A method for rapid detection of Trichoderma harzianum in shiitake mushroom sticks

Abstract

The invention discloses a method for rapidly detecting the pathogen of mushroom stick rot, Trichoderma harzianum ( Trichoderma harzianum ) method, using a hypothetical protein gene sequence of the target fungus (GenBank: ON321836) as a specific molecular marker, primers that can specifically amplify Trichoderma harzianum were designed, and the sensitivity of the primers was verified. Using specific primers, the potential target pathogenic fungi in the factory environment can be quickly detected by PCR amplification. This method can be used to quickly identify and detect Trichoderma harzianum in the factory cultivation environment, providing a strong guarantee for the prevention and control of mushroom stick rot.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial detection, and particularly relates to a method for rapidly detecting Trichoderma harzianum infecting shiitake mushroom hyphae in shiitake mushroom sticks. Background Art

[0002] The factory-based centralized stick making and year-round mushroom production model has the advantages of high efficiency, high quality and low cost, and has made great progress in my country. However, under this model, the production standards and culture conditions of mushroom sticks are highly consistent, and once a mushroom stick disease occurs, it is very easy to break out on a large scale. It has been found that a kind of Trichoderma harzianum can infect the mycelium of mushroom sticks, causing mushroom stick rot. During the peak period of the disease, the incidence rate is as high as 30%-40%, resulting in a significant reduction in mushroom production and quality damage. Keeping the production environment clean, timely detecting pathogenic fungi and disinfecting them are the core effective measures to prevent and control this mushroom disease. Therefore, it is necessary to develop a method that can quickly and accurately detect Trichoderma harzianum.

[0003] Nucleic acid testing is a commonly used method for fungal identification. The identification process is to use universal primers to perform polymerase chain reaction on the target fungal DNA, and perform Sanger sequencing on the amplified products. The sequencing results are then compared with the database to identify the target fungi at the genus and species levels. In order to monitor pathogenic fungi during factory cultivation of shiitake mushrooms, it is necessary to quickly detect the presence of pathogenic fungi in media containing a variety of fungi (such as air, water, and culture media). If nucleic acid detection methods are used, it is necessary to first perform pure culture of a variety of fungi, and then conduct molecular biological identification. The whole process is time-consuming and costly.

[0004] Specific molecular marker detection is a method for rapid and accurate detection of target microorganisms, which can specifically detect target microorganisms in mixed microbial DNA samples. Compared with conventional nucleic acid detection methods, it eliminates the tedious process of continuously isolating microorganisms in the sample to be tested, and identification can be performed without obtaining pure cultures of target microorganisms. Moreover, the products of the polymerase chain reaction do not need to be sequenced and compared, and only gel electrophoresis detection can be performed to determine whether the target microorganism exists. It has the advantages of being fast, efficient, and accurate. Summary of the invention

[0005] The invention discloses a method for rapidly detecting Trichoderma harzianum infecting shiitake mushroom mycelia in shiitake mushroom sticks. A hypothetical protein gene sequence (GenBank: ON321836, the sequence is shown in SEQID NO.1) of the target fungus is used as a specific molecular marker to design primers that can specifically amplify Trichoderma harzianum. Using the specific primers, the potential target pathogenic fungi in the factory environment can be rapidly detected by PCR amplification. This method can be used to rapidly identify and detect Trichoderma harzianum in the factory cultivation environment, providing a strong guarantee for the prevention and control of shiitake mushroom stick rot.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0007] A hypothetical protein gene sequence of Trichoderma harzianum (GenBank: ON321836, sequence shown in SEQ ID NO.1) was used as a specific molecular marker, and specific primers ThHP-F (5'-CATCTACACATACACGCTTGGC-3') and ThHP-F (5'-CCAGGCTCCACATAGTGATAC-3') were designed.

[0008] A method for rapidly detecting Trichoderma harzianum infecting shiitake mushroom mycelium in shiitake mushroom sticks comprises the following steps:

[0009] (1) collecting culture medium of Lentinus edodes spawn sticks at the spawning or fruiting stage, and extracting total DNA from the culture medium;

[0010] (2) Using the total DNA of the culture medium as a template, PCR amplification was performed using primers ThHP-F and ThHP-F;

[0011] (3) The amplified product is subjected to nucleic acid electrophoresis detection. If a specific amplified band of 610 bp is detected in the culture medium sample, it indicates that Trichoderma harzianum is present in the culture medium.

[0012] Preferably, the PCR reaction conditions are: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 56°C for 20 s, extension at 72°C for 50 s, 30 cycles; extension at 72°C for 3 min, and storage at 4°C.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] 1. The present invention obtains a specific protein of Trichoderma harzianum (Hypothetical protein: PKK50283.1) by comparing the proteomes of different species of Trichoderma, and then designs primers (ThHP-F, ThHP-F) that can specifically amplify Trichoderma harzianum based on the gene ThHP (GenBank: ON321836) encoding the specific protein of Trichoderma harzianum. The primers are used to amplify the total DNA of the shiitake mushroom stick culture material in the germination or fruiting stage, and a specific sequence of Trichoderma harzianum with a length of 610bp can be obtained. The ThHP gene can be used to distinguish and identify the target fungus from common fungi in the factory environment and other closely related species of Trichoderma harzianum, providing a reference for interspecies identification of Trichoderma harzianum.

[0015] 2. The PCR amplification method can be used to quickly detect whether the pathogenic fungus Trichoderma harzianum is present in the culture medium of shiitake mushroom sticks during the spawning or fruiting stage. Timely measures can effectively prevent and control the shiitake mushroom stick rot disease that breaks out during factory cultivation, and also solve the shortcoming of poor timeliness of traditional prevention and control methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is the electrophoresis diagram after amplification with ITS primers in Example 1. M: BM2000 Marker; Lane 6 is the amplification result of Trichoderma harzianum genome; Lanes 1-5, 7-10 are the amplification results of 9 reference fungal genomes; Lane 11 is the sterile water negative control.

[0017] Figure 2 It is the electrophoresis diagram after ThHP primer amplification in Example 1. M: BM2000 Marker; Lane 6 is the amplification result of Trichoderma harzianum genome; Lanes 1-5, 7-10 are the amplification results of 9 reference fungal genomes; Lane 11 is the sterile water negative control.

[0018] Figure 3 It is the result of the ThHP primer sensitivity test in Example 2. M: BM2000 Marker, lanes 1-12 are the DNA contents of Trichoderma harzianum (T. harzianum) in the PCR reaction system, which are 40, 20, 10, 5, 2.5, 1.26, 0.62, 0.32, 0.16, 0.08, 0.04, 0 ng, respectively.

[0019] Figure 4It is the detection result of Trichoderma harzianum in the diseased sample in Example 2. M: BM2000 Marker; Lane 1 is the result of amplifying the total DNA of the culture medium of the diseased part of the mushroom stick with ThHP primer, Lane 2 is the result of amplifying the genomic DNA of Trichoderma harzianum, and Lane 3 is the negative control of sterile water. DETAILED DESCRIPTION

[0020] Example 1: Specific primer design

[0021] Eight protein groups of Trichoderma harzianum and its five closely related species were downloaded from NCBI for comparison (Trichoderma harzianum, GCA_000988865.1; Trichoderma harzianum, GCA_002838845.1; Trichoderma harzianum, GCA_003025095.1; Trichoderma atroviride, GCF_000171015.1; Trichodermacoru damae, GCA_020631695.1; Trichoderma gamsli, GCF_001481775.2; Trichoderma masemiorbis, GCA_020045945.2; Trichoderma arundinaceunm, GCA_003012105.1), and multiple Trichoderma harzianum-specific proteins were obtained. One of the proteins (hypothetical The gene sequence was then compared with eight Trichoderma harzianum genomes to ensure that the sequence was unique to Trichoderma harzianum.

[0022] According to the specific sequence of Trichoderma harzianum (SEQ ID NO.1), specific primers ThHP-F and ThHP-R were designed using Primer5 software. Specific primers (ThHP-F, ThHP-R) and universal primers (ITS1: TCCGTAGGTGAACCTGCGG, ITS4: TCCTCCGCTTATTGATATGC) were used to amplify genomic DNA of Trichoderma harzianum and 9 fungi (Trichoderma asperellum, Trichoderma citrinoviride, Trichoderma viride, Trichoderma longibranchiatum, Trichoderma atroviride, Trichoderma harzianum, Mucor plumbeus, Penicllium fellutanum, Aspergillustamarii, Lentinula edodes). ITS primers can amplify clear bands from genomic DNA of 10 fungi (see Figure 1 ), indicating that the quality of the 10 fungal DNA samples was good. However, the ThHP primer could only amplify a 610 bp band from the genomic DNA of T. hasrzianum (see Figure 2 ), indicating that primers ThHP-F and ThHP-R can specifically detect the presence of Trichoderma harzianum.

[0023] The PCR reaction system was 20 μL in total, including 10 μL of 2×SanTag PCR Mix (Sangon Biotechnology (Stock) Co., Ltd.), 1 μL of upstream and downstream primers (10 μmol / L), 2 μL of DNA template, and ddH 2 O 6μL.

[0024] PCR program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 56°C for 20 s, extension at 72°C for 50 s, 30 cycles; extension at 72°C for 3 min, storage at 4°C.

[0025] Table 1

[0026]

[0027] Example 2: Detection of Trichoderma harzianum using specific primers

[0028] Sensitivity test: 40, 20, 10, 5, 2.5, 1.26, 0.62, 0.32, 0.16, 0.08, 0.04, 0 ng of T.harzianum genomic DNA were added to each PCR reaction system for primer sensitivity test. The results showed that the sensitivity of ThHP primers was very high, and the target band could be amplified with only 0.04 ng of DNA template in a 20 μL system (see Figure 3 ).

[0029] Application example: The inventor collected culture medium from the diseased part of shiitake mushroom sticks in the mushroom shed of Shandong Qihe Biotechnology Co., Ltd. Weigh 500 mg of culture medium and use Molpure Soil DNA Kit (purchased from Yisheng Biotechnology Shanghai Technology Co., Ltd.) to extract total DNA from the culture medium. 2 O The DNA extracted by the kit was diluted 10 times and used as a template for the PCR system. ThHP-F and ThHP-R were used as upstream and downstream primers to amplify the target segment. The PCR product was electrophoresed in a 3% agarose gel. A single PCR product of 610 bp was detected in the culture medium DNA sample (see Figure 4 ), indicating that the pathogen Trichoderma harzianum (T.harzianum) is present in the culture medium.

Claims

1. Used to detect Trichoderma harzianum in shiitake mushroom sticks ( Trichoderma harzianum ), characterized in that The primer sequences were 5′-CATCTACACATACACGCTTGGC-3′ and 5′-CCAGGCTCCACATAGTGATAC-3′.

2. Detection of Trichoderma harzianum in shiitake mushroom sticks using the primers described in claim 1 Trichoderma harzianum ), characterized in that The following steps are involved: (1) Collecting culture medium of Lentinus edodes spawn and extracting total DNA of the culture medium; (2) using the total DNA of the culture medium as a template and performing PCR amplification using the primers described in claim 1; (3) The amplified product is subjected to nucleic acid gel electrophoresis. If a specific amplified band of 610 bp is detected, the culture medium contains Trichoderma harzianum ( Trichoderma harzianum ).

3. The method according to claim 2, characterized in that the PCR program is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 56°C for 20 s, extension at 72°C for 50 s, 30 cycles; extension at 72°C for 3 min, and storage at 4°C.

Images