A recombinant Bacillus subtilis strain for highly expressing raw starch α-amylase and its application

By expressing the optimized starch α-amylase AmyZ1 in Bacillus subtilis WB600, the problem of low expression level of starch α-amylase in the prior art was solved, efficient expression and high enzyme activity were achieved, and its use in a variety of industrial applications was expanded.

CN115873772BActive Publication Date: 2025-05-30ANHUI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210914414.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-01
Publication Date
2025-05-30
Estimated Expiration
2042-08-01

AI Technical Summary

Technical Problem

In the prior art, the expression level of starch alpha-amylase is low and lacks high-energy activity of starch alpha-amylase, which limits its application in food processing, sewage treatment and other fields.

Method used

By constructing the recombinant plasmid pBHSS142-C1-amyZ1 and expressing the starch α-amylase AmyZ1 derived from Pontibacillus sp.ZY in Bacillus subtilis WB600, the signal peptide and promoter sequences were optimized to improve the expression efficiency of proteins.

Benefits of technology

It has achieved efficient expression of starch-grown α-amylase in Bacillus subtilis WB600, and the enzyme activity after shake flask fermentation reaches 2974U/mL, reducing production costs, and expanding its application in the fields of preparation of raw starch, hydrolyzed raw starch sugar production, food baking and bioethanol production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115873772B_ABST
    Figure CN115873772B_ABST
Patent Text Reader

Abstract

The present invention discloses a recombinant Bacillus subtilis strain for highly expressing raw starch α - amylase and its application. The recombinant Bacillus subtilis strain of the present invention uses pBHSS142 as an expression vector, the raw starch α - amylase gene derived from Pontibacillus sp. ZY as the target gene, and Bacillus subtilis WB600 as an expression host. A signal peptide gene is inserted upstream of the target gene, and the promoter, 5' untranslated region sequence and proximal coding sequence are modified. The recombinant Bacillus subtilis strain of the present invention can highly express α - amylase. Using it as a production strain, after shake - flask fermentation for 48 h, the enzyme activity of α - amylase in the fermentation broth can be increased to 2974 U / mL.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a recombinant Bacillus subtilis bacteria capable of efficiently expressing raw starch alpha-amylase and application thereof, belonging to the technical fields of genetic engineering and microbial engineering. Background Art

[0002] α-Amylase (EC 3.2.1.1) is an important industrial enzyme in the glycoside hydrolase class. It is widely available in animals, plants, and microorganisms. α-Amylase acts on α-1,4-glucosidic bonds within starch, polysaccharides, and oligosaccharides, producing maltooligosaccharides and glucosides with the α-anomeric configuration retained. Therefore, α-amylase is widely used in food processing, wastewater treatment, the pharmaceutical industry, the brewing industry, and new bioenergy applications.

[0003] Of the α-amylases discovered, less than 10% are capable of degrading raw starch. These enzymes act directly on raw starch, ungelatinized, effectively simplifying the initial processing of raw starch in the modern fermentation industry, reducing energy and costs. To date, most raw starch α-amylases have been cloned and heterologously expressed, primarily in Escherichia coli and Bacillus. However, expression levels of raw starch α-amylases remain low. In addition to the lack of high-specific activity raw starch α-amylases, efficient protein expression strains remain a major limitation. Bacillus subtilis has been reported to express a variety of amylases. Compared to E. coli, it is endotoxin-free, making it a food-safe strain. It can also secrete the target protein extracellularly, facilitating subsequent protein processing. The ability to hydrolyze raw starch, also known as granular starch, without the need for cooking, low temperatures, sub-gelatinization temperatures, or unconventional starch hydrolysis is considered a major breakthrough in the starch processing industry. Therefore, the development of recombinant strains capable of efficiently expressing raw starch α-amylases holds great promise. Summary of the Invention

[0004] To address the aforementioned issues in raw amylase production, the present invention provides a recombinant Bacillus subtilis strain that efficiently expresses raw starch α-amylase and its applications. The engineered Bacillus subtilis strain of the present invention can efficiently express α-amylase. Using it as a production strain, shake flask fermentation for 48 hours can increase the α-amylase activity in the fermentation broth to 2974 U / mL.

[0005] The recombinant Bacillus subtilis bacteria of the present invention that efficiently express raw starch α-amylase are classified and named Bacillus subtilis WB600 / pBHSS142-C1-amyZ1, and are deposited in the China Center for Type Culture Collection (CCTCC), address: Wuhan University, Wuhan, China, with a deposit number of CCTCC NO: M 2022980 and a deposit date of June 27, 2022.

[0006] The invention discloses a recombinant Bacillus subtilis strain that efficiently expresses raw starch α-amylase, comprising a recombinant plasmid and an expression host. The recombinant plasmid comprises a target gene, a promoter sequence, a 5' untranslated region, a signal peptide gene, and an expression vector; the expression host is Bacillus subtilis WB600.

[0007] Furthermore, the target gene is an α-amylase gene; the nucleotide sequence of the α-amylase gene AmyZ1 is shown in SEQ ID No: 1, or is a nucleotide sequence of SEQ ID No: 1 with several nucleotides mutated synonymously and encoding the same protein amino acid sequence.

[0008] Furthermore, the nucleotide sequence of the promoter is shown in SEQ ID NO: 2; the nucleotide sequence of the 5' untranslated region is shown in SEQ ID NO: 3; the nucleotide sequence of the synonymous mutation of the signal peptide gene is shown in SEQ ID NO: 4; and the expression vector is pHT43 or pBHE or pBHSS142 constructed based on pHT43.

[0009] The invention discloses a recombinant Bacillus subtilis bacterium for efficiently expressing raw starch α-amylase, preferably using pBHSS142 as an expression vector, a raw starch α-amylase gene derived from Pontibacillus sp. ZY as a target gene, and Bacillus subtilis WB600 as an expression host. A signal peptide gene is inserted upstream of the target gene, and a promoter, a 5' untranslated region sequence, and a proximal coding sequence are modified.

[0010] The method for constructing a recombinant Bacillus subtilis strain that efficiently expresses raw starch α-amylase of the present invention comprises the following steps:

[0011] Step 1: Using genomic DNA of Pontibacillus sp. ZY bacteria containing a raw starch hydrolase gene with high specific enzyme activity as a template, PCR amplification was performed using primers P1 and P2 to obtain a PCR amplification product, which was double-digested with BamH I and Xba I to obtain the double-digested fragment amyZ1 and plasmid pHT43, and then the digested amyZ1 and pHT43 were ligated with T4 DNA ligase to obtain a ligation product;

[0012] Step 2: The obtained ligation product was transformed into Escherichia coli Trans1-T1 competent cells, and positive clones were screened; plasmids were extracted from the positive clones, and then used as templates to amplify the AmyZ1 expression cassette elements using P3 and P4; plasmid pBEP43 was used as a template and P5 and P6 were used as primers to amplify the kan resistance gene and replication element; the above two fragments were connected by POE-PCR method, and then transformed into Bacillus subtilis WB600 competent cells, positive clones were picked, plasmids were extracted and sequenced, and the correct plasmid obtained was pBHE-amyZ1.

[0013] Step 3: Using the Bacillus subtilis 168 genome as a template and primers P7 and P8 to amplify the endogenous promoter P spoVG , P9 and P10 were used as primers to amplify the truncated promoter P spoVG142 Then, the two promoters were connected into a double promoter P using the Overlap method. SS142 The plasmid pBHE-amyZ1 obtained above was used as a template, P13 and P14 were used as primers to amplify the backbone plasmid, and then the backbone plasmid was amplified with the dual promoter P by POE-PCR. SS142 The ligation was performed and then transformed into Bacillus subtilis WB600 competent cells. Positive clones were picked, plasmids were extracted and sequenced, and the correct plasmid obtained was pBHSS142-amyZ1.

[0014] Step 4: Use plasmid pBHSS142-amyZ1 as template and primers P15 and P16 to amplify signal peptide SP YpuA The backbone plasmid was amplified using primers P17 and P18, and then the backbone plasmid was ligated with the signal peptide SP by POE-PCR. YpuA The plasmid was ligated and then transformed into Bacillus subtilis WB600 competent cells. The positive clones were picked, the plasmid was extracted and sequenced. The correct plasmid was pBHSS142-SP. YpuA -amyZ1.

[0015] Step 5: Use plasmid pBHSS142-SP YpuA-amyZ1 was used as a template, P19 and P20 were used as primers to amplify the 5' untranslated region and synonymous mutants of amyZ1, and P21 and P22 were used as primers to amplify the backbone plasmid. The backbone plasmid was then ligated with the 5' untranslated region using the POE-PCR method and then transformed into Bacillus subtilis WB600 competent cells. Positive clones were picked, plasmids were extracted and sequenced, and the correct strain was obtained, namely the recombinant expression strain Bacillus subtilis WB600 / pBHSS142-C1-amyZ1.

[0016] The application of the recombinant Bacillus subtilis bacteria of the present invention is to produce raw starch alpha-amylase by fermenting and culturing the recombinant Bacillus subtilis bacteria.

[0017] The specific method is to first inoculate the recombinant Bacillus subtilis into a seed culture medium for cultivation to obtain a seed liquid; and then inoculate the seed liquid into a fermentation culture medium for cultivation.

[0018] The components of the seed culture medium include 8-12 g / L of peptone, 4-6 g / L of yeast powder and 8-12 g / L of sodium chloride.

[0019] The fermentation medium comprises 14-18 g / L of tryptone, 8-12 g / L of yeast extract powder and 4-6 g / L of sodium chloride; and the initial pH of the fermentation medium is 6.5-7.5.

[0020] Specifically, a single colony of the recombinant Bacillus subtilis was picked and inoculated into a seed culture medium, and cultured at 35-38°C and 180-220 rpm for 8-10 hours to obtain a seed liquid; then the seed liquid was inoculated into a fermentation medium at a volume ratio of 1:50, and cultured at 30-37°C and 180-220 rpm for 45-50 hours.

[0021] The beneficial effects of the present invention are embodied in:

[0022] The present invention constructs a novel expression vector based on pHT43, uses the raw starch α-amylase AmyZ1 from Pontibacillus sp. ZY as the target gene, obtains a strong promoter, replaces the signal peptide that can efficiently express AmyZ1, and ultimately achieves efficient expression in Bacillus subtilis WB600 by optimizing translation efficiency. The supernatant enzyme activity obtained by shake flask fermentation reaches 2974 U / mL, and the production cost is low.

[0023] The recombinant bacteria provided by the present invention have wide applications in preparing raw starch α-amylase, hydrolyzing raw starch to make sugar, food baking and bioethanol production. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Flowchart for the construction of the novel recombinant vector pBHE-amyZ1.

[0025] Figure 2 The figure is the electrophoresis pattern of the recombinant vector pBHE-amyZ1 of the present invention after double digestion with Kpn I and Xba I.

[0026] Figure 3 The figure shows a flow chart for constructing the recombinant vector pBHSS142-C1-amyZ1 of the present invention.

[0027] Figure 4 This is the SDS-PAGE electrophoresis diagram of the shake flask fermentation of the recombinant bacteria Bacillus subtilisWB600 / pBHSS142-C1-amyZ1. DETAILED DESCRIPTION

[0028] The implementation methods in the following examples are all conventional methods unless otherwise specified.

[0029] The methods involved in the following embodiments are as follows:

[0030] Preparation of competent cells of Bacillus subtilis WB600: Streak the WB600 strain onto a solid LB plate containing 1% soluble starch and culture overnight at 37°C. Use an inoculation loop to pick a single colony and inoculate it into 5 mL of GM I solution. Cultivate overnight at 37°C and 200 rpm with shaking for 10-12 hours. The next day, transfer 1 mL of fresh culture to 9 mL of GM I solution and culture at 37°C and 200 rpm with shaking for 4.5 hours. Transfer 1 mL of the previous culture to 9 mL of GM II and culture at 37°C and 200 rpm with shaking for 90 minutes. These competent cells are ready for transformation. Add an appropriate amount of DNA (~1 μg / mL) to 0.5 mL of this culture, incubate at 37°C with slow shaking (80-120 rpm) for 2.5 hours, then spread on the corresponding resistance plate and culture overnight at 37°C.

[0031] Enzyme activity detection method: 0.3 mL of 2% raw rice starch solution and 0.27 mL of 50 mM, pH 7.0 phosphate buffer were thoroughly mixed, preheated at 40°C for 10 min, 0.03 mL of crude enzyme solution was added, and the mixture was shaken to mix. After reacting for 10 min, 0.3 mL of DNS was added, shaken, and boiled for 15 min, then rapidly cooled. The mixture was centrifuged at 12,000 g for 1 min, and the absorbance was measured at 540 nm (using the inactivated enzyme solution as a control).

[0032] Under the above conditions, the amount of enzyme required to produce 1 μmol of maltose per unit time is defined as 1 U.

[0033] The culture medium involved in the following examples is as follows:

[0034] Seed culture medium: 8-12 g / L peptone, 4-6 g / L yeast powder and 8-12 g / L sodium chloride.

[0035] Fermentation medium: 14-18 g / L tryptone, 8-12 g / L yeast extract powder and 4-6 g / L sodium chloride; the initial pH of the fermentation medium is 6.5-7.5.

[0036] LB solid medium: 10 g / L peptone, 5 g / L yeast extract powder, 10 g / L NaCl, and 0.2 g / L agar powder.

[0037] LB liquid medium: 10 g / L peptone, 5 g / L yeast extract powder, and 10 g / L NaCl.

[0038] Salt solution (T-base): 2g / L (NH4)2SO4, 18.3g / L K2HPO4·3H2O, 6g / L KH2PO4, 1g / L sodium citrate·2H2O.

[0039] GMI

[0040]

[0041] GMII

[0042]

[0043] Note: Except for the salt solution, all other components of GMI and GMII culture media must be sterilized separately, and the tryptophan must be filtered out.

[0044] Mix all components before use.

[0045] (1) Construction of the novel recombinant expression vector pBHE-amyZ1

[0046] The specific implementation steps are as follows:

[0047] 1. The genome of the strain Pontibacillus sp. ZY obtained from previous laboratory screening was used as a template, and primers P1 and P2 were used to amplify the AmyZ1 sequence with restriction sites BamH I and Xba I, wherein a histidine tag was added to its 3' end.

[0048] P1: 5'CG GGATCC ATGGCAAGCAAGAATGGGAC 3'

[0049] P2: 5'GC TCTAGATTAGTGATGGTGATGGTGATGCTTTTGTTTATATACCGAGAC 3'

[0050] Note: The underlined part is the restriction enzyme cleavage site, and the histidine tag is shown in bold.

[0051] The PCR amplification program was as follows: initial denaturation at 94°C for 5 min; 30 cycles of denaturation at 94°C for 10 s, annealing at 55°C for 10 s, and extension at 72°C for 100 s; and finally, 10 min at 72°C. PCR products were recovered by electrophoresis on 1% agarose gel. The PCR products and plasmid pHT43 were digested with BamHI and XbaI. The enzyme digestion system is shown in Table 1.

[0052] Table 1 BamH I and Xba I double enzyme digestion system

[0053] Enzyme digestion components Dosage <![CDATA[QuickCut TM BamHI]]> 2μL <![CDATA[QuickCut TM XbaI]]> 2μL <![CDATA[10×QuickCut TM Buffer]]> 5μL pHT43 or PCR product 2 μg <![CDATA[ddH2O]]> Make up to 50 μL

[0054] Enzyme digestion conditions: 37°C, 30 min.

[0055] The digested PCR product and plasmid pHT43 were ligated using T4 ligase and transformed into competent E. coli Trans1-T1 cells. The transformation product was evenly plated onto an Amp-resistant selection plate and incubated overnight at 37°C. A single colony was selected and transferred to a 5 mL tube of LB medium containing Amp-resistant medium and incubated at 37°C for 8 hours. The plasmid was extracted according to the kit's instructions and verified by double digestion with BamH I and Xba I. The plasmid that was correctly digested was pHT43-amyZ1.

[0056] 2. Using pHT43-amyZ1 as a template, primers P3 and P4 were used to amplify the expression cassette element (A) of amyZ1, including the promoter, signal peptide, target gene, and terminator. Simultaneously, using plasmid pBEP43 as a template, primers P5 and P6 were used to amplify the kan resistance gene and replication element (B). The primer sequences are as follows:

[0057] P3: 5'GAGGTTCGGATTCATCTATGGGTACCAGCTATTGTAAC 3'

[0058] P4: 5'CAACGCACCTTTCAGCCCTTCCACCCTTTCGATCAATTC3'

[0059] P5: 5'GAATTGATCGAAAGGGTGGAAGGGCTGAAAGGTGCGTTG 3'

[0060] P6: 5'GTTACAATAGCTGGTACCCATAGATGAATCCGAACCTC 3'

[0061] The PCR amplification program was as follows: initial denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 150 s, and finally 10 min at 72°C. PCR products were recovered by 1% agarose gel electrophoresis.

[0062] The fragments A and B were connected into a multimeric plasmid using the POE-PCR method. A and B were added to the reaction system at a molar ratio of 1:1. The multimeric plasmid was then transformed into Bacillus subtilis WB600 and cultured at 37°C overnight after plating.

[0063] POE-PCR reaction is shown in Table 2:

[0064] Table 2 POE-PCR reaction system

[0065]

[0066] The PCR amplification program was as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 10 s, 55°C annealing for 10 s, 72°C extension for 15 min, 30 cycles; 72°C for 20 min. Double enzyme digestion was performed using Kpn I and Xba I. The results are shown in Figure 2 As shown. The enzyme digestion system is shown in Table 3:

[0067] Table 3 Kpn I and Xba I double enzyme digestion system

[0068] Enzyme digestion components Dosage <![CDATA[QuickCut TM KpnI]]> 0.5μL <![CDATA[QuickCut TM XbaI]]> 0.5μL <![CDATA[10×QuickCut TM Buffer]]> 1 μL PCR products 2μL <![CDATA[ddH2O]]> Make up to 10 μL

[0069] Single colonies with clear zones were picked from the overnight culture plates and inoculated into LB liquid for culture. Plasmids were extracted and amplified using primers P3 and P4 as described in condition 2. PCR products were sent to Shanghai Sangon Biotechnology for sequencing. The plasmid corresponding to the correct sequence was pBHE-amyZ1.

[0070] (2) Recombinant dual promoter expression vector pBHSS142-amyZ1

[0071] The specific implementation steps are as follows:

[0072] 1. Using the Bacillus subtilis 168 genome as a template and primers P7 and P8 to amplify the endogenous promoter P spoVG , P9 and P10 were used as primers to amplify the truncated promoter P spoVG142 , the primer sequences are as follows:

[0073] P7: 5'GGGGTACCTGCGGAAGTAAACG 3'

[0074] P8: 5'CTATATAAAAGCATTAGTG 3'

[0075] P9: 5'GATACACTAATGCTTTTATATAGCGAAATGAAAGCTTTATGA 3'

[0076] P10: 5'CTATATAAAAGCATTAGTGTATC 3'

[0077] The PCR amplification program was as follows: initial denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C for 10 s, annealing at 55°C for 10 s, and extension at 72°C for 20 s, and finally 10 min at 72°C. PCR products were recovered by electrophoresis on 1.5% agarose gel.

[0078] The two promoters P were overlapped using the Overlap method. spoVG and P spoVG142 Connected to a dual promoter P SS142 .P spoVG and P spoVG142 Add to the reaction system at a molar ratio of 1:1. The specific reaction system is shown in Table 4:

[0079] Table 4 Overlap reaction system

[0080]

[0081] The PCR amplification program was as follows: initial denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C for 10 s, annealing at 55°C for 10 s, and extension at 72°C for 40 s, and finally 10 min at 72°C. PCR products were recovered by electrophoresis on 1.5% agarose gel.

[0082] The plasmid pBHE-amyZ1 constructed in (1) above was used as a template and primers P13 and P14 were used to amplify the backbone plasmid pBH-amyZ1. The specific steps are as follows:

[0083] The primer sequences are as follows:

[0084] P13: 5'CGTTTACTTCCGCAGGTACCCCCATAGATGAATCCGAACC 3'

[0085] P14: 5'ACACTAATGCTTTTATATAGCTGCAGCCCAATTAAAGGAGGAAGGATCA3'

[0086] The PCR amplification procedure was as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 10 s, 60°C annealing for 10 s, 72°C extension for 4 min, 30 cycles; 72°C for 10 min. The PCR product was recovered by 1% agarose gel electrophoresis. The backbone plasmid pBH-amyZ1 was then ligated with the dual promoter P by POE-PCR. SS142 The PCR product was then transformed into Bacillus subtilis WB600 competent cells, positive clones were picked, plasmids were extracted and sequenced, and the correct plasmid was obtained as the dual promoter expression vector pBHSS142-amyZ1 (see the detailed process for details). Figure 3 ).

[0087] POE-PCR reaction is shown in Table 5:

[0088] Table 5 POE-PCR reaction system

[0089]

[0090] The PCR amplification program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 10 s, annealing at 55°C for 10 s, extension at 72°C for 15 min, 30 cycles; and 72°C for 20 min.

[0091] (III) Construction of recombinant Bacillus subtilis WB600 / pBHSS142-C1-amyZ1

[0092] The plasmid pBHSS142-amyZ1 constructed in step (2) was used as a template and primers P17 and P18 were used to amplify the backbone plasmid pBHSS142-SP-amyZ1. The signal peptide SP was amplified using the genome of Bacillus subtilis 168 as a template and primers P15 and P16 as primers. YpuA .

[0093] The primer sequences are as follows:

[0094] P15:5'TGATCCTTCCCTTTTAATTGG 3'

[0095] P16: 5'GTCAGTCTCGCGGATGCCGGATCCATGGCAAGCAAGAATG 3'

[0096] P17:

[0097] 5'CCAATTAAAGGAGGAAGGATCAATGAAAAAAATATGGATTGGAATGCTGGCAGCAGC 3'

[0098] P18: 5'GGCATCCGCGAGACTGAC3'

[0099] The PCR amplification program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 10 s, annealing at 55°C for 10 s, and extension at 72°C for 4 min (backbone plasmid) and 20 s (signal peptide SP YpuA ), 30 cycles; 72℃, 10min. The PCR products were recovered by 1% agarose gel electrophoresis. The backbone plasmid pBHSS142-SP-amyZ1 was combined with the signal peptide SP by POE-PCR. YpuA The plasmid was ligated and then transformed into Bacillus subtilis WB600 competent cells. The positive clones were picked, the plasmid was extracted and sequenced. The correct plasmid was pBHSS142-SP. YpuA -amyZ1. POE-PCR reaction is shown in Table 6:

[0100] Table 6 POE-PCR reaction system

[0101]

[0102] The PCR amplification program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 10 s, annealing at 55°C for 10 s, extension at 72°C for 15 min, 30 cycles; and 72°C for 20 min.

[0103] Plasmid pBHSS142-SP YpuA -amyZ1 was used as a template, and primers P19 and P20 were used to amplify the 5' untranslated region and the synonymous mutant C1 of amyZ1. Primers P21 and P22 were used to amplify the backbone plasmid pBHSS142-C-amyZ1. The primer sequences are as follows:

[0104] P19: 5'

[0105] CTGCAGATTATAGGTAAGAGAGGAATGTACACATGGTCGTCAACTATTAGCCCAATTAAAGGAGGAAGG3'

[0106] P20:5'GAATTCGCCCCAGCCGTCTTTG3'

[0107] P21:5'CAAAGACGGCTGGGGCGAATTC3'

[0108] P22:5'CATTCCTTCTTACCTATAATCTGCAGCTATAAAAGC 3'

[0109] The PCR amplification program was as follows: initial denaturation at 94°C for 5 min, 30 cycles of denaturation at 94°C for 10 s, annealing at 55°C for 10 s, and extension at 72°C for 2 min, and finally 10 min at 72°C. PCR products were recovered by 1% agarose gel electrophoresis.

[0110] The backbone plasmid pBHSS142-C-amyZ1 was ligated with C1 using POE-PCR, and then transformed into Bacillus subtilis WB600 competent cells. Positive clones were picked, plasmids were extracted, and sequence analysis was performed. The correct strain obtained was the recombinant expression strain Bacillus subtilis WB600 / pBHSS142-C1-amyZ1. The POE-PCR reaction is shown in Table 7:

[0111] Table 7 POE-PCR reaction system

[0112]

[0113] The PCR amplification program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 10 s, annealing at 55°C for 10 s, extension at 72°C for 15 min, 30 cycles; and 72°C for 20 min.

[0114] (IV) Determination of enzyme production by shake flask fermentation and α-amylase activity in raw starch

[0115] The engineered strain Bacillus subtilis WB600 / pBHSS142-C1-amyZ1 obtained in (3) was inoculated into 5 ml seed culture medium containing kanamycin and cultured at 37°C and 200 rpm for 10-12 h. It was then transferred to 100 mL fermentation medium and cultured at 30°C and 200 rpm for 48 h. The supernatant was then collected by centrifugation at 8000 rpm and 4°C to obtain the crude enzyme solution (the results of SDS-PAGE electrophoresis of the crude enzyme solution are shown in FIG. Figure 4 ).

[0116] SEQ ID No: 1 genomic DNA

[0117]

[0118] SEQ ID No:2 genomic DNA

[0119] TGCGGAAGTAAACGAAGTGTACGGACAATATTTTGACACTCACAAACCGGCGAGATCTTGTGTTGAAGTCGCGAGACTCCCGAAGGATGCGTTAGTCGAGATCGAAGTTATTGCACTGGTGAAATAATAAGAAAAGTGATTCTGGGAGAGCCGGGATCACTTTTTTATTTACCTTATGCCCGAAATGAAAGCTTTATGACCTAATTGTGTAACTATATCCTATTTTTTCAAAAAATATTTTAAAAACGAGCAGGATTTCAGAAAAAATCGTGGAATTGATACACTAATGCTTTTATATAGCGAAATGAAAGCTTTATGACCTAATTGTGTAACTATATCCTATTTTTTTAAAAAATATTTTAAAAACGAGCAGGATTTCAGAAAAAATCGTGGAATTGATACACTAATGCTTTTATATAG

[0120] SEQ ID No:3 other DNA

[0121] CTGCAGATTATAGGTAAGAGAGGAATGTACACATGGTCGTCAACTATTAGCCCAATTAAAGGAGGAAGGATCA

[0122] SEQ ID No:4 genomic DNA

[0123] ATGAAAAAAATATGGATTGGAATGCTGGCAGCAGCAGTTTTGCTGCTGATGGTTCCGAAGGTCAGTCTCGCGGATGCC。

Claims

1. A recombinant Bacillus subtilis strain for highly expressing raw starch α-amylase, characterized in that: The recombinant Bacillus subtilis strain uses pBHSS142 as the expression vector, the raw starch α-amylase gene AmyZ1 derived from Pontibacillus sp. ZY as the target gene, and Bacillus subtilis WB600 as the expression host. A signal peptide gene YpuA is inserted upstream of the target gene, and the promoter spoVG, 5' untranslated region sequence, and 5' proximal coding sequence are modified; The classification and naming of the recombinant Bacillus subtilis strain is Bacillus subtilis WB600 / pBHSS142-C1-amyZ1, which is deposited in the China Center for Type Culture Collection (CCTCC), address: Wuhan University, Wuhan, China, deposit number CCTCC NO: M 2022980, and the deposit date is June 27, 2022.

2. An application of the recombinant Bacillus subtilis strain according to claim 1, characterized in that: By fermenting and culturing the recombinant Bacillus subtilis strain, raw starch α-amylase is produced.

3. The application according to claim 2, characterized in that: The recombinant Bacillus subtilis strain is first inoculated into a seed medium for culture to obtain a seed solution; then the seed solution is inoculated into a fermentation medium for culture.

4. The application according to claim 3, characterized in that: The components of the seed medium include 8 - 12 g / L of peptone, 4 - 6 g / L of yeast powder, and 8 - 12 g / L of sodium chloride.

5. The application according to claim 3, characterized in that: The components of the fermentation medium include 14 - 18 g / L of tryptone, 8 - 12 g / L of yeast extract powder, and 4 - 6 g / L of sodium chloride; the initial pH of the fermentation medium is 6.5 - 7.

5.

6. The application according to claim 3, characterized in that: Pick a single colony of the recombinant Bacillus subtilis strain and inoculate it into a seed medium, culture it at 35 - 38 °C and 180 - 220 rpm for 8 - 10 h to obtain a seed solution; then inoculate the seed solution into a fermentation medium at a ratio of 1:50, and culture it at 30 - 37 °C and 180 - 220 rpm for 45 - 50 h.

Citation Information

Patent Citations

  • Bacillus subtilis engineering bacteria capable of efficiently expressing alpha-amylase

    CN108841772A

  • Method for expressing alpha-amylase in bacillus subtilis

    CN112553134A