Taq DNA polymerase mutants for use in probe-based qPCR

By designing the Taq DNA polymerase mutant V64S, the problem of slow detection speed of wild-type Taq DNA polymerase in probe-based qPCR was solved, achieving more efficient amplification and detection, reducing the total detection time, and having economic advantages.

CN115873821BActive Publication Date: 2025-11-25WUHAN AIBO TAIKE BIOTECH CO LTD
View PDF 16 Cites 0 Cited by

Patent Information

Application Number
CN202211011025.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2021-09-09
Filing Date
2021-09-30
Publication Date
2025-11-25
Estimated Expiration
2041-09-30

AI Technical Summary

Technical Problem

Wild-type Taq DNA polymerase cannot rapidly separate fluorescent probes in probe-based qPCR, limiting the detection speed and becoming the rate-limiting factor for probe-based qPCR.

Method used

A Taq DNA polymerase mutant, V64S, was designed and characterized. By mutating the amino acid sequence of V64S, its 5′→3′ exonuclease activity was improved, enabling it to extend primers within 1 second.

Benefits of technology

It significantly reduces the total time of the qPCR process, improves detection efficiency, achieves faster amplification results, and has a significant economic advantage.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115873821B_ABST
    Figure CN115873821B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of molecular biology, and particularly relates to a Taq DNA polymerase mutant for probe qPCR. In the application, the Taq DNA polymerase mutant is designed, characterized and screened based on probe qPCR, a cycle process with fast amplification time (1 second of extension period) is adopted, and part of the Taq DNA polymerase mutant is obtained. Compared with the wild-type Taq DNA polymerase, the mutant provided in the application has the characteristics of fast detection and amplification result, which significantly reduces the total time required in the qPCR process and improves the detection efficiency of the qPCR or real-time qPCR. Therefore, the mutant provided in the application has great economic advantages. The Taq DNA polymerase mutant provided in the application can be used for conventional qPCR detection, including gene expression analysis and other DNA quantitative detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, and in particular relates to a Taq DNA polymerase mutant for probe-based qPCR. Background Technology

[0002] Taq DNA polymerase is generally used in polymerase chain reaction (PCR) for the amplification of nucleic acid amplicones. In a PCR reaction, the target DNA fragment (amplicon) is typically amplified through a three-step cycle: denaturation, annealing, and extension. Real-time quantitative PCR (qPCR) detects and records the amplification results by collecting fluorescence signal data generated by dyes or probes during the PCR amplification process. Probe-based detection technology refers to the use of fluorescently labeled target probes for detection. When the fluorescent probe binds to the target sequence, it releases fluorescent dye, and the progress of amplification can be inferred by detecting changes in the fluorescence signal intensity in real time.

[0003] Taq DNA polymerase possesses both DNA polymerase activity and 5′→3′ exonuclease activity, which is the basis for probe-based qPCR. Since the amplicons in probe-based qPCR are typically short, even within a short amplification interval (e.g., 1 second), the polymerization activity of wild-type Taq DNA polymerase is sufficient to meet amplification requirements. However, regardless of whether polymerization occurs during amplification, wild-type Taq DNA polymerase cannot separate the probe from its attached fluorophore within 1 second, thus limiting the detection speed. Therefore, the 5′→3′ exonuclease activity of Taq DNA polymerase, responsible for releasing the reporter signal, becomes the rate-limiting factor for probe-based qPCR. Based on this, this application provides a Taq DNA polymerase mutant capable of enhancing 5′→3′ exonuclease activity to achieve rapid qPCR detection. Summary of the Invention

[0004] In view of the problems existing in the prior art, the present invention provides a Taq DNA polymerase mutant for probe-based qPCR, aiming to solve some of the problems in the prior art or at least alleviate some of the problems in the prior art.

[0005] This invention provides a Taq DNA polymerase mutant, wherein the amino acid sequence of the Taq DNA polymerase mutant has a V64S mutation compared to the amino acid sequence of the wild-type Taq DNA polymerase; the amino acid sequence of the wild-type Taq DNA polymerase is shown in SEQ ID NO.2, and the V64S indicates that the 64th amino acid in SEQ ID NO.2 has been mutated from V to S.

[0006] Furthermore, the Taq DNA polymerase mutant can extend primers, with extension conditions limited to within 1 second.

[0007] The present invention also provides a DNA sequence encoding a Taq DNA polymerase mutant as described above. The encoding nucleotide sequence of the wild-type Taq DNA polymerase is shown in SEQ ID NO.1, and the nucleotide sequence of V64S differs from SEQ ID NO.1 only in that the codon at amino acid position 64 is replaced by TCT instead of GTT.

[0008] The present invention also provides a vector comprising the DNA sequence as described above.

[0009] The present invention also provides cells comprising the DNA sequence described above.

[0010] The present invention also provides the application of the Taq DNA polymerase mutant as described above in nucleic acid amplification.

[0011] The present invention also provides the application of the Taq DNA polymerase mutant as described above in qPCR.

[0012] The present invention also provides a qPCR detection kit, comprising: a target sequence primer, a target probe with an inserted dye or label, and a Taq DNA polymerase mutant as described above.

[0013] Furthermore, the insertion dye is either SYBR Green or EvaGreen. The label fluoresces when it is peeled off the probe by an exonuclease.

[0014] This invention also provides a qPCR detection method. The qPCR reaction system, with a total volume of 20 µL, contains 4 µL of 50 ng / µL Taq DNA polymerase mutant, 1 µL of 10 µM forward primer, 1 µL of 10 µM reverse primer, 1 µL of 5 µM tag probe, 1 µL of template, 2 µL of 10× buffer, and the remainder is water. The reaction program is: denaturation at 95 °C for 30 seconds; annealing at 95 °C for 4 seconds; extension at 60 °C for 1 second, for 40 cycles. The buffer contains 20 mM Tris-HCl, 80 mM Tris-Acetate, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 3 mM Mg-Acetate, 0.1% Triton®-X-100, and pH 8.8.

[0015] In summary, the advantages and positive effects of this invention are as follows:

[0016] The Taq DNA polymerase mutant provided by this invention exhibits higher qPCR efficiency compared to wild-type Taq DNA polymerase. In this invention, Taq DNA polymerase mutants were designed, characterized, and screened using probe-based qPCR, employing a rapid amplification time (1-second extension phase) cycling process to obtain the Taq DNA polymerase mutant V64S.

[0017] Compared to wild-type Taq DNA polymerase, the mutant provided in this application features rapid detection of amplification results, which significantly reduces the total time required for the qPCR process and improves the detection efficiency of qPCR or real-time qPCR. Therefore, the mutant provided in this application has significant economic advantages.

[0018] The Taq DNA polymerase mutant provided by this invention can be used for routine qPCR detection, including gene expression analysis and other DNA quantification detection. Attached Figure Description

[0019] Figure 1 This is an amplification signal graph for wild-type and mutant V64S. In the graph, the X-axis represents the cycle number, and the Y-axis represents the fluorescence signal (DR), indicating the fluorescence change during the amplification process. The dots represent the specific signal values ​​detected in each cycle. All detection threshold lines are fixed at 0.02. The qPCR program for all mutants was run repeatedly, as shown in the figure, where two different sets of dots and lines can be seen. Detailed Implementation

[0020] In this application, the words “about” and “approximately”, when used with numbers, usually refer to values ​​within the experimental error range (such as a mean within a 95% confidence interval) or variable values ​​within ±10% of the value, with the larger value as the boundary.

[0021] The term "labeled probe" refers to a labeled probe used in amplification reactions, including quantitative or qPCR analysis and endpoint analysis. These labeled probes can be used to monitor the amplification of target polynucleotides and are suitable for monitoring changes in the number of amplicones over time.

[0022] Oligonucleotide-labeled probes include, but are not limited to, 5'-exonuclease TaqMan probes (see U.S. Patent No. 5,538,848), various stem-loop molecular beacons (see U.S. Patent Nos. 6,103,476 and 5,925,517), stemless molecular beacons or linear beacons (WO 99 / 21881), PNA molecular beacons (e.g., U.S. Patent Nos. 6,355,421 and 6,593,091), linear PNA beacons, non-FRET-labeled probes (e.g., U.S. Patent No. 6,150,097), Sunrise / amplfluor-labeled probes (U.S. Patent No. 6,548,250), stem-loop and double scorpion-shaped labeled probes (U.S. Patent No. 6,589,743), convex-loop labeled probes (U.S. Patent No. 6,59091), and pseudo-knot labeled probes (U.S. Patent No. 1). Labeled probes include U.S. Patent No. 6,589,250; cyclic molecules (U.S. Patent No. 6,383,752); hairpin-labeled probes (U.S. Patent No. 6,596,490); peptide nucleic acid (PNA) luminescent labeled probes; self-assembled nanoparticle labeled probes; and ferrocene-modified labeled probes, such as U.S. Patent No. 6,485,901. Labeled probes can also include black hole quenchers (Biosearch), Iowa Black (IDT) quenchers, QSY quenchers (molecular labeled probes), and Dabsyl and Dabcel sulfonate / carboxylate quenchers (Epoch). Labeled probes can also consist of two probes, such as a fluorophore on one probe and a quencher on the other, where hybridization quenches the signal or alters the signal characteristics through changes in fluorescence. In addition to carboxyfluorescein, phosphoramide fluorescein, and CY 5 phosphoramide fluorescein (available from Amersham), labeled probes can also include sulfonated derivatives of fluorescent dyes with sulfonic acid groups.

[0023] In this application, "sample" means a biological sample from any source, including nucleic acids or DNA.

[0024] In this application, "real-time quantitative PCR", "real-time qPCR" and "quantitative PCR" (abbreviated as "qPCR") can be used interchangeably. They refer to PCR amplification methods that use labeled probes to simultaneously amplify, detect and quantify target polynucleotides. Furthermore, they may also include the methods exemplified in this application, such as TaqMan, SYBR Green and other methods in real-time quantitative PCR or semi-quantitative quantitative PCR systems.

[0025] In this application, "target" refers to a polynucleotide sequence that needs to be amplified, which can be a nucleic acid molecule or exist in a nucleic acid molecule or sample. The target polynucleotide can be obtained in any way, including RNA-based DNA or cDNA, and can be in methylated and / or unmethylated form.

[0026] In this application, "cyclic threshold" or "C" T "Cq" refers to the number of cycles required for the fluorescence signal to reach a set threshold, including real-time quantitative PCR of DNA achieved by plotting a logarithmic curve of fluorescence signal versus cycle period. The threshold is preferably set to 3-5 times the difference between the fluorescence signal and the background signal. The number of cycles in which fluorescence exceeds the threshold is called the threshold cycle (Ct) or quantitative cycle (Cq).

[0027] In this application, "threshold" refers to the threshold used to calculate the loop threshold (C). T The reported signal value.

[0028] In this application, "reporter signal" refers to a signal value related to the concentration of PCR products generated by a reporter gene (usually a dye or labeled probe) during data detection and analysis, including but not limited to cyclic reaction data. This data includes, but is not limited to, fluorescence signal data, optical signal data, magnetic signal data, and electronic signal data. The detection and analysis includes, but is not limited to, DNA quantification analysis via qPCR. The reporter signal can be generated by DNA binding to or intercalating into a dye (such as SYBR Green or evgreen). During PCR, the dye binds to double-stranded DNA, increasing the fluorescence quantum yield of the dye, thereby increasing the fluorescence intensity measured in each cycle. The signal intensity can be increased by adjusting the detection method, thereby improving the accuracy of target DNA quantification.

[0029] The Taq DNA polymerase mutant in this invention can improve qPCR efficiency, such as reducing the amplification time interval to 1 second. To improve the amplification efficiency of the target system, the Taq DNA polymerase mutant in this application can be used with primers and templates to screen for the optimal combination. In experiments, the DNA concentration can be serially diluted to construct a system compatible with C... T A standard curve of value changes is obtained, thereby determining the sample dilution based on the reported signal. The amplification factor is determined using the slope of a linear regression; for example, if a dilution of 1:2 results in a (CT) difference of 1, then the amplification factor is 100%.

[0030] The amplification efficiency of qPCR can also be determined by qPCR quantification, which does not require the plotting of a standard curve. For example, the MAK2 method (see Boggy G, Woolf PJ (2010); Ravasi T (ed.). "A Mechanistic Model of PCR for Accurate Quantification of Quantitative PCR Data" PLOS ONE 5(8): e12355) has been shown to have the same or better quantitative detection results as the standard curve method. These methods estimate sample concentration and amplification efficiency based on the principles of polymerase amplification.

[0031] The Taq DNA polymerase mutant of this invention can be used for real-time or qPCR detection, as well as for nucleic acid quantification, and can detect gene expression through relative or absolute quantification. Absolute quantification requires that the PCR amplification efficiency of the sample and the standard be the same, so that the accurate quantity of target DNA molecules can be determined by comparing with a standard curve. The Taq DNA polymerase mutant of this invention can provide a faster cycle time and the same or higher amplification efficiency, making it very suitable for absolute and relative quantification.

[0032] Qualitative PCR can also be used for nucleic acid detection of infectious diseases, cancer, and genetic abnormalities, thereby enabling rapid diagnosis. The characteristics of the Taq DNA polymerase mutant in qPCR detection described in this invention are helpful for the diagnosis of infectious diseases or emerging diseases (such as influenza and coronavirus).

[0033] The Taq DNA polymerase mutant in this invention can detect gene expression in real time or by qPCR, which is of great significance for food safety, food spoilage, fermentation, and microbial risk assessment and public health protection of water bodies (including drinking water and recreational water).

[0034] The Taq DNA polymerase mutant of this invention can perform real-time or qPCR detection of genes of different categories or functions, such as determining the number of microorganisms in environmentally relevant samples and / or identifying microorganisms of different families, genera, and species based on markers. It can also be used for the detection of functional markers (protein-coding genes) to show gene expression within a community, thereby revealing environmental information.

[0035] The Taq DNA polymerase mutant of this invention enables real-time or qPCR detection of agricultural pathogens, including bacteria that infect plants or seedlings. It works even when the detection system contains only small amounts of pathogens, such as *Phytophthora ramorum*, an oomycete that can kill oak trees and other species by mixing with host plant DNA.

[0036] The Taq DNA polymerase mutant of this invention can detect transgenic organisms based on the sensitivity and dynamic range of real-time or qPCR detection. This detection does not require amplification of the transgene; it only requires amplification of the promoter, terminator, or intermediate sequence of the vector with specific primer combinations. Since several copies of the transgene are typically inserted during the construction of transgenic plants, the Taq DNA polymerase mutant of this application can also be used for gene copy number detection.

[0037] qPCR using the Taq DNA polymerase mutant of this invention enables quantitative analysis and genotyping of viruses (using melting curves to characterize strains).

[0038] The degree of infection is closely related to the diagnosis of many diseases. In this invention, a Taq DNA polymerase mutant can be used to quantitatively analyze the copy number of a unit viral genome in patient tissues, thereby determining the degree of infection.

[0039] In this invention, SEQ ID NO.1 is the DNA sequence of wild-type Taq DNA polymerase with a C-terminal Histag tag. SEQ ID NO.2 is the amino acid sequence of wild-type Taq DNA polymerase with a C-terminal Histag tag.

[0040] Example

[0041] When performing gene expression analysis using the Taq DNA polymerase mutant of this invention, RNA is typically extracted from the sample and then reverse transcribed to obtain cDNA. The threshold of the reporter signal can be detected using any method in the prior art to determine the cDNA content of the sample. T This enables the quantitative detection of cDNA targets.

[0042] Obtaining mutants

[0043] Taq DNA polymerase mutants were obtained using reverse PCR mutagenesis. All Taq DNA polymerase mutants in this invention were expressed and purified in *E. coli* and verified by sequencing. To facilitate purification, a His tag was added to the C-terminus of all mutants and the wild-type.

[0044] qPCR probes

[0045] Acquisition of qPCR probes: qPCR was performed using the SARS-CoN gene 2019-nCoV_N2 published by the CDC 2019-nCoV Real-Time RT-PCR Diagnostic Group.

[0046] Forward primer: 2019-nCoV_N2 Forward Primer: TTACAAACATTGGCCGCAAA (SEQ ID NO: 3);

[0047] Reverse primer: 2019-nCoV_N2 Reverse Primer: GCGCGACATTCCGAAGAA (SEQ ID NO:4);

[0048] Probe: 2019-nCoV_N2 Probe: FAM-ACA ATT TGC CCC CAG CGC TTC AG-BHQ1 (SEQID NO: 5).

[0049] The initial target concentration was 10 Covid-19 N genes synthesized per reaction (Twist Bioscience, CA).

[0050] The reaction system consists of 20 µL of 4 µL 50 ng / µL Taq DNA polymerase, 1 µL 10 µM forward primer, 1 µL 10 µM reverse primer, 1 µL 5 µM tag probe, 1 µL 10 copies / µL Covid-19 N gene, 2 µL 10x buffer (20 mM Tris-HCl, 80 mM Tris-Acetate, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 3 mM Mg-Acetate, 0.1% Triton®-X-100, pH 8.8 @ 25 °C), with the remainder being water.

[0051] The Prime Pro 48 Real-time qPCR instrument (Cole-Parmer, UK) was used. The reaction program was: denaturation at 95°C for 30 seconds, followed by 40 cycles [annealing at 95°C for 4 seconds, extension at 60°C for 1 second], with fluorescence signals collected at 60°C.

[0052] The results are as follows Figure 1 As shown. The wild type showed no significant signal, while the mutant V64S produced a significant signal change. The nucleotide and amino acid sequences of the mutant V64S are described in the sequence listing (see sequence listing for details).

[0053] This application explains the technical solutions by referencing patents and literature. The embodiments given above are merely representative examples and do not limit the scope of protection of this application. Those skilled in the art can make changes to the experimental methods, embodiments, etc., based on their understanding of the technical solutions of this application, and these changes are included within the scope of protection of the claims of this application. It is obvious to those skilled in the art that substitutions or modifications can be made to the technical solutions of this invention without departing from the scope and spirit of this invention. For elements not explicitly stated as necessary conditions in this invention, this invention can be implemented without including these elements. In each embodiment, terms such as "comprising," "including," or "containing" are open-ended descriptions. The order of methods or processes in this invention can be adjusted and is not limited to the order of steps indicated in the specification or claims. In any case, the interpretation of this application should not be limited to the specific descriptions in the specification or embodiments of this application.

[0054] This invention provides a broad description of the technical solutions, including microorganisms belonging to the same subgenus or species. The terminology and expressions used in this invention are descriptive only and do not impose limitations. Any description with the same meaning as these terms or expressions is acceptable and falls within the scope of protection of this invention. Therefore, although this application has explicitly disclosed preferred embodiments or optional features, those skilled in the art can make modifications based on the concepts disclosed in this invention, and these modifications all fall within the scope of protection of the claims of this invention.

Claims

1. A Taq DNA polymerase mutant, characterized in that, The amino acid sequence of the Taq DNA polymerase mutant has a V64S mutation compared to the amino acid sequence of the wild-type Taq DNA polymerase; the amino acid sequence of the wild-type Taq DNA polymerase is shown in SEQ ID NO.2, and V64S indicates that the 64th amino acid in SEQ ID NO.2 has been mutated from V to S.

2. DNA encoding the Taq DNA polymerase mutant as described in claim 1.

3. The DNA of the Taq DNA polymerase mutant according to claim 2, characterized in that, The encoding nucleotide sequence of the wild-type Taq DNA polymerase is shown in SEQ ID NO.

1. The only difference between the nucleotide sequence of V64S and SEQ ID NO.1 is that the codon for the 64th amino acid is replaced by TCT instead of GTT.

4. A vector comprising the DNA sequence as described in claim 2.

5. A cell comprising the DNA sequence as described in claim 2.

6. The application of the Taq DNA polymerase mutant as described in claim 1 in nucleic acid amplification.

7. The application of the Taq DNA polymerase mutant as described in claim 1 in qPCR.

8. A qPCR detection kit, characterized in that, include: The target sequence primer, the target probe with inserted dye or label, and the Taq DNA polymerase mutant as described in claim 1.

9. A qPCR detection kit according to claim 8, characterized in that: The insertion dye is either SYBR Green or EvaGreen.

10. A qPCR detection method, characterized in that, The qPCR reaction system, with a total volume of 20 µL, contains 4 µL of 50 ng / µL Taq DNA polymerase mutant as described in claim 1, 1 µL of 10 µM forward primer, 1 µL of 10 µM reverse primer, 1 µL of 5 µM tag probe, 1 µL of template, 2 µL of 10× buffer, and the remainder is water; the reaction program is: denaturation at 95 °C for 30 seconds; annealing at 95 °C for 4 seconds, extension at 60 °C for 1 second, for 40 cycles; the buffer contains 20 mM Tris-HCl, 80 mM Tris-Acetate, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 3 mM Mg-Acetate, 0.1% Triton®-X-100, pH 8.8.

Citation Information

Patent Citations

  • Method for detecting nucleic acid amplification using self-quenching fluorescence probe

    US5538848A

  • Detectably labeled dual conformation oligonucleotide probes, assays and kits

    US5925517A

  • Detectably labeled, dual conformation oligonucleotide probes, assays and kits

    US6103476A

  • Nucleic acid detection probes having non-FRET fluorescence quenching and kits and assays including such probes

    US6150097A

  • Methods, kits and compositions pertaining to PNA molecular beacons

    US6355421B1