CTLA-4 binding molecules and their applications

Abstract

The present invention relates to CTLA-4 binding molecules and their applications. The CTLA-4 binding molecules of the present invention comprise anti-CTLA-4 single-domain antibodies, wherein the complementary determining regions CDR of the single-domain antibodies comprise CDR1, CDR2 and CDR3, wherein CDR1 comprises the sequence shown in SEQ ID NO:1, CDR2 comprises the sequence shown in SEQ ID NO:2, and CDR3 comprises the sequence shown in SEQ ID NO:3. The present invention also provides the coding sequence, expression vector, and corresponding host cells, pharmaceutical compositions and uses of the CTLA-4 binding molecules. The CTLA-4 binding molecules of the present invention can bind to the extracellular region of CTLA-4 with high specificity, have high affinity and biological activity, as well as low immunogenicity, stable structure and good drugability.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine or biopharmaceutical technology, and more specifically to a cytotoxic T-lymphocyte associated antigen 4 (CTLA-4) binding molecule and its application. The CTLA-4 binding molecule of the present invention can bind to the CTLA-4 extracellular region with high specificity, has high affinity and biological activity, low immunogenicity, stable structure, and good drugability. Background Art

[0002] T cell activation requires two signals: the first signal is initiated by the T cell receptor complex (TCR) recognizing the antigen peptide-MHC complex (p-MHC) on the surface of APC (Weiss, J. Clin. Invest. 86: 1015 (1990)); the second signal is initiated by the interaction of co-stimulatory molecules between T cells and APC (Schwartz, Science 248: 1349 (1990)). The most important pair of co-stimulatory molecules is the binding between the B7 molecule expressed on the surface of professional APC and the dimer molecule CD28 on the surface of T cells. CD28 transmits signals to T cells to initiate T cell responses, including promoting the production of IL-2 molecules and the differentiation of initial T cells into effector T cells and memory T cells.

[0003] Cytotoxic T-lymphocyte associated antigen 4 (CTLA-4) and CD28 molecules are both T cell surface co-stimulatory receptors and belong to the B7 molecule family. CTLA-4 molecules are also members of the immunoglobulin (Ig) superfamily and contain a single extracellular Ig domain; CTLA-4 contains a 6-amino acid sequence MYPPPY, which has 70% homology with the CD28 molecular structure, and both bind to the same ligands, namely B7-1 (CD80) and B7-2 (CD86). However, the role of CTLA-4 molecules is opposite to that of CD28 molecules. CD28 molecules are expressed in resting or active T cells, and after binding to ligands, they promote T cell activation and cytokine production; while CTLA-4 is only expressed in activated T cells, with its peak occurring about 24 hours after T cell activation, and is almost undetectable in resting T cells. It has the effect of inhibiting T cell proliferation and reducing the production of cytokine IL-2, and is related to maintaining the body's immune homeostasis and peripheral tolerance function (Linsley PS et al. J Exp Med, 1992, 176 (6): 1595-1604; Bour-Jordan H et al. Immunol Rev, 2011, 241 (1): 180-205.). CTLA-4 is also found in regulatory T cells (treg) and contributes to their inhibitory function. At the same time, CTLA-4 has a higher binding affinity than CD28, which makes it a potential treatment for autoimmune diseases.

[0004] Given the immunosuppressive function of CTLA-4 molecules, blocking CTLA-4 can enhance the activation and proliferation of T cells. Currently, drug development targeting CTLA-4 molecules is mainly based on fusion proteins, monoclonal antibodies, bispecific antibodies, etc., which are used to treat autoimmune diseases and tumors respectively. At present, there are 2 CTLA-4 fusion proteins and 1 CTLA-4 antibody on the market worldwide, namely Orencia (Abatacept) launched in 2005, Nulojix (Belatacept) launched in 2011, and Yervoy (ipilimumab). Among them, Abatacept fusion protein is approved for the treatment of rheumatoid arthritis, which can effectively improve symptoms and signs and delay the progression of joint radiology; Belatacept is approved for the prevention of acute rejection in adult renal transplant recipients. And ipilimumab monoclonal antibody is approved for combination with nivolumab for the treatment of cancers including melanoma, renal cancer, lung cancer, colorectal cancer, etc., showing better anti-tumor effects than single antibodies. In terms of bispecific antibodies, Alphamab has developed a bispecific antibody (KN046) targeting CTLA-4 and PD-L1, which has entered Phase I clinical trials in Australia. The antibody has also obtained the Phase I clinical approval from the China National Medical Products Administration and will enter domestic clinical trials. KN046 is targeted for use in the tumor microenvironment, thereby reducing side effects on the human peripheral system. In preclinical studies, KN046 has excellent anti-tumor efficacy and significantly reduced toxicity compared to the existing CTLA-4 antibody ipilimumab. Ongoing clinical trials have also shown its good tolerability in humans.

[0005] Nanoantibodies have natural advantages such as easy expression, high stability, and high affinity. Based on the advantages of nanoantibodies themselves and the biological mechanism of CTLA-4, the development of CTLA-4 nanoantibodies has very broad application prospects. Summary of the invention

[0006] The object of the present invention is to provide CTLA-4 binding molecules and applications thereof.

[0007] In a first aspect, the present invention provides a CTLA-4 binding molecule comprising an anti-CTLA-4 single domain antibody, wherein the complementarity determining region CDR of the single domain antibody comprises CDR1, CDR2 and CDR3, wherein CDR1 comprises the sequence shown in SEQ ID NO:1, CDR2 comprises the sequence shown in SEQ ID NO:2, and CDR3 comprises the sequence shown in SEQ ID NO:3.

[0008] In one or more embodiments, SEQ ID NO: 1 is GX1X2X3X4X5X6X7, wherein X1 is S, L, D, F or G, X2 is T, N or S, X3 is L, F or S, X4 is D, G or E, X5 is P, I, S, D or Y, X6 is F, Y, H, Q or W, and X7 is V, D, A or S.

[0009] In one or more embodiments, CDR1 comprises the sequence shown in any one of SEQ ID NOs: 4-10.

[0010] SEQ ID NO:2 is X1X2X3X4X5X6X7X8, wherein X1 is I or M, X2 is N, G, S or R, X3 is R, P, S or G, X4 is S, N, D or T, X5 is R or G, X6 is T, A, D, E, R, G or L, X7 is I, F, T, S, G, R or none, and X8 is T or none.

[0011] In one or more embodiments, CDR2 comprises the sequence shown in any one of SEQ ID NOs: 11-18.

[0012] In one or more embodiments, SEQ ID NO:3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X16X 17 X 18 X 19 X 20 X 21 X 22 , wherein X1 is A, G or T, X2 is A, L, S or G, X3 is S, G, E, V, A or K, X4 is P, R or L, X5 is D, E, L, T, I or A, X6 is K, R, V, L, S or H, X7 is P, A, Y, F, G or Q, X8 is F, H, T, V or S, X9 is Y, S, L, A, H or M, X 10 is T, I, C, A or W, X 11 D, Y, S, L or V, X 12 is Q, A, L, M or C, X 13 is T, S, N or C, X 14 M, E, H, Q, A or none, X 15 C, Y, G, H, A, N or None, X 16 N, D, M, Y, S, E or None, X 17 K, I, Y, R, F or None, X 18 H, D, S, G or none, X19 Y, T, D, L or none, X 20 Y or None, X 21 G or None, X 22 Is Y or None.

[0013] In one or more embodiments, CDR3 comprises the sequence shown in any one of SEQ ID NOs: 19-26.

[0014] In one or more embodiments, the CDR1 of the single domain antibody comprises the sequence shown in any one of SEQ ID NOs: 4-10, the CDR2 comprises the sequence shown in any one of SEQ ID NOs: 11-18, and the CDR3 comprises the sequence shown in any one of SEQ ID NOs: 19-26.

[0015] In one or more embodiments, the single domain antibody contains CDR1, CDR2 and CDR3 shown in SEQ ID NO of any one of the following groups a1 to a9:

[0016] Group CDR1 CDR2 CDR3 a1 4 11 19 a2 4 12 20 a3 4 12 20 a4 5 13 21 a5 6 14 22 a6 7 15 23 a7 8 16 24 a8 9 17 25 a9 10 18 26 .

[0017] In one or more embodiments, the FR1 of the single-domain antibody VHH can be selected from the FR1 of any VHH of SEQ ID NOs: 27-73, the FR2 of the VHH can be selected from the FR2 of any VHH of SEQ ID NOs: 27-73, the FR3 of the VHH can be selected from the FR3 of any VHH of SEQ ID NOs: 27-73, and the FR4 of the VHH can be selected from the FR4 of any VHH of SEQ ID NOs: 27-73.

[0018] In one or more embodiments, the FR region of the single domain antibody is a FR region of any VHH selected from SEQ ID NOs: 27-73.

[0019] In one or more embodiments, the single domain antibody VHH is as shown in any one of SEQ ID NOs: 27-73.

[0020] In one or more embodiments, the CTLA-4 binding molecule is a monovalent or multivalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody or an antigen-binding fragment thereof, an antibody or an antigen-binding fragment thereof comprising one, two or more anti-CTLA-4 single domain antibodies described herein.

[0021] In one or more embodiments, the multivalent single domain antibody or multispecific single domain antibody is connected to multiple single domain antibodies via a linker. The linker consists of 1-15 amino acids selected from G and S.

[0022] In one or more embodiments, the antigen-binding fragment of the heavy chain antibody is a single-chain heavy chain antibody.

[0023] In one or more embodiments, the heavy chain antibody is a camelid heavy chain antibody or a cartilaginous fish heavy chain antibody.

[0024] In one or more embodiments, the heavy chain antibody further comprises a heavy chain constant region.

[0025] In one or more embodiments, the heavy chain constant region is a constant region of a camel heavy chain antibody, comprising CH2 and CH3. In one or more embodiments, the CH2 and CH3 are CH2 and CH3 of human IgG Fc, such as CH2 and CH3 of IgG1 or IgG4. Preferably, the heavy chain constant region is CH2 and CH3 of IgG4, and its amino acid sequence is shown in SEQ ID NO:74.

[0026] In one or more embodiments, the heavy chain constant region is a constant region of a cartilaginous fish heavy chain antibody, comprising CH1, CH2, CH3, CH4 and CH5.

[0027] In one or more embodiments, the antibody is an antibody comprising the anti-CTLA-4 single domain antibody as a heavy chain variable domain.

[0028] In one or more embodiments, the antibody further comprises a light chain variable domain, a heavy chain constant domain, and a light chain constant domain.

[0029] In one or more embodiments, the antigen-binding fragment of an antibody is selected from Fab, F(ab')2, Fv, scFv.

[0030] In one or more embodiments, the binding molecule described in any embodiment of the present invention is a chimeric antibody or a fully human antibody; preferably a fully human antibody.

[0031] The present invention also provides a polynucleotide selected from:

[0032] (1) the coding sequence of the single domain antibody described in any embodiment of the present invention or the antibody or antigen-binding fragment thereof described herein;

[0033] (2) the complementary sequence of (1);

[0034] (3) A 5-50 bp fragment of any of the sequences in (1) or (2).

[0035] In one or more embodiments, the fragment is a primer.

[0036] The present invention also provides a nucleic acid construct comprising the polynucleotide described herein.

[0037] In one or more embodiments, the nucleic acid construct is a recombinant vector or an expression vector.

[0038] The present invention also provides a phage comprising the CTLA-4 binding molecule described in any embodiment herein.

[0039] In one or more embodiments, the CTLA-4 binding molecule is displayed on the surface of the bacteriophage.

[0040] The present invention also provides a host cell selected from:

[0041] (1) expressing a CTLA-4 binding molecule as described in any embodiment of the present invention;

[0042] (2) comprising a polynucleotide as described herein; and / or

[0043] (3) comprising the nucleic acid construct described herein.

[0044] The present invention also provides a method for producing a CTLA-4 binding molecule, comprising: culturing the host cell described herein under conditions suitable for producing a CTLA-4 binding molecule (e.g., a monovalent or multivalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody, an antibody or an antigen-binding fragment thereof), and optionally purifying the CTLA-4 binding molecule from the culture.

[0045] The present invention also provides a pharmaceutical composition comprising the CTLA-4 binding molecule, polynucleotide, nucleic acid construct, phage or host cell described in any embodiment of the present invention, and a pharmaceutically acceptable excipient.

[0046] In one or more embodiments, the pharmaceutical composition is used to treat cancer.

[0047] In one or more embodiments, the cancer is a CTLA-4-related cancer. Preferably, the cancer is selected from the group consisting of lung cancer, ovarian cancer, colon cancer, rectal cancer, melanoma, kidney cancer, bladder cancer, breast cancer, liver cancer, lymphoma, malignant blood disease, head and neck cancer, glioma, gastric cancer, nasopharyngeal cancer, laryngeal cancer, cervical cancer, uterine body cancer, osteosarcoma, etc.

[0048] The present invention also provides use of the CTLA-4 binding molecule described in any embodiment herein in the preparation of a medicament for preventing or treating cancer.

[0049] In one or more embodiments, the cancer is a CTLA-4-related cancer. Preferably, the cancer is selected from the group consisting of lung cancer, ovarian cancer, colon cancer, rectal cancer, melanoma, kidney cancer, bladder cancer, breast cancer, liver cancer, lymphoma, malignant blood disease, head and neck cancer, glioma, gastric cancer, nasopharyngeal cancer, laryngeal cancer, cervical cancer, uterine body cancer, osteosarcoma, etc.

[0050] The present invention also provides a method for treating or preventing cancer, comprising administering to a patient in need thereof a therapeutically effective amount of the CTLA-4 binding molecule described in any embodiment of the present invention, or a pharmaceutical composition containing the CTLA-4 binding molecule described in any embodiment of the present invention.

[0051] In one or more embodiments, the cancer is a CTLA-4-related cancer. Preferably, the cancer is selected from the group consisting of lung cancer, ovarian cancer, colon cancer, rectal cancer, melanoma, kidney cancer, bladder cancer, breast cancer, liver cancer, lymphoma, malignant blood disease, head and neck cancer, glioma, gastric cancer, nasopharyngeal cancer, laryngeal cancer, cervical cancer, uterine body cancer, osteosarcoma, etc.

[0052] The present invention also provides a kit for detecting CTLA-4, which is used for evaluating the effect of drug treatment or diagnosing cancer, and the kit comprises the CTLA-4 binding molecule, polynucleotide, nucleic acid construct, bacteriophage, and host cell described in any embodiment of the present invention.

[0053] In one or more embodiments, the kit further comprises a reagent for detecting the binding of CTLA-4 to a single domain antibody, an antibody or an antigen-binding fragment thereof, for example, a reagent for detecting the binding by enzyme-linked immunosorbent assay.

[0054] In one or more embodiments, the detection binding agent is a detectable label that can be linked to the CTLA-4 binding molecule, such as biotin. The detectable label is linked to the CTLA-4 binding molecule or is separately present in the kit.

[0055] The present invention also provides a non-diagnostic method for detecting the presence of CTLA-4 in a sample, the method comprising: incubating the sample with the CTLA-4 binding molecule described in any embodiment of the present invention, and detecting the binding of CTLA-4 to a single domain antibody, an antibody or an antigen-binding fragment thereof, thereby determining the presence of CTLA-4 in the sample. The detection is an enzyme-linked immunosorbent assay.

[0056] The present invention also provides use of the CTLA-4 binding molecule described in any embodiment herein in preparing a kit for detecting CTLA-4 in a sample, evaluating the effect of drug treatment, or diagnosing cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 This is a titer test for alpaca antiserum against human CTLA-4 protein.

[0058] Figure 2 The results of the binding test of anti-human CTLA-4 antibody on 293T cells overexpressing human CTLA-4.

[0059] Figure 3AThe results show that anti-human CTLA-4 antibody blocks the binding of B7-1 molecules on 293T cells overexpressing human CTLA-4. Figure 3B The results show that anti-human CTLA-4 antibody blocked the binding of B7-2 molecules on 293T cells overexpressing CTLA-4.

[0060] Figure 4 This is the effect of anti-human CTLA-4 antibody on IL-2 secretion in a reporter gene assay.

[0061] Figure 5A-5C These are the cross-binding detection data of anti-human CTLA-4 humanized antibodies with human, cynomolgus monkey, and mouse CTLA-4 proteins.

[0062] Figure 6 The figure shows the binding test results of anti-human CTLA-4 humanized antibody on 293T cells overexpressing human CTLA-4.

[0063] Figure 7 The results show that the humanized anti-human CTLA-4 antibody blocked the binding of biotin-labeled B7-1 molecules on 293T cells overexpressing CTLA-4.

[0064] Figure 8A-8B These are the cross-reaction results of anti-human CTLA-4 humanized antibodies NB-27-z5 and NGS-12-z1 with 5,300 membrane proteins. DETAILED DESCRIPTION

[0065] The inventors have conducted extensive and in-depth research and found a class of CTLA-4 binding molecules comprising anti-CTLA-4 single domain antibodies after a large number of screenings. The CTLA-4 binding molecules of the present invention can bind to CTLA-4 with high specificity, have high affinity and biological activity, as well as low immunogenicity, stable structure, and good drugability. The single domain antibodies of the present invention are easy to generate.

[0066] Antibody

[0067] As used herein, a "CTLA-4 binding molecule" is a protein that specifically binds to CTLA-4, including but not limited to antibodies, antigen-binding fragments of antibodies, heavy chain antibodies, nanobodies, minibodies, affibodies, target binding regions of receptors, cell adhesion molecules, ligands, enzymes, cytokines, and chemokines.

[0068] As used herein, the term "antibody" includes monoclonal antibodies (including full-length antibodies having an immunoglobulin Fc region), antibody compositions having multiple epitope specificities, multispecific antibodies (e.g., bispecific antibodies), diabodies and single-chain molecules, as well as antibody fragments, especially antigen-binding fragments, e.g., Fab, F(ab')2 and Fv). As used herein, the terms "immunoglobulin" (Ig) and "antibody" are used interchangeably.

[0069] The basic 4-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light chains (L) and two identical heavy chains (H). IgM antibodies consist of 5 basic heterotetrameric units and an additional polypeptide called J chain, containing 10 antigen binding sites; while IgA antibodies contain 2-5 basic 4-chain units, which can be combined with J chains to form multivalent assemblies. In the case of IgG, the 4-chain unit is usually about 150,000 Daltons. Each light chain is connected to the heavy chain by one covalent disulfide bond, while the two heavy chains are connected to each other by one or more disulfide bonds, the number of which depends on the isotype of the heavy chain. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has a variable domain (VH) at the N-terminus, followed by three (CH1, CH2 and CH3 for each α and γ chain) and four (CH1, CH2, CH3 and CH4 for μ and ε isotypes) constant domains (CH) and a hinge region (Hinge) between the CH1 domain and the CH2 domain. Each light chain has a variable domain (VL) at the N-terminus, followed by a constant domain (CL) at the other end. VL is arranged with VH, while CL is arranged with the first constant domain (CH1) of the heavy chain. Specific amino acid residues are considered to form an interface between the light chain and heavy chain variable domains. Pairs of VH and VL together form an antigen binding site. For the structure and properties of different classes of antibodies, see, e.g., Basic and Clinical Immunology, 8th edition, Daniel P. Sties, Abba I. Terr and Tristram G. Parsolw, ed., Appleton & Lange, Norwalk, CT, 1994, p. 71 and Chapter 6. Light chains from any vertebrate species can be assigned to one of two distinct types, called kappa and lambda, based on their constant domain amino acid sequences. Immunoglobulins can be assigned to different classes or isotypes based on their heavy chain constant domain (CH) amino acid sequences. There are five classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, with heavy chains called α, δ, ε, γ, and μ, respectively. Based on relatively minor differences in CH sequence and function, the γ and α classes can be further divided into subclasses, for example humans express the following subclasses: IgG1, IgG2A, IgG2B, IgG3, IgG4, IgA1, and IgA2.

[0070] The "heavy chain antibody" described herein is an antibody derived from a camelid or cartilaginous fish. Compared with the above-mentioned 4-chain antibody, the heavy chain antibody lacks the light chain and the heavy chain constant region 1 (CH1), and only contains 2 heavy chains consisting of a variable region (VHH) and other constant regions, and the variable region is connected to the constant region by a hinge region structure. Each heavy chain of the camelid heavy chain antibody contains 1 variable region (VHH) and 2 constant regions (CH2 and CH3), and each heavy chain of the cartilaginous fish heavy chain antibody contains 1 variable region and 5 constant regions (CH1-CH5). The antigen-binding fragment of the heavy chain antibody includes VHH and a single-chain heavy chain antibody. By fusion with the constant region of human IgG Fc, the heavy chain antibody can have CH2 and CH3 of human IgG Fc.

[0071] As used herein, the terms "single domain antibody", "anti-CTLA-4 single domain antibody", "heavy chain variable region domain of heavy chain antibody", "VHH", and "nanoantibody" are used interchangeably and refer to single domain antibodies that specifically recognize and bind to CTLA-4. A single domain antibody is a variable region of a heavy chain antibody. Typically, a single domain antibody contains three CDRs and four FRs. Preferably, the single domain antibody of the present invention has CDR1 shown in SEQ ID NO: 1, CDR2 shown in SEQ ID NO: 2, and CDR3 shown in SEQ ID NO: 3. A single domain antibody is the smallest functional antigen-binding fragment. Usually, an antibody that naturally lacks the light chain and heavy chain constant region 1 (CH1) is first obtained, and then the variable region of the antibody heavy chain is cloned to construct a single domain antibody consisting of only one heavy chain variable region.

[0072] A binding molecule comprising two or more single domain antibodies is a multivalent single domain antibody; a binding molecule comprising two or more single domain antibodies of different specificities is a multispecific single domain antibody. A multivalent single domain antibody or a multispecific single domain antibody connects multiple single domain antibodies via a linker. The linker is generally composed of 1-15 amino acids selected from G and S.

[0073] In this article, heavy chain antibodies and antibodies are intended to distinguish different combinations of antibodies. Due to the similarity between the two structures, the following structural description of antibodies is also applicable to heavy chain antibodies in addition to light chains.

[0074] The "variable region" or "variable domain" of an antibody refers to the amino terminal domain of the heavy or light chain of an antibody. The variable domains of the heavy and light chains may be referred to as "VH" and "VL", respectively. These domains are usually the most variable parts of an antibody (relative to other antibodies of the same type) and contain the antigen binding site.

[0075] The term "variable" refers to the situation that certain segments in the variable domain vary widely in the antibody sequence. The variable domain mediates antigen binding and defines the specificity of a particular antibody to its specific antigen. However, the variability is not evenly distributed over all the amino acids spanned by the variable domain. Instead, it is concentrated in three segments called hypervariable regions (HVRs) (in both the light chain and heavy chain variable domains), namely, HCDR1, HCDR2, HCDR3 (heavy chain antibodies can be referred to as CDR1, CDR2, CDR3) of the heavy chain variable region and LCDR1, LCDR2 and LCDR3 of the light chain variable region. The more highly conserved parts of the variable domain are called framework regions (FRs). The variable domains of natural heavy and light chains each contain four FR regions (FR1, FR2, FR3 and FR4), most of which adopt a β-folded conformation, connected by three HVRs that form a loop connection and in some cases form a part of the β-folded structure. The HVR in each chain is held together in close proximity by the FR region and contributes to the formation of the antigen binding site of the antibody together with the HVR of the other chain. Typically, the structure of the light chain variable region is FR1-LCDR1-FR2-LCDR2-FR3-LCDR3-FR4, and the structure of the heavy chain variable region is FR1-HCDR1-FR2-HCDR2-FR3-HCDR3-FR4. The constant domain is not directly involved in the binding of the antibody to the antigen, but exhibits a variety of effector functions, such as the participation of the antibody in antibody-dependent cell-mediated cytotoxicity.

[0076] "Fc region" (fragment crystallizable region) or "Fc domain" or "Fc" refers to the C-terminal region of an antibody heavy chain that mediates the binding of an immunoglobulin to host tissues or factors, including binding to Fc receptors located on various cells of the immune system (e.g., effector cells), or binding to the first component (C1q) of the classical complement system. In IgG, IgA, and IgD antibody isotypes, the Fc region is composed of two identical protein fragments from the CH2 domain and the CH3 domain of the two heavy chains of the antibody; the Fc region of IgM and IgE contains three heavy chain constant domains (CH domains 2-4) in each polypeptide chain. Although the boundaries of the Fc region of an immunoglobulin heavy chain can vary, the human IgG heavy chain Fc region is generally defined as a sequence segment from an amino acid residue at position C226 or P230 of the heavy chain to the carboxyl terminus, wherein the numbering is according to the EU index, as in Kabat. As used herein, the Fc region may be a native sequence Fc or a variant Fc.

[0077] "Antibody fragments" comprise a portion of an intact antibody, preferably the antigen binding region and / or variable region of an intact antibody. Antibody fragments are preferably antigen binding fragments of antibodies. Examples of antibody fragments include Fab, Fab', F(ab')2 and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; scFv-Fc fragments; multispecific antibodies formed from antibody fragments; and any fragments that should be able to increase half-life by chemical modification or by incorporation into liposomes. Digestion of antibodies with papain produces two identical antigen binding fragments, called "Fab" fragments, and a residual "Fc" fragment, which has the ability to readily crystallize. Fab fragments consist of a complete light chain and heavy chain variable domain (VH) and one heavy chain first constant domain (CH1). Each Fab fragment is monovalent in terms of antigen binding, i.e., it has a single antigen binding site. Pepsin treatment of antibodies produces a larger F(ab')2 fragment, which is roughly equivalent to two Fab fragments linked by disulfide bonds, with different antigen binding activities and still able to cross-link antigen. Fab' fragments differ from Fab fragments by the addition of some additional residues at the carboxyl terminus of the CH1 domain, including one or more cysteines from the antibody hinge region. F(ab')2 antibody fragments were originally generated as pairs of Fab' fragments with hinge cysteines between them. Other chemical couplings of antibody fragments are also known. The Fc fragment contains the carboxyl terminal portions of the two heavy chains held together by disulfide bonds. The effector functions of antibodies are determined by sequences in the Fc region, which is also the region recognized by Fc receptors (FcR) found on certain types of cells.

[0078] "Fv" is the smallest antibody fragment that contains a complete antigen recognition and binding site. The fragment consists of a dimer of a heavy chain variable domain and a light chain variable domain in tight, non-covalent association. Six hypervariable loops (3 loops each in the heavy chain and light chain) protrude from the folding of these two domains, contributing the amino acid residues for antigen binding and giving the antibody antigen binding specificity. However, even a single variable domain (or half an Fv containing only three HVRs specific for an antigen) has the ability to recognize and bind to an antigen, although the affinity is lower than that of a complete binding site. "Single-chain Fv", also abbreviated as "sFv" or "scFv", is an antibody fragment comprising the antibody VH and VL domains connected into one polypeptide chain. Preferably, the sFv polypeptide also contains a polypeptide linker between the VH and VL domains so that the sFv forms a desired antigen binding structure.

[0079] Herein, the term "monoclonal antibody" refers to an antibody obtained from a group of substantially homogeneous antibodies, that is, except for possible natural mutations and / or post-translational modifications (e.g., isomerization, amidation) that may exist in small amounts, the individual antibodies constituting the group are identical. Monoclonal antibodies are highly specific and are directed to a single antigenic site. Compared with polyclonal antibody preparations (which typically include different antibodies directed to different determinants (epitopes)), each monoclonal antibody is directed to a single determinant on the antigen. In addition to their specificity, the advantage of monoclonal antibodies is that they are synthesized by hybridoma culture without being contaminated by other immunoglobulins. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous antibody group and should not be interpreted as requiring the production of antibodies by any ad hoc method. For example, the monoclonal antibody used according to the present invention can be generated by a variety of techniques, including, for example, hybridoma method, phage display method, recombinant DNA method, and technology, single cell sequencing method for generating human or human-like antibodies from animals with part or all of the human immunoglobulin locus or genes encoding human immunoglobulin sequences.

[0080] Monoclonal antibodies herein also include "chimeric" antibodies in which a portion of the heavy and / or light chain is identical or homologous to the corresponding sequence in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain is identical or homologous to the corresponding sequence in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity.

[0081] The "humanized" form of a non-human (e.g., mouse) antibody refers to a chimeric antibody that contains at least a sequence derived from a non-human immunoglobulin. Therefore, a "humanized antibody" generally refers to a non-human antibody in which the variable domain framework region is exchanged with a sequence found in a human antibody. Typically in a humanized antibody, the entire antibody (except for the CDR) is encoded by a polynucleotide of human origin or is identical to such an antibody (except for the CDR). The CDRs (some or all of which are encoded by nucleic acids derived from non-human organisms) are transplanted into the β-folded skeleton of the variable region of a human antibody to produce an antibody, the specificity of which is determined by the transplanted CDR. The production methods of such antibodies are well known in the art, for example, using mice with a genetically engineered immune system. In the present invention, antibodies, single domain antibodies, heavy chain antibodies, etc. all include humanized variants of each of the antibodies.

[0082] "Human antibody" refers to an antibody having an amino acid sequence corresponding to the amino acid sequence of an antibody produced by a human and / or produced using any of the techniques disclosed herein for producing human antibodies. This definition of human antibody explicitly excludes humanized antibodies comprising non-human antigen-binding residues. Human antibodies can be produced using a variety of techniques known in the art, including phage display libraries.

[0083] In some embodiments, the present invention also provides single domain antibodies, heavy chain antibodies, antibodies or antigen-binding fragments thereof that bind to the same epitope of CTLA-4 as any anti-CTLA-4 single domain antibody of the present invention, i.e., single domain antibodies, heavy chain antibodies, antibodies or antigen-binding fragments thereof that can cross-compete with any single domain antibody of the present invention for binding to CTLA-4.

[0084] In the present invention, the CDR1 of the single domain antibody comprises the sequence shown in SEQ ID NO: 1, SEQ ID NO: 1 is GX1X2X3X4X5X6X7, wherein X1 is S, L, D, F or G, X2 is T, N or S, X3 is L, F or S, X4 is D, G or E, X5 is P, I, S, D or Y, X6 is F, Y, H, Q or W, and X7 is V, D, A or S. In one or more embodiments, CDR1 comprises the sequence shown in any one of SEQ ID NOs: 4-10.

[0085] In the present invention, the CDR2 of the single domain antibody comprises the sequence shown in SEQ ID NO: 2, SEQ ID NO: 2 is X1X2X3X4X5X6X7X8, wherein X1 is I or M, X2 is N, G, S or R, X3 is R, P, S or G, X4 is S, N, D or T, X5 is R or G, X6 is T, A, D, E, R, G or L, X7 is I, F, T, S, G, R or none, and X8 is T or none. In one or more embodiments, CDR2 comprises the sequence shown in any one of SEQ ID NOs: 11-18.

[0086] In the present invention, the CDR3 of the single domain antibody comprises the sequence shown in SEQ ID NO: 3, and SEQ ID NO: 3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 , wherein X1 is A, G or T, X2 is A, L, S or G, X3 is S, G, E, V, A or K, X4 is P, R or L, X5 is D, E, L, T, I or A, X6 is K, R, V, L, S or H, X7 is P, A, Y, F, G or Q, X8 is F, H, T, V or S, X9 is Y, S, L, A, H or M, X 10 is T, I, C, A or W, X 11 D, Y, S, L or V, X 12is Q, A, L, M or C, X 13 is T, S, N or C, X 14 M, E, H, Q, A or none, X 15 C, Y, G, H, A, N or None, X 16 N, D, M, Y, S, E or None, X 17 K, I, Y, R, F or None, X 18 H, D, S, G or none, X 19 Y, T, D, L or none, X 20 Y or None, X 21 G or None, X 22 In one or more embodiments, CDR3 comprises a sequence as shown in any one of SEQ ID NOs: 19-26.

[0087] In one or more embodiments, the single domain antibody contains CDR1, CDR2 and CDR3 shown in any group of SEQ ID NOs from Group a1 to Group a9 in Table A:

[0088] Table A

[0089] Group CDR1 CDR2 CDR3 a1 4 11 19 a2 4 12 20 a3 4 12 20 a4 5 13 21 a5 6 14 22 a6 7 15 23 a7 8 16 24 a8 9 17 25 a9 10 18 26 .

[0090] In one or more embodiments, the FR1 of the single-domain antibody VHH can be selected from the FR1 of any VHH of SEQ ID NOs: 27-73, the FR2 of the VHH can be selected from the FR2 of any VHH of SEQ ID NOs: 27-73, the FR3 of the VHH can be selected from the FR3 of any VHH of SEQ ID NOs: 27-73, and the FR4 of the VHH can be selected from the FR4 of any VHH of SEQ ID NOs: 27-73.

[0091] In a preferred embodiment, the FR region of the single-domain antibody VHH of the present invention is a FR region of any VHH selected from SEQ ID NO: 27-73. Further preferably, the CDR of such an antibody is selected from any of the aforementioned groups a1 to a9. In one or more embodiments, the single-domain antibody VHH is as shown in any of SEQ ID NO: 27-73.

[0092] The CTLA-4 binding molecules described herein can be monovalent or multivalent single domain antibodies, multispecific single domain antibodies, heavy chain antibodies or antigen binding fragments thereof, antibodies or antigen binding fragments thereof comprising one, two or more anti-CTLA-4 single domain antibodies described herein.

[0093] In some embodiments, the CTLA-4 binding molecules herein comprise an anti-CTLA-4 single domain antibody and an immunoglobulin Fc region. The Fc region that can be used in the present invention can be from immunoglobulins of different subtypes, for example, IgG (e.g., IgG1, IgG2, IgG3, or IgG4 subtypes), IgA1, IgA2, IgD, IgE, or IgM. In some embodiments, the immunoglobulin Fc region is IgG4Fc, and its amino acid sequence is shown in SEQ ID NO:74.

[0094] In some embodiments, the CTLA-4 binding molecule described herein is a heavy chain antibody. The heavy chain antibody further comprises a heavy chain constant region, such as a constant region of a camel heavy chain antibody or a cartilaginous fish heavy chain antibody. Preferably, the heavy chain constant region is as shown in SEQ ID NO:74.

[0095] The present invention also includes the antibody derivatives and analogs. "Derivatives" and "analogs" refer to polypeptides that substantially maintain the same biological function or activity as the antibodies of the present invention. The derivatives or analogs of the present invention may be (i) polypeptides having a substitution group in one or more amino acid residues, or (ii) polypeptides formed by fusion of a mature polypeptide with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol), or (iii) polypeptides formed by fusion of an additional amino acid sequence to this polypeptide sequence (such as a leader sequence or secretory sequence or a sequence or proprotein sequence used to purify the polypeptide, or a fusion protein formed with a 6His tag). According to the teachings herein, these derivatives and analogs are within the scope known to those skilled in the art.

[0096] Without substantially affecting the activity of the antibody, a person skilled in the art may change one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more) amino acids in the sequence of the present invention to obtain variants of the antibody or its functional fragment sequence. These variants include (but are not limited to): one or more (usually 1-50, preferably 1-30, more preferably 1-20, and most preferably 1-10) amino acid deletions, insertions and / or substitutions, and addition of one or more (usually within 20, preferably within 10, and more preferably within 5) amino acids at the C-terminus and / or N-terminus. In the art, conservative substitutions with amino acids with similar or similar properties generally do not change the function of the protein. For example, amino acids with similar properties are substituted in the FR and / or CDR regions of the variable region. Amino acid residues that can be conservatively substituted are well known in the art. Such substituted amino acid residues may or may not be encoded by the genetic code. For another example, adding one or more amino acids to the C-terminus and / or N-terminus will generally not change the function of the protein. They are all considered to be included in the scope of protection of the present invention.

[0097] Variant forms of the antibodies described herein include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that can hybridize with the encoding DNA of the antibodies of the present invention under high or low stringency conditions, and polypeptides or proteins obtained using antiserum against the antibodies of the present invention.

[0098] In some embodiments, the sequence of the variant of the present invention may have at least 95%, 96%, 97%, 98% or 99% identity to its source sequence. The sequence identity of the present invention can be measured using sequence analysis software. For example, the computer program BLAST, especially BLASTP or TBLASTN, using default parameters is used. The present invention also includes molecules having antibody heavy chain variable regions with CDRs, as long as their CDRs have more than 90% (preferably more than 95%, and most preferably more than 98%) homology with the CDRs identified herein.

[0099] The antibodies of the present invention can be prepared by conventional methods in the art, such as hybridoma technology well known in the art. The heavy chain antibodies of the present invention can be prepared by conventional methods in the art, such as phage display technology well known in the art. Alternatively, the antibodies or heavy chain antibodies of the present invention can be expressed in other cell lines. Suitable mammalian host cells can be transformed with sequences encoding antibodies of the present invention. Transformation can be carried out by any known method, for example, including packaging the polynucleotide in a virus (or viral vector) and transducing the host cell with the virus (or vector). The transformation procedure used depends on the host to be transformed. Methods for introducing heterologous polynucleotides into mammalian cells are well known in the art, including dextran-mediated transfection, calcium phosphate precipitation, polybrene-mediated transfection, protoplast fusion, electroporation, encapsulation of polynucleotides in liposomes, and direct microinjection of DNA into the nucleus. Mammalian cell lines that can be used as hosts for expression are well known in the art and include, but are not limited to, a variety of immortalized cell lines available from the American Type Culture Collection (ATCC), including, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., HepG2), etc. Particularly preferred cell lines are selected by determining which cell lines have high expression levels and produce antibodies with substantial CTLA-4 binding properties.

[0100] Nucleic Acids

[0101] The present invention also provides polynucleotides encoding the above-mentioned antibodies or fragments thereof. Provided herein are polynucleotides encoding heavy chain variable regions, light chain variable regions, heavy chains, light chains, and each CDR. The polynucleotides of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or artificially synthesized DNA. DNA may be single-stranded or double-stranded. DNA may be a coding strand or a non-coding strand.

[0102] As will be appreciated by those skilled in the art, due to the degeneracy of the genetic code, a very large number of nucleic acids can be produced, all of which encode the antibodies or antigen-binding fragments thereof of the present invention. Thus, once a specific amino acid sequence has been identified, one skilled in the art can produce any number of different nucleic acids by simply modifying the sequence of one or more codons in a manner that does not alter the amino acid sequence encoding the protein. Therefore, the present invention also relates to polynucleotides that hybridize with the above-mentioned polynucleotide sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that can hybridize with the polynucleotides of the present invention under stringent conditions. In the present invention, "stringent conditions" refers to: (1) hybridization and elution at relatively low ionic strength and relatively high temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) the addition of a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization occurs only when the identity between the two sequences is at least 90%, preferably at least 95%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide.

[0103] The full-length nucleotide sequence of the antibody of the present invention or its fragment can usually be obtained by PCR amplification, recombination or artificial synthesis. A feasible method is to synthesize the relevant sequence by artificial synthesis, especially when the fragment length is short. Usually, a fragment with a very long sequence can be obtained by synthesizing multiple small fragments first and then connecting them. In addition, the coding sequence of the heavy chain and the expression tag (such as 6His) can be fused together to form a fusion protein.

[0104] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the host cells after proliferation by conventional methods. The biomolecules (nucleic acids, proteins, etc.) involved in the present invention include biomolecules in isolated form. At present, the DNA sequence encoding the protein of the present invention (or its fragment, or its derivative) can be obtained completely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequence of the present invention by chemical synthesis.

[0105] Therefore, the present invention also relates to nucleic acid constructs, such as expression vectors and recombinant vectors, comprising the above-mentioned appropriate DNA sequences and appropriate promoters or control sequences. These vectors can be used to transform appropriate host cells to enable them to express proteins. The vectors usually contain sequences for plasmid maintenance and for cloning and expressing exogenous nucleotide sequences. The sequences (collectively referred to as "flanking sequences" in certain embodiments) usually include one or more of the following nucleotide sequences: promoters, one or more enhancer sequences, replication origins, transcription termination sequences, complete intron sequences containing donor and acceptor splice sites, sequences encoding leader sequences for polypeptide secretion, ribosome binding sites, polyadenylation sequences, multiple linker regions for inserting nucleic acids encoding antibodies to be expressed, and selectable marker elements.

[0106] Host cells can be prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells such as yeast; insect cells of Drosophila S2 or Sf9; animal cells such as CHO, COS7, 293 cells, etc.

[0107] Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA can be harvested after the exponential growth phase and treated with the CaCl2 method, the steps used are well known in the art. Another method is to use MgCl2. If necessary, transformation can also be carried out by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be selected: calcium phosphate coprecipitation method, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0108] The obtained transformant can be cultured by conventional methods to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the culture medium used in the culture can be selected from various conventional culture media. Culture is carried out under conditions suitable for the growth of the host cells. After the host cells grow to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0109] The polypeptide in the above method can be expressed in the cell, on the cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be separated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include but are not limited to: conventional renaturation treatment, treatment with protein precipitants (salting out method), centrifugation, osmotic sterilization, ultra-treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography techniques and combinations of these methods.

[0110] Therapeutic uses and pharmaceutical compositions

[0111] By constructing a nano antibody library, the inventors discovered and expressed and purified multiple nano antibodies that can bind to CTLA-4 protein. All aspects of the antibodies described herein can be used to prepare drugs for preventing or treating various conditions and diseases described herein, and the conditions and diseases are especially diseases or conditions associated with cells expressing CTLA-4. In some embodiments, the conditions and diseases are cancers, including but not limited to: lung cancer, ovarian cancer, colon cancer, rectal cancer, melanoma, kidney cancer, bladder cancer, breast cancer, liver cancer, lymphoma, malignant blood diseases, head and neck cancer, glioma, gastric cancer, nasopharyngeal cancer, laryngeal cancer, cervical cancer, uterine body cancer, osteosarcoma, etc.

[0112] The pharmaceutical compositions herein contain binding molecules as described herein, and pharmaceutically acceptable excipients, including but not limited to diluents, carriers, solubilizers, emulsifiers, preservatives and / or adjuvants. Excipients are preferably non-toxic to the recipient at the dose and concentration used. Such excipients include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. In certain embodiments, the pharmaceutical composition may contain substances for improving, maintaining or retaining, for example, the pH, permeability, viscosity, clarity, color, isotonicity, odor, sterility, stability, dissolution or release rate, absorption or penetration of the composition. These substances are known in the prior art. The optimal pharmaceutical composition can be determined based on the expected route of administration, delivery method, and required dosage.

[0113] Pharmaceutical compositions for in vivo administration are usually provided in the form of sterile preparations. Sterilization is achieved by filtering through a sterile filtration membrane. When the composition is freeze-dried, this method can be used for sterilization before or after freeze-drying and rehydration. The pharmaceutical composition of the present invention can be selected for parenteral delivery. The composition for parenteral administration can be stored in a freeze-dried form or in a solution. For example, it is prepared by conventional methods with physiological saline or an aqueous solution containing glucose and other adjuvants. Parenteral compositions are usually placed in a container with a sterile access hole, such as an intravenous solution strip or a vial with a stopper that can be pierced by a hypodermic injection needle. Alternatively, the composition can be selected for inhalation or delivery through the digestive tract (such as oral). The preparation of the pharmaceutically acceptable composition is within the technology of the art. Other pharmaceutical compositions will be apparent to those skilled in the art, including formulations containing antibodies in sustained or controlled release delivery formulations. Technologies for preparing a variety of other sustained or controlled delivery methods (such as liposome carriers, bioerodible microparticles or porous beads and accumulated injections) are also known to those skilled in the art.

[0114] Once the pharmaceutical composition is formulated, it is stored in a sterile vial in the form of a solution, suspension, gel, emulsion, solid, crystal or in the form of a dehydrated or lyophilized powder. The formulation can be stored in a ready-to-use form or in a form of rehydration before administration (e.g., lyophilization). The present invention also provides a kit for producing a single-dose administration unit. The kit of the present invention can each contain a first container with a dried protein and a second container with an aqueous formulation. In certain embodiments of the present invention, a kit containing a single-chamber and multi-chamber prefilled syringe (e.g., a liquid syringe and a lyophilized syringe) is provided.

[0115] The present invention also provides a method for treating a patient (especially a patient's CTLA-4-related disease) by administering a binding molecule or a pharmaceutical composition thereof as described in any embodiment of the present invention. Herein, the terms "patient", "subject", "individual", and "object" are used interchangeably herein and include any organism, preferably an animal, more preferably a mammal (e.g., rats, mice, dogs, cats, rabbits, etc.), and most preferably a human. "Treatment" refers to the subject using a treatment regimen described herein to achieve at least one positive therapeutic effect (e.g., a reduction in the number of cancer cells, a reduction in tumor volume, a reduction in the rate of cancer cell infiltration to peripheral organs, or a reduction in the rate of tumor metastasis or tumor growth). The treatment regimen that effectively treats a patient may vary according to a variety of factors (such as the patient's disease state, age, weight, and the ability of the therapy to stimulate an anti-cancer response in the subject).

[0116] The therapeutically effective amount of the pharmaceutical composition containing the binding molecules of the present invention that will be adopted will depend on, for example, the degree of treatment and the target. It will be appreciated by those skilled in the art that the appropriate dosage level for the treatment of will depend in part on the size (body weight, body surface or organ size) and / or condition (age and general health status) of the delivered molecule, indication, route of administration and the patient and change. In certain embodiments, the clinician can titrate the dosage and change the route of administration to obtain the best therapeutic effect. For example, about 10 micrograms / kg body weight-about 50 milligrams / kg body weight every day.

[0117] The frequency of administration will depend on the pharmacokinetic parameters of the binding molecule in the formulation used. The clinician typically administers the composition until a dose is achieved to achieve the desired effect. The composition can therefore be administered as a single dose, or as two or more doses (which may or may not contain the same amount of the desired molecule) over time, or as a continuous infusion via an implant device or catheter.

[0118] The route of administration of the pharmaceutical composition is according to known methods, for example, orally, by injection via intravenous, intraperitoneal, intracerebral (intracerebroparenchymal), intracerebroventricular, intramuscular, intraocular, intraarterial, portal vein or intralesional routes; by sustained release systems or by implant devices.

[0119] Diagnostics, Tests and Kits

[0120] The binding molecules of the present invention can be used in assays, such as binding assays, to detect and / or quantify CTLA-4 expressed in tissues or cells due to their high affinity for CTLA-4. Binding molecules such as single domain antibodies can be used in studies to further study the role of CTLA-4 in disease. The method for detecting CTLA-4 is generally as follows: obtaining a cell and / or tissue sample; detecting the level of CTLA-4 in the sample.

[0121] The CTLA-4 binding molecules of the present invention can be used for diagnostic purposes to detect, diagnose or monitor diseases and / or conditions associated with CTLA-4. The present invention provides for detecting the presence of CTLA-4 in a sample using classical immunohistological methods known to those skilled in the art. Detection of CTLA-4 can be performed in vivo or in vitro. Examples of methods suitable for detecting the presence of CTLA-4 include ELISA, FACS, RIA, etc.

[0122] For diagnostic applications, binding molecules such as single domain antibodies are typically labeled with a detectable labeling group. Suitable labeling groups include, but are not limited to, the following: radioisotopes or radionuclides (e.g., 3H, 14C, 15N, 35S, 90Y, 99Tc, 111In, 125I, 131I), fluorescent groups (e.g., FITC, rhodamine, lanthanide phosphors), enzymatic groups (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), chemiluminescent groups, biotinyl groups, or predetermined polypeptide epitopes recognized by secondary reporters (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags), MRI (magnetic resonance imaging) or CT (computer tomography) contrast agents. Various methods for labeling proteins are known in the art and can be used to perform the present invention.

[0123] Another aspect of the invention provides a method for detecting the presence of a test molecule that competes with the antibodies of the invention for binding to CTLA-4. An example of such an assay would involve detecting the amount of free antibody in a solution containing a certain amount of CTLA-4 in the presence or absence of a test molecule. An increase in the amount of free antibody (i.e., antibody that is not bound to CTLA-4) would indicate that the test molecule is able to compete with the antibody for binding to CTLA-4. In one embodiment, the antibody is labeled with a labeling group. Alternatively, the test molecule is labeled and the amount of free test molecule is monitored in the presence or absence of the antibody.

[0124] The present invention also provides a detection kit for detecting CTLA-4 levels, which includes an antibody that recognizes CTLA-4 protein, a lysis medium for dissolving the sample, and universal reagents and buffers required for detection, such as various buffers, detection markers, detection substrates, etc. The detection kit can be an in vitro diagnostic device.

[0125] The present invention will be described below in the form of specific examples. It should be understood that these examples are illustrative only and are not intended to limit the scope of the present invention. The methods and materials used in the examples are, unless otherwise stated, materials and methods conventional in the art.

[0126] Example

[0127] Example 1: Alpaca Immunization

[0128] 1.1 Preparation of immunogens:

[0129] According to the CTLA-4 protein sequence queried on NCBI, it was fused with the human IgG Fc fragment sequence and commissioned to Nanjing GenScript to synthesize and construct a eukaryotic expression vector of the pCDNA3.4 (Thermo) plasmid. The synthesized plasmid was expressed using the EXpiCHOTM (Thermo Fisher) expression system. After expression, a 5 mL Protein A pre-packed column (GE) was used for one-step affinity purification. The purified sample was replaced into PBS buffer, and the purity was identified by SDS-PAGE electrophoresis gel and HPLC. After the activity was identified by ELISA, it was aliquoted and frozen in a -80 degree refrigerator for subsequent immunization.

[0130] 1.2 Alpaca Immunity:

[0131] The first immunization antigen (CTLA-4.hFc) was 1000μg, mixed with adjuvant (GERBU FAMA), and injected subcutaneously at four points on the back of the alpaca, with a dose of 1mL at each point. The second immunization was performed 3 weeks apart. From the 2nd to the 9th immunization: the immunization antigen was 500μg, injected subcutaneously at four points on the back of the alpaca, with a dose of 1mL at each point, and the interval between each immunization was one week.

[0132] 1.3 Immune serum titer detection:

[0133] 1.3.1 Protein level titer detection

[0134] CTLA-4.His antigen (Acrobiosystems) was coated overnight at 4°C, blocked and washed, and then the gradient diluted serum was added to the ELISA plate for incubation, and then incubated with anti-llama IgG HRP (Abcam) antibody. After washing, TMB colorimetric solution was added for color development, and the reaction was terminated with 2M HCl. Then, the absorbance at OD450 nanometers was detected with an enzyme reader. The experimental results are shown in Figure 2. Figure 1 As shown, the titer of alpaca reached a high level (>64000) after 9 immunizations.

[0135] Example 2: Construction and screening of nanoantibody immune library targeting CTLA-4

[0136] (1) After 9 rounds of immunization, 100 mL of peripheral blood lymphocytes were extracted from camels and total RNA was extracted. RNA extraction was performed according to the instructions of RNAiso reagent from TAKARA.

[0137] (2) Using RNA as template and oligo dT as primer, synthesize the first strand of cDNA according to the instruction manual of TAKARA reverse transcriptase.

[0138] (3) Using PrimeSTAR high-fidelity DNA polymerase, nested PCR was used to obtain the variable region encoding gene of the heavy chain antibody. Nested PCR was used to amplify the variable region fragment of the heavy chain antibody:

[0139] First round of PCR:

[0140] Upstream primer: GTCCTGGCTGCTCTTCTACAAGGC (SEQ ID NO: 77)

[0141] Downstream primer: GGTACGTGCTGTTGAACTGTTCC (SEQ ID NO: 78)

[0142] The fragment between the heavy chain antibody guide peptide and antibody CH2 was amplified, annealed at 55°C for 30 cycles; a DNA fragment of about 600 bp was recovered and used as a template for the second round of PCR.

[0143] Second round of PCR:

[0144] Upstream primer: GATGTGCAGCTGCAGGAGTCTGGRGGAGG (SEQ ID NO: 79)

[0145] Downstream primer: GGACTAGTGCGGCCGCTGGAGACGGTGACCTGGGT (SEQ ID NO: 80)

[0146] The fragments between the heavy chain antibody FR1 region and the long and short hinge regions (long fragments and short fragments) were amplified, annealed at 55°C for 30 cycles, and the target fragment was recovered. The results showed that the size of the fragment was about 500 bp, that is, the electrophoresis band of the nanobody gene was about 500 bp.

[0147] (4) The phagemid pME207 and the PCR amplification product were double-digested with Sfi I and Not I (NEB), respectively. After recovery and quantification, the two fragments were ligated with T4 DNA ligase (TaKaRa) at a molar ratio of 1:3 at 16°C overnight.

[0148] (5) After ethanol precipitation, the ligation product was dissolved in 100 μL sterile water and electroporated to transform E. coli TG1 ten times. Take 100 μL of the bacterial solution after electroporation and culture, dilute it in multiple proportions, spread it on the ampicillin LB culture plate, calculate the reservoir capacity, and spread the rest on the ampicillin 2×YT culture plate, invert and culture at 37°C for 13 to 16 hours. Use 10 mL of 2×YT culture medium to scrape the bacterial moss on the culture plate, add glycerol at a final concentration of 25%, divide it into aliquots, and store it at -80°C for later use. The reservoir capacity is 4.3×10 9 To detect the insertion rate of the library, 48 clones were randomly selected for colony PCR, and the results showed that the insertion rate had reached more than 90%.

[0149] (6) Based on the calculated reservoir capacity, 10 times the reservoir capacity of live cells was inoculated into 200 mL of 2×YT (containing 2% glucose and 100 μg / mL ampicillin) and cultured at 37°C, 200 r / min until OD600 reached 0.5. Helper phage was added at a multiplicity of infection of 20:1. The culture was allowed to stand at 37°C for 30 min and then incubated at 37°C, 200 r / min for 30 min. The culture was centrifuged, and the precipitate was resuspended in 200 mL of 2×YT (containing 100 μg / mL ampicillin and 50 μg / mL kanamycin). After overnight culture at 37°C and 250 r / min, the supernatant was centrifuged at 8000 rpm, 5×PEG / NaCl solution was added, the solution was placed on ice for 60 min, and the solution was centrifuged at 8000 rpm for 30 min. The precipitate was resuspended in 5 mL of PBS to obtain an anti-CTLA-4 single domain heavy chain antibody (VHH) immune library. 10 μL was taken for titer determination, and the rest was aliquoted and stored at -80°C for later use.

[0150] (7) CTLA-4 protein was coated on the ELISA plate at 5 μg / mL, 100 μL per well, and placed at 4°C overnight. A negative control was also set up. The next day, 200 μL of 3% BSA was added to each of the five wells and blocked at room temperature for 2 hours. After 2 hours, the plate was washed three times with PBST (PBS containing 0.05% Tween 20). After washing the plate, 100 μL of phage (2-3×10 600 μL) pre-blocked with 5% skim milk was added to each negative sieve hole. 11tfu immune camel nano antibody phage display gene library), act at room temperature for 1.5 hours, then transfer the supernatant after negative screening to the target antigen coated well, and act at room temperature for 1.5 hours. Wash 12 times with PBST (PBS contains 0.05% Tween 20) to wash away the unbound phage. Use Glycine (SIGMA) to dissociate the phage that specifically binds to CTLA-4, and the eluted phage is neutralized with Tris (Invitrogen, 1M, PH 8.0) and then infects TG1 in the logarithmic phase. After reproduction and amplification, the next round of "adsorption-elution" is carried out. Finally, the eluted phage is infecting TG1, and IPTG (Thermo) is used to induce TG1 to express nano antibodies. The supernatant expressed by TG1 is taken for ELISA binding detection and blocking activity detection. The secondary antibody used for ELISA binding detection was anti-c-myc Antibody HRP (Bethyl), and the secondary antibody used for blocking Biotinylated Human B7-1 / CD80 Protein, Fc molecule (Acrobiosystem) binding detection was HRP-labeled streptavidin (Thermo). At the same time, the supernatant of TG1 expression was taken for FACS binding detection on 293T overexpressing CTLA-4 cells, the primary antibody used was biotin-anti-his antibody (GenScript), and the fluorescent antibody used was PE Streptavidin (Biolegend).

[0151] (8) After sequence analysis, combined with the results of ELISA and FACS, 9 nanobodies with blocking activity were selected as candidate antibodies.

[0152] Example 3: Expression and purification of candidate antibodies

[0153] The nanobody was constructed into the pCDNA3.4-IgG4 vector and constructed into VHH-IgG4 format, and then TM The protein was expressed using the Thermo Fisher expression system. After one week of expression, the supernatant was collected for Protein A (GE) purification. The protein quality was then tested using Nanodrop and the protein purity was tested using HPLC. The purity and yield of the obtained protein met the requirements of subsequent experiments.

[0154] Example 4: Candidate Antibody Characterization

[0155] (1) Protein level affinity detection:

[0156] The binding kinetics and affinity of antibodies to human CTLA-4his tag antigen were determined using surface plasmon resonance (SPR). The purified antibody was passed through a sensor chip pre-fixed with protein A, and the antibody was captured by protein A. Then, 5 different concentrations of CTLA-4.his protein were used as the mobile phase, and the binding time and dissociation time were 30min and 60min, respectively. Biacore Evaluation Software 2.0 (GE) was used to analyze the binding rate (ka), dissociation rate (kd) and equilibrium constant (KD). The listed CTLA-4 antibody drug Yevory was selected as a control. BMK1 is an IgG4 antibody prepared according to the Yevory sequence provided by https: / / www.drugbank.ca / , and BMK2 is an IgG4 antibody prepared according to the sequence in the CN 107400166 A patent of Suzhou Alphamab Biotechnology Co., Ltd. The amino acid sequences of each candidate antibody, BMK1, and BMK2 are shown in Table 5, and the CDR sequences of each candidate antibody are shown in Table 6. The results of protein level affinity detection are shown in Table 1 below.

[0157] Table 1. Affinity test results of different antibodies

[0158]

[0159] (2) Protein level ligand competition assay

[0160] ELISA was used to identify whether the VHH-IgG4 antibody competed with the ligand Biotinylated Human B7-1 / CD80Protein, Fc protein (Acrobiosystem) for binding to human CTLA-4.hFc extracellular protein. Briefly, the CTLA-4.his antigen was diluted to 1.5 μg / mL with PBS, and 100 μL of antigen was added to each well of the ELISA plate and coated overnight at 4°C; the next day, the plate was washed twice with PBST (added with 0.5% TWEEN-20), and then blocked with 3% BSA at 37°C for 1.5h, and then washed twice with PBST. Biotinylated Human B7-1 / CD80 Protein, Fc protein was diluted to 5.2μg / mL; VHH-IgG4 antibody was diluted to 2000nM, and then diluted 4-fold in 8 gradients; 50μL Biotinylated HumanB7-1 / CD80 Protein, Fc protein and 50μL diluted antibody were added to each well, and the ELISA plate was incubated at 37℃ for 1h; after washing 3 times, 100μL HRP-SA antibody (Biolegend) diluted at 1:2000 was added to each well and incubated for 30min; then the plate was washed 3 times with PBST, TMB colorimetric solution was added at 100μL / well, and the reaction was allowed to react for 3-5min; 3N hydrochloric acid was added at 100μL / well to terminate the reaction. After the reaction was terminated, OD450 / 650 was selected for detection on the Tecan ELISA reader. The dose-effect curve was prepared using Graphprism 8.0 software, and IC50 was calculated. The results showed that except for the isotype control antibody (Isotype, whose amino acid sequence is shown in SEQ ID NO: 2 in CN 106146653A), all other 9 candidate antibodies showed ligand competitive activity with BMK and Yervoy; the results are summarized in Table 2.

[0161] (3) Homologous protein binding assay

[0162] CTLA-4 and its homologous proteins PD-1.his tag protein (ACRO Biosystems), ICOS.Histag (ACRO Biosystems), and CD28.His tag (ACRO Biosystems) were coated on the ELISA plate at a concentration of 1μg / ml and placed at 4°C overnight. After blocking and washing, the diluted antibodies were added to the ELISA plate and incubated at room temperature for 2 hours. After washing, Goat anti-Human IgG-Fc Fragment Antibody HRP (Bethyl) secondary antibody was added and incubated at room temperature for 1 hour. After washing, TMB colorimetric solution was added, and then the reaction was terminated with 3N HCl, and the OD450 value was read using an ELISA reader. The results showed that the 9 candidate antibodies, Yervory, BMK and other antibodies only bound to the CTLA-4 protein, and had no cross-reaction with CTLA-4 homologous proteins (PD-1, ICOS, CD28). The results of the 9 candidate antibodies are summarized in Table 2.

[0163] (4) Species cross-fertilization study

[0164] CTLA-4.his tag protein (ACRO Biosystems) of different species (human, cynomolgus monkey, murine) was coated on the ELISA plate at a concentration of 1μg / ml and placed at 4°C overnight. After blocking and washing, the diluted antibodies were added to the ELISA plate and incubated at room temperature for 2 hours. After washing, Goat anti-Human IgG-Fc Fragment Antibody HRP (Bethyl) secondary antibody was added and incubated at room temperature for 1 hour. After washing, TMB colorimetric solution was added, and then the reaction was terminated with 2M HCl, and the OD450 value was read using an ELISA reader.

[0165] The results showed that all nine candidate antibodies and BMK1 bound to human and cynomolgus monkey CTLA-4, but not to mouse CTLA-4. The results are shown in Table 2.

[0166] Table 2. Summary of anti-CTLA-4 antibody ELISA test results

[0167]

[0168]

[0169] (5) Cell-level binding activity detection

[0170] HEK293T cells expressing the extracellular domain of CTLA-4 were plated in 96-well plates at 3 × 10 5Cells, and then the gradient diluted candidate antibodies were incubated with 293T cells overexpressing CTLA-4 at 2-8°C; after half an hour, the detection antibody anti-human IgG PE (Jackson Immuno Research, Code: 109-117-008) was added for incubation after washing, and then detected using a CytoFLEX flow cytometer. Curve fitting was performed using Graphprism software to calculate the EC50 (nM) of the antibody. Isotype is the isotype control (negative control, the sequence is derived from SEQ ID NO: 2 of patent CN 106146653A). The results of some candidate antibodies are shown in Figure 2 The EC50 values ​​of the remaining candidate antibodies were 0.4-0.7 nM.

[0171] (6) Cell-level ligand competition activity assay

[0172] Ligand Biotinylated Human B7-1 / CD80 Protein, Fc protein (Acrobiosystem) and Biotinylated Human B7-2 / CD80 Protein, Fc protein (Acrobiosystem) were diluted to fixed concentrations. HEK293T cells expressing the extracellular domain of CTLA-4 were plated in 96-well plates, with 3×10 5 Cells were then added with 50 μL of gradient diluted antibodies and 50 μL of ligands, and incubated at 4°C; after 30 minutes, the cells were washed and the detection reagent PE streptivin (Biolegend) was added and incubated for another 30 minutes; after the incubation, the cells were washed, resuspended, and detected using a CytoFLEX flow cytometer. Curve fitting was performed using Graphprism software to calculate the IC50 of the antibodies. The results showed that except for the NB-784 antibody, all candidate antibodies could compete for the binding of the ligand to CTLA-4. The results of some candidate antibodies are shown in Figure 2. Figure 3A and Figure 3B shown.

[0173] Example 5: Antibody functional activity test (reporter gene test)

[0174] The assay buffer (RMPI1640 + 10% FBS buffer) was used to adjust the density of GS-J1 / CD28 cells (GenScript) to 2×10 6 / mL; GS-C1 / CD80 cells (GenScript) target cells were adjusted to a density of 1×10 in antibiotic-free medium. 6 / mL. The antibody to be tested was gradiently diluted with test buffer, and the CTLA-4 protein was diluted to 100μg / mL with test buffer. 20μL GS-J1 / CD28, 20μL GS-C1 / CD80 cells, 20μLCTLA-4 protein, 20μL of the antibody to be tested or test buffer were added to each well of the 384-well plate in sequence, and the 384-well plate was placed in a cell culture incubator for 24 hours. After 24 hours, the cell supernatant was centrifuged and the IL-2 concentration was quantified using the IL-2 quantitative detection kit (Cisbio). The test results were curve fitted using Graphprism software to calculate the EC50 (nM) of the antibody.

[0175] like Figure 4 As shown, each candidate antibody has good functional activity in the reporter gene test function detection method, among which NB-27, NB-57, NB-783, and NB-879 have EC50 between 4 and 6 nM, and BMK1, BMK2, and Yervory have EC50 around 7 nM. NB-784 has poor functional activity.

[0176] Example 6: VHH antibody humanization and affinity testing

[0177] Referring to the method of humanizing nanobodies (J.Biol.Chem.2009;284:3273-3284), four VHH antibodies, NB-27, NGS-12, NGS-16, and NB-879, were humanized using the CDR region transplantation method. The modified antibody sequences of each antibody are shown in Table 5 below. The IgBLAST (http: / / www.ncbi.nlm.nih.gov / igblast / ) database was screened for four germlines with high homology, such as NB-27, NGS-12, NGS-16, and NB-879, as templates. Biacore was used to perform affinity testing on the antibodies before and after humanization. The purified antibodies were passed through a sensor chip pre-fixed with protein A, and the antibodies were captured by protein A. Then, 5 different concentrations of CTLA-4.His protein were used as mobile phases, and the binding time and dissociation time were 30min and 60min, respectively. Biacore Evaluation Software 2.0 (GE) was used to analyze the association rate (ka), dissociation rate (kd) and equilibrium constant (KD). The test results are shown in Table 3. The affinity of each antibody after modification did not decrease, and even increased.

[0178] Table 3. Antibody affinity (SPR) test results after humanization modification

[0179]

[0180]

[0181] Example 7: Characterization of VHH antibodies after humanization

[0182] (1) Species crossover study

[0183] The binding of three humanized VHH antibodies (NB-27-Z5, NGS-12-Z1, and NGS-16-Z2) to human, cynomolgus monkey, and mouse CTLA-4 proteins was detected by ELISA. The detection method was as shown in the species cross-test in Example 4. The results are shown in FIG. Figures 5A-5C As shown, the three humanized antibodies all had good binding to human, cynomolgus monkey, and mouse CTLA-4 proteins.

[0184] (2) Cell-level binding activity detection

[0185] The binding activity of the humanized VHH antibody to 293T cells overexpressing CTLA-4 was detected by FACS, and the detection method was as shown in the cell level binding activity detection section of Example 4. The results are shown in Figure 6 As shown, the EC50 of the three modified antibodies binding to 293T cells overexpressing CTLA-4 was between 7 and 10 nM.

[0186] (3) Cellular ligand competition assay

[0187] The humanized VHH antibody was tested by FACS to detect the competition between B7-1 protein and 293T cells overexpressing CTLA-4. The detection method was as shown in the cell-level ligand competition activity detection section of Example 4. The results are shown in Figure 7 As shown, the IC50 values ​​of three VHH antibodies, NGS-12-Z1, NGS-16-Z2, and NB-27-Z5, were 2.6 nM, 2.4 nM, and 1.8 nM, respectively, and the modifications all maintained good ligand competitive activity.

[0188] Example 8: Validation of VHH antibody specificity after humanization

[0189] 1) Membrane protein cross-reactivity

[0190] The membrane protein array screening platform (Membrane Proteome Array, MPA) developed by Integral Molecular Company of the United States was used to perform membrane protein cross-reaction. 5300 different human membrane proteins were displayed on the cell surface by transfecting HEK293 cells, and the binding signals of antibodies on these proteins were detected by FACS to evaluate the specificity of the antibodies to be tested. MPA screening results ( Fig. 8A and Figure 8B) showed that NB-27-Z5 and NGS-12-Z1 antibodies only bind to human CTLA-4 protein and do not bind to more than 5,000 other proteins.

[0191] 2) Tissue cross-reactivity

[0192] 34 tissues were selected for frozen sections, dried at room temperature and fixed with acetone. The samples were blocked with reagents A and B of the endogenous biotin blocking kit (Sangong, E674001), and the biotin-labeled antibody samples were incubated for 30 minutes. After washing, horseradish peroxidase-labeled streptavidin (Abcam, ab7403) was added and incubated for 15 minutes. DAB was used for color development and hematoxylin counterstaining, and the slides were sealed with neutral plastic and air-dried for microscopic examination. The positive controls were Anti-CTLA-4 antibodies BMK1 and BMK2, and the negative controls were IgG4 isotype controls.

[0193] The results are shown in Table 4. BMK1 and BMK2 had a small amount of positive reaction (less than 5%) in some tissues (testis, tonsil); NGS-16-Z2 had a small amount of positive reaction (less than 5%) in some tissues. No obvious positive reaction was found for NGS-12-Z1 and NB-27-Z5, that is, there was no obvious specific binding with 34 normal human tissues.

[0194] Table 4. Summary of the results of cross-reactivity tests on 34 human tissues

[0195]

[0196]

[0197] Example 9: Sequence Summary

[0198] Table 5. Summary of antibody sequences

[0199]

[0200]

[0201]

[0202]

[0203]

[0204]

[0205]

[0206] Table 6. Summary of antibody CDR sequences

[0207] Sequence Listing <110> Zhejiang Nano-Antibody Technology Center Co., Ltd. <120> CTLA-4 binding molecules and their applications <130> 217672 <160> 80 <170> PatentIn version 3.5 <210> 1 <211> 8 <212> PRT <213> Artificial <220> <223> CDR1 <220> <221> MISC_FEATURE <222> (2)..(2) <223> Xaa is S, L, D, F or G <220> <221> MISC_FEATURE <222> (3) <223> Xaa is T, N or S <220> <221> MISC_FEATURE <222> (4) <223> Xaa is L, F or S <220> <221> MISC_FEATURE <222> (5) <223> Xaa is D, G or E <220> <221> MISC_FEATURE <222> (6) <223> Xaa is P, I, S, D or Y <220> <221> MISC_FEATURE <222> (7) <223> Xaa is F, Y, H, Q or W <220> <221> MISC_FEATURE <222> (8) <223> Xaa is V, D, A or S <400> 1 Gly Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1 5 <210> 2 <211> 8 <212> PRT <213> Artificial <220> <223> CDR2 <220> <221> MISC_FEATURE <222> (1) <223> Xaa is I or M <220> <221> MISC_FEATURE <222> (2)..(2) <223> Xaa is N, G, S or R <220> <221> MISC_FEATURE <222> (3) <223> Xaa is R, P, S or G <220> <221> MISC_FEATURE <222> (4) <223> Xaa is S, N, D or T <220> <221> MISC_FEATURE <222> (5) <223> Xaa is R or G <220> <221> MISC_FEATURE <222> (6) <223> Xaa is T, A, D, E, R, G or L <220> <221> MISC_FEATURE <222> (7) <223> Xaa is I, F, T, S, G, R or none <220> <221> MISC_FEATURE <222> (8) <223> Xaa is T or None <400> 2 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1 5 <210> 3 <211> twenty two <212> PRT <213> Artificial <220> <223> CDR3 <220> <221> MISC_FEATURE <222> (1) <223> Xaa is A, G or T <220> <221> MISC_FEATURE <222> (2)..(2) <223> Xaa is A, L, S or G <220> <221> MISC_FEATURE <222> (3) <223> Xaa is S, G, E, V, A or K <220> <221> MISC_FEATURE <222> (4) <223> Xaa is P, R or L <220> <221> MISC_FEATURE <222> (5) <223> Xaa is D, E, L, T, I or A <220> <221> MISC_FEATURE <222> (6) <223> Xaa is K, R, V, L, S or H <220> <221> MISC_FEATURE <222> (7) <223> Xaa is P, A, Y, F, G or Q <220> <221> MISC_FEATURE <222> (8) <223> Xaa is F, H, T, V or S <220> <221> MISC_FEATURE <222> (9)..(9) <223> Xaa is Y, S, L, A, H or M <220> <221> MISC_FEATURE <222> (10)..(10) <223> Xaa is T, I, C, A or W <220> <221> MISC_FEATURE <222> (11)..(11) <223> Xaa is D, Y, S, L or V <220> <221> MISC_FEATURE <222> (12)..(12) <223> Xaa is Q, A, L, M or C <220> <221> MISC_FEATURE <222> (13) <223> Xaa is T, S, N or C <220> <221> MISC_FEATURE <222> (14)..(14) <223> Xaa is M, E, H, Q, A or None <220> <221> MISC_FEATURE <222> (15) <223> Xaa is C, Y, G, H, A, N or none <220> <221> MISC_FEATURE <222> (16)..(16) <223> Xaa is N, D, M, Y, S, E or none <220> <221> MISC_FEATURE <222> (17)..(17) <223> Xaa is K, I, Y, R, F or none <220> <221> MISC_FEATURE <222> (18)..(18) <223> Xaa is H, D, S, G or none <220> <221> MISC_FEATURE <222> (19)..(19) <223> Xaa is Y, T, D, L or none <220> <221> MISC_FEATURE <222> (20)..(20) <223> Xaa is Y or none <220> <221> MISC_FEATURE <222> (21)..(21) <223> Xaa is G or none <220> <221> MISC_FEATURE <222> (22)..(22) <223> Xaa is Y or none <400> 3 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1 5 10 15 Xaa Xaa Xaa Xaa Xaa Xaa 20 <210> 4 <211> 8 <212> PRT <213> Artificial <220> <223> CDR1 <400> 4 Gly Ser Thr Leu Asp Pro Phe Val 1 5 <210> 5 <211> 8 <212> PRT <213> Artificial <220> <223> CDR1 <400> 5 Gly Leu Asn Phe Gly Ile Tyr Asp 1 5 <210> 6 <211> 8 <212> PRT <213> Artificial <220> <223> CDR1 <400> 6 Gly Asp Thr Leu Glu Ser Phe Ala 1 5 <210> 7 <211> 8 <212> PRT <213> Artificial <220> <223> CDR1 <400> 7 Gly Phe Thr Leu Asp Asp His Ala 1 5 <210> 8 <211> 8 <212> PRT <213> Artificial <220> <223> CDR1 <400> 8 Gly Phe Ser Ser Asp Tyr Tyr Asp 1 5 <210> 9 <211> 8 <212> PRT <213> Artificial <220> <223> CDR1 <400> 9 Gly Phe Thr Leu Asp Asp Gln Ala 1 5 <210> 10 <211> 8 <212> PRT <213> Artificial <220> <223> CDR1 <400> 10 Gly Gly Thr Leu Asp Tyr Trp Ser 1 5 <210> 11 <211> 6 <212> PRT <213> Artificial <220> <223> CDR2 <400> 11 Ile Asn Arg Ser Arg Thr 1 5 <210> 12 <211> 6 <212> PRT <213> Artificial <220> <223> CDR2 <400> 12 Ile Asn Arg Asn Arg Ala 1 5 <210> 13 <211> 8 <212> PRT <213> Artificial <220> <223> CDR2 <400> 13 Met Asn Pro Asp Gly Asp Ile Thr 1 5 <210> 14 <211> 8 <212> PRT <213> Artificial <220> <223> CDR2 <400> 14 Ile Gly Arg Thr Gly Glu Phe Thr 1 5 <210> 15 <211> 7 <212> PRT <213> Artificial <220> <223> CDR2 <400> 15 Ile Ser Ser Ser Gly Arg Thr 1 5 <210> 16 <211> 8 <212> PRT <213> Artificial <220> <223> CDR2 <400> 16 Ile Arg Ser Ser Gly Gly Ser Thr 1 5 <210> 17 <211> 7 <212> PRT <213> Artificial <220> <223> CDR2 <400> 17 Ile Ser Ser Ser Gly Arg Gly 1 5 <210> 18 <211> 8 <212> PRT <213> Artificial <220> <223> CDR2 <400> 18 Ile Ser Gly Thr Gly Leu Arg Thr 1 5 <210> 19 <211> 22 <212> PRT <213> Artificial <220> <223> CDR3 <400> 19 Ala Ala Ser Pro Asp Lys Pro Phe Tyr Thr Asp Gln Thr Met Cys Asn 1 5 10 15 Lys His Tyr Tyr Gly Tyr 20 <210> 20 <211> 22 <212> PRT <213> Artificial <220> <223> CDR3 <400> 20 Ala Ala Ser Pro Asp Lys Ala Phe Tyr Thr Asp Gln Thr Met Cys Asn 1 5 10 15 Ile His Tyr Tyr Gly Tyr 20 <210> 21 <211> 13 <212> PRT <213> Artificial <220> <223> CDR3 <400> 21 Ala Leu Gly Pro Glu Arg Tyr Phe Ser Ile Tyr Ala Thr 1 5 10 <210> 22 <211> 19 <212> PRT <213> Artificial <220> <223> CDR3 <400> 22 Ala Ala Glu Arg Leu Val Phe His Leu Cys Ser Leu Ser Glu Tyr Asp 1 5 10 15 Tyr Asp Thr <210> 23 <211> 19 <212> PRT <213> Artificial <220> <223> CDR3 <400> 23 Ala Ser Val Pro Thr Leu Gly Thr Ala Cys Leu Met Thr His Gly Met 1 5 10 15 Arg Ser Asp <210> 24 <211> 19 <212> PRT <213> Artificial <220> <223> CDR3 <400> 24 Gly Leu Ala Pro Ile Ser Pro Val His Ala Val Cys Asn Gln His Tyr 1 5 10 15 Phe Gly Tyr <210> 25 <211> 19 <212> PRT <213> Artificial <220> <223> CDR3 <400> 25 Ala Ser Val Pro Ala Val Gln Thr Met Cys Leu Met Thr His Ala Ser 1 5 10 15 Arg Asp Asp <210> 26 <211> 19 <212> PRT <213> Artificial <220> <223> CDR3 <400> 26 Thr Gly Lys Leu Leu His Pro Ser Leu Trp Ser Ala Cys Ala Asn Glu 1 5 10 15 Tyr Asp Leu <210> 27 <211> 127 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 27 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Ala Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Leu Asp Pro Phe 20 25 30 Val Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Thr Val 35 40 45 Ala Cys Ile Asn Arg Ser Arg Thr Ser Tyr Ala Asp Ser Val Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Met Val Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Ser Pro Asp Lys Pro Phe Tyr Thr Asp Gln Thr Met Cys Asn Lys His 100 105 110 Tyr Tyr Gly Tyr Trp Thr Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 28 <211> 127 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 28 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Ala Gln Ser Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Val Ser Gly Ser Thr Leu Asp Pro Phe 20 25 30 Val Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Thr Val 35 40 45 Ser Cys Ile Asn Arg Asn Arg Ala Ser Tyr Ala Asp Gly Val Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Asp Thr Ala Lys Asn Met Val Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Ser Pro Asp Lys Ala Phe Tyr Thr Asp Gln Thr Met Cys Asn Ile His 100 105 110 Tyr Tyr Gly Tyr Trp Ala Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 29 <211> 127 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 29 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Ala Gln Ser Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Val Ser Gly Ser Thr Leu Asp Pro Phe 20 25 30 Val Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Thr Val 35 40 45 Ser Cys Ile Asn Arg Asn Arg Ala Ser Tyr Ala Asp Gly Val Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Asp Thr Ala Lys Asn Met Val Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Ser Pro Asp Lys Ala Phe Tyr Thr Asp Gln Thr Met Cys Asn Ile His 100 105 110 Tyr Tyr Gly Tyr Trp Ala Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 125 <210> 30 <211> 120 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 30 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Val Ser Gly Leu Asn Phe Gly Ile Tyr 20 25 30 Asp Phe Thr Trp Gly Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45 Ala Thr Met Asn Pro Asp Gly Asp Ile Thr Asn Tyr Val Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Asn Glu Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Leu Tyr Tyr Cys 85 90 95 Ala Leu Gly Pro Glu Arg Tyr Phe Ser Ile Tyr Ala Thr Arg Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 31 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 31 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ser Ser Gly Asp Thr Leu Glu Ser Phe 20 25 30 Ala Val Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Leu 35 40 45 Ala Cys Ile Gly Arg Thr Gly Glu Phe Thr Asp Tyr Pro Gly Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Thr Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Glu Met Val Asn Leu Lys Ala Glu Asp Thr Gly Val Tyr Tyr Cys 85 90 95 Ala Ala Glu Arg Leu Val Phe His Leu Cys Ser Leu Ser Glu Tyr Asp 100 105 110 Tyr Asp Thr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 32 <211> 125 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 32 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Phe Thr Leu Asp Asp His 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Ala Arg Glu Gly Val 35 40 45 Ser Cys Ile Ser Ser Ser Gly Arg Thr Thr Tyr Leu Leu Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Thr Arg Asp Asn Ala Lys Asn Thr Ala Tyr Leu 65 70 75 80 Gln Met Asn Arg Leu Gln Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Ser Val Pro Thr Leu Gly Thr Ala Cys Leu Met Thr His Gly Met Arg 100 105 110 Ser Asp Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 33 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 33 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Val Ser Gly Phe Ser Ser Asp Tyr Tyr 20 25 30 Asp Ile Gly Trp Phe Arg Gln Asp Pro Glu Lys Glu Arg Glu Met Val 35 40 45 Ser Cys Ile Arg Ser Ser Gly Gly Ser Thr Lys Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Glu Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Gly Leu Ala Pro Ile Ser Pro Val His Ala Val Cys Asn Gln His Tyr 100 105 110 Phe Gly Tyr Trp Gly Gln Gly Thr Arg Val Thr Val Ser Ser 115 120 125 <210> 34 <211> 125 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 34 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Asp Asp Gln 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Ala Cys Ile Ser Ser Ser Gly Arg Gly Thr Tyr Leu Leu Ser Val Lys 50 55 60 Gly Arg Phe Thr Val Thr Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Arg Leu Gln Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Ser Val Pro Ala Val Gln Thr Met Cys Leu Met Thr His Ala Ser Arg 100 105 110 Asp Asp Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 35 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 35 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Gly Thr Leu Asp Tyr Trp 20 25 30 Ser Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Val 35 40 45 Ser Cys Ile Ser Gly Thr Gly Leu Arg Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ser Arg Asn Ser Val Ile 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Gly Val Tyr Tyr Cys 85 90 95 Thr Gly Lys Leu Leu His Pro Ser Leu Trp Ser Ala Cys Ala Asn Glu 100 105 110 Tyr Asp Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 36 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 36 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Ser Asp Tyr Tyr 20 25 30 Asp Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Met Val 35 40 45 Ser Cys Ile Arg Ser Ser Gly Gly Ser Thr Lys Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Gly Leu Ala Pro Ile Ser Pro Val His Ala Val Cys Asn Gln His Tyr 100 105 110 Phe Gly Tyr Trp Gly Gln Gly Thr Arg Val Thr Val Ser Ser 115 120 125 <210> 37 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 37 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Ser Asp Tyr Tyr 20 25 30 Asp Ile Gly Trp Phe Arg Gln Asp Pro Gly Lys Glu Arg Glu Met Val 35 40 45 Ser Cys Ile Arg Ser Ser Gly Gly Ser Thr Lys Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Gly Leu Ala Pro Ile Ser Pro Val His Ala Val Cys Asn Gln His Tyr 100 105 110 Phe Gly Tyr Trp Gly Gln Gly Thr Arg Val Thr Val Ser Ser 115 120 125 <210> 38 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 38 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Ser Asp Tyr Tyr 20 25 30 Asp Ile Gly Trp Phe Arg Gln Ala Pro Glu Lys Glu Arg Glu Met Val 35 40 45 Ser Cys Ile Arg Ser Ser Gly Gly Ser Thr Lys Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Gly Leu Ala Pro Ile Ser Pro Val His Ala Val Cys Asn Gln His Tyr 100 105 110 Phe Gly Tyr Trp Gly Gln Gly Thr Arg Val Thr Val Ser Ser 115 120 125 <210> 39 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 39 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Ser Asp Tyr Tyr 20 25 30 Asp Ile Gly Trp Phe Arg Gln Asp Pro Glu Lys Glu Arg Glu Met Val 35 40 45 Ser Cys Ile Arg Ser Ser Gly Gly Ser Thr Lys Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Gly Leu Ala Pro Ile Ser Pro Val His Ala Val Cys Asn Gln His Tyr 100 105 110 Phe Gly Tyr Trp Gly Gln Gly Thr Arg Val Thr Val Ser Ser 115 120 125 <210> 40 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 40 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Ser Asp Tyr Tyr 20 25 30 Asp Ile Gly Trp Phe Arg Gln Asp Pro Glu Lys Glu Arg Glu Met Val 35 40 45 Ser Cys Ile Arg Ser Ser Gly Gly Ser Thr Lys Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Glu Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Gly Leu Ala Pro Ile Ser Pro Val His Ala Val Cys Asn Gln His Tyr 100 105 110 Phe Gly Tyr Trp Gly Gln Gly Thr Arg Val Thr Val Ser Ser 115 120 125 <210> 41 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 41 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Thr Leu Asp Tyr Trp 20 25 30 Ser Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Val 35 40 45 Ser Cys Ile Ser Gly Thr Gly Leu Arg Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Thr Gly Lys Leu Leu His Pro Ser Leu Trp Ser Ala Cys Ala Asn Glu 100 105 110 Tyr Asp Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 42 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 42 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Thr Leu Asp Tyr Trp 20 25 30 Ser Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Val 35 40 45 Ser Cys Ile Ser Gly Thr Gly Leu Arg Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Ile 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Thr Gly Lys Leu Leu His Pro Ser Leu Trp Ser Ala Cys Ala Asn Glu 100 105 110 Tyr Asp Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 43 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 43 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Thr Leu Asp Tyr Trp 20 25 30 Ser Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Val 35 40 45 Ser Cys Ile Ser Gly Thr Gly Leu Arg Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Gly Val Tyr Tyr Cys 85 90 95 Thr Gly Lys Leu Leu His Pro Ser Leu Trp Ser Ala Cys Ala Asn Glu 100 105 110 Tyr Asp Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 44 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 44 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Thr Leu Asp Tyr Trp 20 25 30 Ser Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Val 35 40 45 Ser Cys Ile Ser Gly Thr Gly Leu Arg Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Ile 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Gly Val Tyr Tyr Cys 85 90 95 Thr Gly Lys Leu Leu His Pro Ser Leu Trp Ser Ala Cys Ala Asn Glu 100 105 110 Tyr Asp Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 45 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 45 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Thr Leu Asp Tyr Trp 20 25 30 Ser Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Val 35 40 45 Ser Cys Ile Ser Gly Thr Gly Leu Arg Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ser Lys Asn Thr Val Ile 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Gly Val Tyr Tyr Cys 85 90 95 Thr Gly Lys Leu Leu His Pro Ser Leu Trp Ser Ala Cys Ala Asn Glu 100 105 110 Tyr Asp Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 46 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 46 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Thr Leu Asp Tyr Trp 20 25 30 Ser Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Val 35 40 45 Ser Cys Ile Ser Gly Thr Gly Leu Arg Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ser Lys Asn Ser Val Ile 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Gly Val Tyr Tyr Cys 85 90 95 Thr Gly Lys Leu Leu His Pro Ser Leu Trp Ser Ala Cys Ala Asn Glu 100 105 110 Tyr Asp Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 47 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 47 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Gly Thr Leu Asp Tyr Trp 20 25 30 Ser Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Val 35 40 45 Ser Cys Ile Ser Gly Thr Gly Leu Arg Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Thr Gly Lys Leu Leu His Pro Ser Leu Trp Ser Ala Cys Ala Asn Glu 100 105 110 Tyr Asp Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 48 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 48 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Gly Thr Leu Asp Tyr Trp 20 25 30 Ser Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Val 35 40 45 Ser Cys Ile Ser Gly Thr Gly Leu Arg Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Ile 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Thr Gly Lys Leu Leu His Pro Ser Leu Trp Ser Ala Cys Ala Asn Glu 100 105 110 Tyr Asp Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 49 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 49 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Gly Thr Leu Asp Tyr Trp 20 25 30 Ser Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Val 35 40 45 Ser Cys Ile Ser Gly Thr Gly Leu Arg Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Gly Val Tyr Tyr Cys 85 90 95 Thr Gly Lys Leu Leu His Pro Ser Leu Trp Ser Ala Cys Ala Asn Glu 100 105 110 Tyr Asp Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 50 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 50 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Gly Thr Leu Asp Tyr Trp 20 25 30 Ser Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Val 35 40 45 Ser Cys Ile Ser Gly Thr Gly Leu Arg Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Ile 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Gly Val Tyr Tyr Cys 85 90 95 Thr Gly Lys Leu Leu His Pro Ser Leu Trp Ser Ala Cys Ala Asn Glu 100 105 110 Tyr Asp Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 51 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 51 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Gly Thr Leu Asp Tyr Trp 20 25 30 Ser Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Val 35 40 45 Ser Cys Ile Ser Gly Thr Gly Leu Arg Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ser Lys Asn Thr Val Ile 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Gly Val Tyr Tyr Cys 85 90 95 Thr Gly Lys Leu Leu His Pro Ser Leu Trp Ser Ala Cys Ala Asn Glu 100 105 110 Tyr Asp Leu Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 52 <211> 127 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 52 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Leu Asp Pro Phe 20 25 30 Val Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Thr Val 35 40 45 Ser Cys Ile Asn Arg Ser Arg Thr Ser Tyr Ala Asp Ser Val Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Ser Pro Asp Lys Pro Phe Tyr Thr Asp Gln Thr Met Cys Asn Lys His 100 105 110 Tyr Tyr Gly Tyr Trp Thr Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 53 <211> 127 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 53 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Leu Asp Pro Phe 20 25 30 Val Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Thr Val 35 40 45 Ser Cys Ile Asn Arg Ser Arg Thr Ser Tyr Ala Asp Ser Val Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Met Val Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Ser Pro Asp Lys Pro Phe Tyr Thr Asp Gln Thr Met Cys Asn Lys His 100 105 110 Tyr Tyr Gly Tyr Trp Thr Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 54 <211> 127 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 54 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Leu Asp Pro Phe 20 25 30 Val Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Thr Val 35 40 45 Ser Cys Ile Asn Arg Ser Arg Thr Ser Tyr Ala Asp Ser Val Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Ser Pro Asp Lys Pro Phe Tyr Thr Asp Gln Thr Met Cys Asn Lys His 100 105 110 Tyr Tyr Gly Tyr Trp Thr Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 55 <211> 127 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 55 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Leu Asp Pro Phe 20 25 30 Val Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Thr Val 35 40 45 Ala Cys Ile Asn Arg Ser Arg Thr Ser Tyr Ala Asp Ser Val Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Ser Pro Asp Lys Pro Phe Tyr Thr Asp Gln Thr Met Cys Asn Lys His 100 105 110 Tyr Tyr Gly Tyr Trp Thr Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 56 <211> 127 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 56 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Leu Asp Pro Phe 20 25 30 Val Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Thr Val 35 40 45 Ala Cys Ile Asn Arg Ser Arg Thr Ser Tyr Ala Asp Ser Val Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Met Val Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Ser Pro Asp Lys Pro Phe Tyr Thr Asp Gln Thr Met Cys Asn Lys His 100 105 110 Tyr Tyr Gly Tyr Trp Thr Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 57 <211> 127 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 57 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Leu Asp Pro Phe 20 25 30 Val Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Thr Val 35 40 45 Ala Cys Ile Asn Arg Ser Arg Thr Ser Tyr Ala Asp Ser Val Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Ser Pro Asp Lys Pro Phe Tyr Thr Asp Gln Thr Met Cys Asn Lys His 100 105 110 Tyr Tyr Gly Tyr Trp Thr Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 58 <211> 127 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 58 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Leu Asp Pro Phe 20 25 30 Val Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Thr Val 35 40 45 Ala Cys Ile Asn Arg Ser Arg Thr Ser Tyr Ala Asp Ser Val Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Met Val Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Ser Pro Asp Lys Pro Phe Tyr Thr Asp Gln Thr Met Cys Asn Lys His 100 105 110 Tyr Tyr Gly Tyr Trp Thr Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 59 <211> 127 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 59 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Leu Asp Pro Phe 20 25 30 Val Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Thr Val 35 40 45 Ser Cys Ile Asn Arg Ser Arg Thr Ser Tyr Ala Asp Ser Val Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Ser Pro Asp Lys Pro Phe Tyr Thr Asp Gln Thr Met Cys Asn Lys His 100 105 110 Tyr Tyr Gly Tyr Trp Thr Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 60 <211> 127 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 60 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Leu Asp Pro Phe 20 25 30 Val Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Gly Arg Glu Thr Val 35 40 45 Ala Cys Ile Asn Arg Ser Arg Thr Ser Tyr Ala Asp Ser Val Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Met Val Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Ser Pro Asp Lys Pro Phe Tyr Thr Asp Gln Thr Met Cys Asn Lys His 100 105 110 Tyr Tyr Gly Tyr Trp Thr Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 61 <211> 127 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 61 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Leu Asp Pro Phe 20 25 30 Val Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Gly Arg Glu Thr Val 35 40 45 Ser Cys Ile Asn Arg Ser Arg Thr Ser Tyr Ala Asp Ser Val Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Ser Pro Asp Lys Pro Phe Tyr Thr Asp Gln Thr Met Cys Asn Lys His 100 105 110 Tyr Tyr Gly Tyr Trp Thr Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 62 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 62 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asp Thr Leu Glu Ser Phe 20 25 30 Ala Val Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Leu 35 40 45 Ser Cys Ile Gly Arg Thr Gly Glu Phe Thr Asp Tyr Pro Gly Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Glu Arg Leu Val Phe His Leu Cys Ser Leu Ser Glu Tyr Asp 100 105 110 Tyr Asp Thr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 63 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 63 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asp Thr Leu Glu Ser Phe 20 25 30 Ala Val Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Leu 35 40 45 Ser Cys Ile Gly Arg Thr Gly Glu Phe Thr Asp Tyr Pro Gly Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Glu Arg Leu Val Phe His Leu Cys Ser Leu Ser Glu Tyr Asp 100 105 110 Tyr Asp Thr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 64 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 64 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asp Thr Leu Glu Ser Phe 20 25 30 Ala Val Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Leu 35 40 45 Ser Cys Ile Gly Arg Thr Gly Glu Phe Thr Asp Tyr Pro Gly Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Thr Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Glu Arg Leu Val Phe His Leu Cys Ser Leu Ser Glu Tyr Asp 100 105 110 Tyr Asp Thr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 65 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 65 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asp Thr Leu Glu Ser Phe 20 25 30 Ala Val Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Leu 35 40 45 Ala Cys Ile Gly Arg Thr Gly Glu Phe Thr Asp Tyr Pro Gly Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Glu Arg Leu Val Phe His Leu Cys Ser Leu Ser Glu Tyr Asp 100 105 110 Tyr Asp Thr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 66 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 66 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asp Thr Leu Glu Ser Phe 20 25 30 Ala Val Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Leu 35 40 45 Ala Cys Ile Gly Arg Thr Gly Glu Phe Thr Asp Tyr Pro Gly Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Glu Arg Leu Val Phe His Leu Cys Ser Leu Ser Glu Tyr Asp 100 105 110 Tyr Asp Thr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 67 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 67 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asp Thr Leu Glu Ser Phe 20 25 30 Ala Val Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Leu 35 40 45 Ala Cys Ile Gly Arg Thr Gly Glu Phe Thr Asp Tyr Pro Gly Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Thr Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Glu Arg Leu Val Phe His Leu Cys Ser Leu Ser Glu Tyr Asp 100 105 110 Tyr Asp Thr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 68 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 68 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asp Thr Leu Glu Ser Phe 20 25 30 Ala Val Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Leu 35 40 45 Ala Cys Ile Gly Arg Thr Gly Glu Phe Thr Asp Tyr Pro Gly Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Thr Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Glu Arg Leu Val Phe His Leu Cys Ser Leu Ser Glu Tyr Asp 100 105 110 Tyr Asp Thr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 69 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 69 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asp Thr Leu Glu Ser Phe 20 25 30 Ala Val Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Val 35 40 45 Ala Cys Ile Gly Arg Thr Gly Glu Phe Thr Asp Tyr Pro Gly Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Glu Arg Leu Val Phe His Leu Cys Ser Leu Ser Glu Tyr Asp 100 105 110 Tyr Asp Thr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 70 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 70 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asp Thr Leu Glu Ser Phe 20 25 30 Ala Val Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Val 35 40 45 Ala Cys Ile Gly Arg Thr Gly Glu Phe Thr Asp Tyr Pro Gly Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Glu Arg Leu Val Phe His Leu Cys Ser Leu Ser Glu Tyr Asp 100 105 110 Tyr Asp Thr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 71 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 71 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asp Thr Leu Glu Ser Phe 20 25 30 Ala Val Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Val 35 40 45 Ala Cys Ile Gly Arg Thr Gly Glu Phe Thr Asp Tyr Pro Gly Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Thr Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Glu Arg Leu Val Phe His Leu Cys Ser Leu Ser Glu Tyr Asp 100 105 110 Tyr Asp Thr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 72 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 72 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asp Thr Leu Glu Ser Phe 20 25 30 Ala Val Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Leu 35 40 45 Ala Cys Ile Gly Arg Thr Gly Glu Phe Thr Asp Tyr Pro Gly Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Thr Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Glu Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Glu Arg Leu Val Phe His Leu Cys Ser Leu Ser Glu Tyr Asp 100 105 110 Tyr Asp Thr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 73 <211> 126 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 73 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ser Ser Gly Asp Thr Leu Glu Ser Phe 20 25 30 Ala Val Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Leu 35 40 45 Ala Cys Ile Gly Arg Thr Gly Glu Phe Thr Asp Tyr Pro Gly Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Thr Arg Asp Asn Ser Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Val Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Glu Arg Leu Val Phe His Leu Cys Ser Leu Ser Glu Tyr Asp 100 105 110 Tyr Asp Thr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 74 <211> 229 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 74 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe 1 5 10 15 Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 20 25 30 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 35 40 45 Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val 50 55 60 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser 65 70 75 80 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 85 90 95 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 100 105 110 Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 115 120 125 Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln 130 135 140 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 145 150 155 160 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 165 170 175 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 180 185 190 Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser 195 200 205 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 210 215 220 Leu Ser Leu Gly Lys 225 <210> 75 <211> 247 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 75 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Thr Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Thr Phe Ile Ser Tyr Asp Gly Asn Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Ile Tyr Tyr Cys 85 90 95 Ala Arg Thr Gly Trp Leu Gly Pro Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ala Ser Glu Ile Val Leu Thr 130 135 140 Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu 145 150 155 160 Ser Cys Arg Ala Ser Gln Ser Val Gly Ser Ser Tyr Leu Ala Trp Tyr 165 170 175 Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Gly Ala Phe 180 185 190 Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly 195 200 205 Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu Pro Glu Asp Phe Ala 210 215 220 Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Pro Trp Thr Phe Gly Gln 225 230 235 240 Gly Thr Lys Val Glu Ile Lys 245 <210> 76 <211> 127 <212> PRT <213> Artificial <220> <223> Amino acid sequence of the antibody <400> 76 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Ile Tyr Ser Ala Tyr 20 25 30 Cys Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Gly Leu Glu Gly Val 35 40 45 Ala Ala Ile Tyr Ile Gly Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Asp Val Ile Pro Thr Glu Thr Cys Leu Gly Gly Ser Trp Ser 100 105 110 Gly Pro Phe Gly Tyr Trp Gly Gln Gly Thr Leu Val Thr Ser Ser 115 120 125 <210> 77 <211> 24 <212> DNA <213> Artificial <220> <223> Primers <400> 77 gtcctggctg ctcttctaca aggc 24 <210> 78 <211> twenty three <212> DNA <213> Artificial <220> <223> Primers <400> 78 ggtacgtgct gttgaactgt tcc 23 <210> 79 <211> 29 <212> DNA <213> Artificial <220> <223> Primers <400> 79 gatgtgcagc tgcaggagtc tggrggagg 29 <210> 80 <211> 35 <212> DNA <213> Artificial <220> <223> Primers <400> 80 ggactagtgc ggccgctgga gacggtgacc tgggt 35

Claims

1. A CTLA-4 binding molecule, comprising an anti-CTLA-4 single domain antibody, wherein the complementarity determining region (CDR) of the single domain antibody comprises CDR1, CDR2 and CDR3, wherein the sequence of CDR1 is shown in SEQ ID NO:8, the sequence of CDR2 is shown in SEQ ID NO:16, and the sequence of CDR3 is shown in SEQ ID NO:

24.

2. The CTLA-4 binding molecule according to claim 1, wherein The single domain antibody VHH is as shown in any one of SEQ ID NOs: 33, 36-40, and / or The CTLA-4 binding molecule is a monovalent or multivalent single domain antibody or heavy chain antibody comprising one or more of the single domain antibodies.

3. A polynucleotide molecule, the polynucleotide sequence of which is selected from: (1) The coding sequence of the CTLA-4 binding molecule of claim 1 or 2; (2) The complementary sequence of (1).

4. A nucleic acid construct, characterized in that The nucleic acid construct comprises the polynucleotide molecule of claim 3.

5. The nucleic acid construct according to claim 4, wherein The nucleic acid construct is a recombinant vector.

6. The nucleic acid construct according to claim 4, wherein The nucleic acid construct is an expression vector.

7. A bacteriophage comprising the CTLA-4 binding molecule of any one of claims 1-2.

8. The bacteriophage according to claim 7, characterized in that The CTLA-4 binding molecule is displayed on the surface of the bacteriophage.

9. A host cell, characterized in that The host cell: (1) expressing the CTLA-4 binding molecule of any one of claims 1 to 2; and / or (2) comprising the polynucleotide molecule of claim 3; and / or (3) A nucleic acid construct comprising any one of claims 4 to 6.

10. A method for producing a CTLA-4 binding molecule, comprising: The host cell of claim 9 is cultured under conditions suitable for producing the CTLA-4 binding molecule.

11. The method according to claim 10, characterized in that The method further comprises purifying the CTLA-4 binding molecule from the culture.

12. A kit for detecting CTLA-4, the kit comprising the CTLA-4 binding molecule according to any one of claims 1-2.

13. The kit according to claim 12, characterized in that The kit also includes reagents for detecting binding of CTLA-4 to the CTLA-4 binding molecule.

14. The kit according to claim 13, wherein The reagent is a reagent for detecting the binding by enzyme-linked immunosorbent assay.

15. A non-diagnostic method for detecting the presence of CTLA-4 in a sample, the method comprising: The CTLA-4 binding molecule of any one of claims 1 to 2 is incubated with a sample, and the binding of CTLA-4 to the CTLA-4 binding molecule is detected to thereby determine the presence of CTLA-4 in the sample.

16. Use of the CTLA-4 binding molecule of any one of claims 1-2 in the preparation of a kit for detecting CTLA-4 in a sample.

Images