3), and the sequences of the 159 bp amplified products were all (SEQ ID No. 4).
[0031] The primer sequences are as follows:
[0032] W121X-F: 5'-GATCTACTAGTGTTCTTACGAGC-3' (SEQ ID No. 1);
[0033] W121X-R: 5'-ACTCTCTAGGGGAATGAACTATAAG-3' (SEQ ID No. 2).
[0034] PCR amplification system: 2 μL of genomic DNA, 10 μL of 2× EsTaq MasterMix (Dye) (Beijing Kangwei Century; Catalog No.: CW0690L), 0.5 μL each of W121X-F and W121X-R (10 μM), and the total volume was made up to 20 μL with 7 μL of ddH2O;
[0035] PCR amplification conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min.
[0036] W121X amplified sequence:
[0037] A: Upper band (163 bp amplification product):
[0038] GATCTACTAGTGTTCTTACGAGCATGTGTATCATTATTGTGGGATGTACTATGTGAGTGTGTGTGTGTGTGTTAGTCGCTAAACACACGCTAAAATACACGCAAATATACGCGTTCATAAGTAATATATAATATCTTATAGTTCATTCCCCTAGAGAGT (SEQ ID No. 3);
[0039] B: Lower band (159 bp amplification product):
[0040] GATCTACTAGTGTTCTTACGAGCATGTGTATCATTATTGTGGGATGTACTATGTGAGTGTGTGTGTGTGTTAGTCGCTAAACACACGCTAAAATACACGCAAATATACGCGTTCATAAGTAATATATAATATCTTATAGTTCATTCCCCTAGAGAGT (SEQ ID No. 4).
[0041] The PCR products were electrophoresed on 7% non-denaturing polyacrylamide gel, stained with silver nitrate, and photographed. The PCR amplification products were then sequenced.
[0042] 4. Genetic linkage analysis
[0043] The polymorphic molecular marker W121X obtained by screening was used to analyze the genotypes of 461 individuals in the F2 population 21Q68. Combined with the petiole color phenotype identification results of the F2 population 21Q68, the results showed that the linkage distance between the molecular marker W121X and the white petiole gene was 0.4 cM ( Figure 2 ).
[0044] The homozygous celery containing the 159bp DNA fragment but not the 163bp DNA fragment in the amplified product was recorded as the BB genotype celery, the homozygous celery containing the 163bp DNA fragment but not the 159bp DNA fragment in the amplified product was recorded as the AA genotype celery, and the heterozygous celery containing both the 163bp DNA fragment and the 159bp DNA fragment in the amplified product was recorded as the AB genotype celery.
[0045] Among the 461 individual plants of the F2 population 21Q68, there were 116 celery plants of the AA genotype, with petioles of all plants green except one that was white; there were 115 celery plants of the BB genotype, with petioles of all plants white; and there were 230 celery plants of the AB genotype, with petioles of all plants white except one that was green (Tables 1-4).
[0046] The above results showed that the polymorphic molecular marker W121X is a molecular marker for celery petiole color, and this molecular marker can be used to identify the color of celery petioles: PCR amplification using the primer pair consisting of W121X-F and W121X-R showed that the celery petioles whose PCR products contained the DNA fragment shown by SEQ ID No. 4 but did not contain the DNA fragment shown by SEQ ID No. 3 were white; the celery petioles whose PCR products contained both the DNA fragment shown by SEQ ID No. 4 and the DNA fragment shown by SEQ ID No. 3 were white; and the celery petioles whose PCR products contained the DNA fragment shown by SEQ ID No. 3 but did not contain the DNA fragment shown by SEQ ID No. 4 were green.
[0047] Table 1. Identification results of genotype and phenotype of 21Q68 in F2 population
[0048]
[0049]
[0050] Table 2. Identification results of genotype and phenotype of 21Q68 in F2 population
[0051]
[0052]
[0053] Table 3. Identification results of genotype and phenotype of 21Q68 in F2 population
[0054]
[0055]
[0056] Table 4. Identification results of genotype and phenotype of 21Q68 in F2 population
[0057]
[0058]
[0059] Note: In Tables 1-4, h: AB heterozygous genotype; b: BB genotype; a: AA genotype.
[0060] 2. Application of molecular marker W121X
[0061] 1. Test materials
[0062] The molecular marker W121X was validated using 44 celery accessions with known petiole colors (Table 5). The celery accessions were obtained from the College of Horticulture, China Agricultural University.
[0063] Table 5. Verification results of W121X in 44 celery samples
[0064]
[0065]
[0066] 2. Test methods
[0067] Genotyping of the test materials was performed using the molecular marker W121X, using the genomic DNA of the test materials as the template. The PCR amplification system and conditions were the same as in step 1.
[0068] 3. Test results
[0069] The marker W121X was used to test the genotypes of 44 celery materials with known petiole colors stored in the laboratory. The results showed that the success rate of the 44 inbred line materials using the W121X marker was 95.5% ( Figure 3 ); This indicates that this marker has strong applicability and can be used to quickly identify the color of celery petioles in practical breeding applications.
[0070] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.
Claims
1. A method for detecting the color characteristics of celery petioles, comprising: The genomic DNA of the celery to be tested is used as a template, and PCR amplification is performed using a primer pair consisting of two single-stranded DNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence list. The petiole color of the homozygous celery with the obtained PCR product sequence of SEQ ID No. 3 is green or a candidate color, the petiole color of the homozygous celery with the obtained PCR product sequence of SEQ ID No. 4 is white or a candidate color, and the petiole color of the heterozygous celery with the obtained PCR product sequences of SEQ ID No. 3 and SEQ ID No. 4 is white or a candidate color.
2. A method for detecting the color characteristics of celery petioles, comprising: The genomic DNA of the celery to be tested was used as a template, and PCR amplification was performed using a primer pair consisting of two single-stranded DNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence list. The obtained PCR product size was 163 bp, and the petiole color of the homozygous celery was green or candidate green. The obtained PCR product size was 159 bp, and the petiole color of the homozygous celery was white or candidate white. The obtained PCR products size were 163 bp and 159 bp, and the petiole color of the heterozygous celery was white or candidate white.
3. Celery breeding method, comprising: The genomic DNA of the celery to be tested is used as a template, and a primer pair consisting of two single-stranded DNAs shown in SEQ ID No. 1 and SEQ ID No. 2 in the sequence table is used for PCR amplification. The celery to be tested whose PCR product is SEQ ID No. 4 or whose PCR product contains SEQ ID No. 4 is selected as the parent to complete the breeding.