Hydantoin Compounds and Their Medical Uses
By designing a new type of heinaceous compound that has a strong agonistic effect on PPARα and PPARδ and has good pharmacokinetic properties, the problem of the poor effect of existing PPARα/δ dual agonists in anti-NASH is solved, and effective treatment of NASH, cholestasis and liver fibrosis is achieved.
Patent Information
- Application Number
- CN202211624621.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2022-01-20
- Filing Date
- 2022-12-16
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2042-12-16
AI Technical Summary
The existing PPARα/δ dual agonist GFT505 is poorly effective in clinical trials against non-alcoholic steatohepatitis (NASH), which may be related to its poor agonistic activity, poor metabolic stability and short half-life.
Design and synthesize a novel heinaceous compound that has a strong agonistic effect on PPARα and PPARδ and has good pharmacokinetic properties.
The heinaceous compound has significantly stronger agonistic activity against PPARα/δ than GFT505 and has excellent pharmacokinetic properties in vivo, showing effective resistance to NASH, cholestasis and liver fibrosis at low doses.
Smart Images

Figure CN115894379B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine, and particularly relates to a hydantoin compound having dual PPARα / δ agonist activity and its medical use as a PPARα / δ dual agonist. Background Art
[0002] Peroxisome proliferators-activated receptors (PPARs) are a family of nuclear receptors, including three subtypes, namely PPARα, PPARδ and PPARγ. Studies have shown that the activation of PPARs plays a positive role in the improvement of metabolic diseases, cardiovascular and cerebrovascular diseases, inflammatory diseases, autoimmune diseases, neurodegenerative diseases, organ regeneration, retinopathy or tumors (Mol.Cells., 2012, 33, 217; J.Biomed.Sci., 2017, 24, 5; J.Med.Chem., 2017, 55, 4027; Endocr.J., 2007, 54, 347). Developing and applying PPARs agonists is a potential therapeutic strategy for intervening in the above various diseases. However, PPARγ agonists have been shown to have risks of weight gain, edema, fractures and potential heart failure. Therefore, developing selective PPARα / δ dual agonists may provide a safe and effective new approach for the treatment of the above diseases.
[0003] Currently, the PPARα / δ dual agonist under clinical investigation is GFT505 (Elafibranor) developed by Genfit, France. GFT505 has been tested in several clinical trials for non-alcoholic fatty liver disease, cholestatic cholangitis and kidney diseases. Unfortunately, in the mid-term analysis of the phase III clinical trial for non-alcoholic steatohepatitis (NASH), the results showed it was basically ineffective (NCT02704403). Analyzing the reasons for its poor clinical trial efficacy may be related to the poor PPARα / δ agonist activity, poor metabolic stability and short half-life of GFT505.
[0004] In summary, there is an urgent clinical need to develop PPARα / δ dual agonists with high activity and excellent pharmacokinetic properties. Summary of the Invention
[0005] Objective of the Invention: To solve the problems existing in the existing PPARs agonists, the present invention provides a novel hydantoin compound. The hydantoin compound of the present invention has a strong agonistic effect on PPARα and PPARδ and a very weak agonistic activity on PPARγ, thus having good selectivity and good pharmacokinetic properties. Therefore, such compounds and their pharmaceutically acceptable salts, prodrugs, deuterated compounds or solvates can be used in the preparation of PPARα / δ dual agonists.
[0006] Another objective of the present invention is to provide the pharmaceutical use of the hydantoin compound as a PPARα / δ dual agonist. Such compounds and their pharmaceutically acceptable salts, prodrugs, deuterated compounds or solvates can be used in the preparation of drugs for preventing or treating diseases mediated by PPARα and / or PPARδ.
[0007] Technical Solution: To achieve the above objectives, the present invention provides a hydantoin compound represented by formula (I) or its pharmaceutically acceptable salt:
[0008]
[0009] A is selected from:
[0010] R 1 is selected from: H, a straight-chain or branched-chain alkyl having 1 to 6 carbons, a cycloalkyl having 3 to 6 carbons, (CH2) p OR 14 or (CH2) q NR 15 , where p is any integer from 2 to 6, q is any integer from 2 to 6, and R 14 and R 15 are each independently H, R 16 , C(O)R 17 , where R 16 and R 17 are each independently a straight-chain or branched-chain alkyl having 1 to 6 carbons or a cycloalkyl having 3 to 6 carbons;
[0011] R 2 and R 3 are each independently selected from: H or a straight-chain or branched-chain alkyl having 1 to 4 carbons, or R 2 and R 3 together with the carbon atom to which they are bonded form a 3- to 6-membered cycloalkyl ring;
[0012] R 4 、R 5 、R 6 and R 7 are each independently selected from: H, halogen, OR 18, a hydroxyl group, a straight-chain or branched alkyl group having 1 to 4 carbon atoms, a trifluoromethyl group, a methylthio group, a trifluoromethoxy group, a trifluoromethylthio group, a cycloalkyl group, a cycloalkenyl group, a heterocycloalkyl group, a heterocycloalkenyl group, an alkynyl group, a phenyl group, a substituted phenyl group, a heteroaryl group, a substituted heteroaryl group, a polycyclic aryl group or a substituted polycyclic aryl group, or, R 4 , R 5 , R 6 and R 7 wherein at least two substituents together with the atom to which they are attached can form a substituted or unsubstituted benzene ring, a substituted or unsubstituted heteroaromatic ring, a substituted or unsubstituted cycloalkane ring, a substituted or unsubstituted heterocycloalkane ring, or a substituted or unsubstituted heterocycloalkene ring;
[0013] R 18 is selected from: a straight-chain or branched alkyl group having 1 to 4 carbon atoms, a hydroxyalkyl group, an alkoxyalkyl group, an alkoxyalkoxyalkyl group, a cycloalkyl group having 3 to 6 carbon atoms or an alkynylalkoxyalkyl group;
[0014] X is selected from: CH2, O or S;
[0015] m is selected from: any integer from 0 to 4;
[0016] n is selected from: any integer from 0 to 2;
[0017] R 8 and R 9 are each independently selected from: H, deuterium, a straight-chain or branched alkyl group having 1 to 4 carbon atoms or a halogen, or, R 8 and R 9 together with the carbon atom to which they are bonded form a 3- to 6-membered cycloalkyl ring;
[0018] R 10 and R 11 are independently selected from: H, a hydroxyl group, a halogen, a cyano group, a straight-chain or branched alkyl group having 1 to 4 carbon atoms, a trifluoromethyl group, a methylthio group, a trifluoromethoxy group, a trifluoromethylthio group, an alkylsulfonyl group, an alkoxy group, a cycloalkyl group, a cycloalkenyl group, a heterocycloalkyl group, a heterocycloalkenyl group, an alkynyl group, a phenyl group, a substituted phenyl group, a phenoxy group, a substituted phenyloxy group, a heteroaryl group, a substituted heteroaryl group, a polycyclic aryl group or a substituted polycyclic aryl group, the substituted phenyl group, the substituted phenyloxy group, the substituted heteroaryl group or the substituted polycyclic aryl group may be independently substituted by 1 to 2 of the following substituents: a halogen, a hydroxyl group, a cyano group, a straight-chain or branched alkyl group having 1 to 4 carbon atoms, a trifluoromethyl group, a methylthio group, a trifluoromethoxy group, a trifluoromethylthio group or an alkylsulfonyl group, or, R 10 and R 11 together with the atom to which they are attached can form a substituted or unsubstituted benzene ring, a substituted or unsubstituted heteroaromatic ring, a substituted or unsubstituted cycloalkane ring, a substituted or unsubstituted heterocycloalkane ring or a substituted or unsubstituted heterocycloalkene ring;
[0019] R 12 and R 13 are each independently selected from: H, deuterium, a straight-chain or branched-chain alkyl group having 1 to 4 carbon atoms, or R 12 and R 13 together with the carbon atom to which they are attached form a 3- to 6-membered cycloalkyl ring.
[0020] Preferably, the hydantoin compound represented by the formula (I) or a pharmaceutically acceptable salt thereof:
[0021] A is selected from:
[0022] R 1 is selected from: H, a straight-chain or branched-chain alkyl group having 1 to 4 carbon atoms, acetylaminoethyl, or (CH2) p OR 14 , where p is any integer from 2 to 6, and the R 14 is selected from a straight-chain or branched-chain alkyl group having 1 to 4 carbon atoms;
[0023] R 2 and R 3 are each independently selected from: H or a straight-chain or branched-chain alkyl group having 1 to 4 carbon atoms, or R 2 and R 3 together with the carbon atom to which they are attached form a 3- to 6-membered cycloalkyl ring;
[0024] R 4 、R 5 、R 6 and R 7 are each independently selected from: H, halogen, trifluoromethyl, trifluoromethoxy, trifluoromethylthio, OR 18 , a straight-chain or branched-chain alkyl group having 1 to 4 carbon atoms;
[0025] R 18 is selected from: a straight-chain or branched-chain alkyl group having 1 to 4 carbon atoms;
[0026] X is selected from: CH2;
[0027] m is selected from: any integer from 0 to 2;
[0028] n is selected from: 0 or 1;
[0029] R 8 and R 9 are each independently selected from: H, deuterium, a straight-chain or branched-chain alkyl group having 1 to 4 carbon atoms, halogen, or R 8 and R 9 together with the carbon atom to which they are attached form a 3- to 6-membered cycloalkyl ring;
[0030] R 10 and R11 Independently selected from: H, halogen, cyano, a straight-chain or branched-chain alkyl group having 1 to 4 carbon atoms, trifluoromethyl, methylthio, trifluoromethoxy, trifluoromethylthio, methylsulfonyl, ethylsulfonyl, a straight-chain or branched-chain alkoxy group having 1 to 4 carbon atoms, a cycloalkyloxy group having 3 to 6 carbon atoms, a cycloalkyl group having 3 to 6 carbon atoms, phenyl, substituted phenyl, phenoxy, substituted phenyloxy, wherein the substituted phenyl or substituted phenyloxy may be independently substituted by 1 to 2 of the following substituents: halogen, cyano, a straight-chain or branched-chain alkyl group having 1 to 4 carbon atoms, trifluoromethyl, methylthio, trifluoromethoxy, trifluoromethylthio or methylsulfonyl;
[0031] R 12 and R 13 Each independently selected from: H, deuterium, a straight-chain or branched-chain alkyl group having 1 to 4 carbon atoms.
[0032] Furthermore, the hydantoin compounds further include their prodrugs, deuterated compounds or solvates.
[0033] In certain more preferred embodiments, the hydantoin compounds of the present invention or their pharmaceutically acceptable salts are any of the compounds shown in Table 1 below:
[0034] Table 1, Structures and Names of Compounds
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047] The hydantoin compounds or pharmaceutically acceptable salts, prodrugs, deuterated compounds or solvates thereof according to the present invention are potent dual PPARα / δ agonists, and thus can be used to prepare dual PPARα / δ agonists.
[0048] The hydantoin compounds or pharmaceutically acceptable salts, prodrugs, deuterated compounds or solvates thereof according to the present invention can be used to prepare drugs for preventing or treating diseases mediated by PPARα and / or PPARδ.
[0049] Specifically, the compounds of the present invention can be used to prepare drugs for preventing and treating the following diseases mediated by PPARα and / or PPARδ.
[0050] The compounds of the present invention can be used to prevent and treat metabolic diseases and cardiovascular and cerebrovascular diseases, including: insulin resistance, metabolic syndrome, type 1 or type 2 diabetes, hyperlipidemia, obesity, lipoma, painful lipomatosis, atherosclerosis, myocardial ischemia, myocardial infarction, arrhythmia, coronary heart disease, hypertension, heart failure, myocardial hypertrophy, myocarditis, diabetic complications (including diabetic cardiomyopathy, diabetic nephropathy, diabetic ulcers, retinopathy and neuropathy, etc.), non-alcoholic fatty liver, non-alcoholic steatohepatitis, alcoholic fatty liver, cirrhosis, hyperuricemia, gout, osteoporosis, polycystic ovary syndrome (PCOS), stroke or cerebral infarction, etc.
[0051] The compounds of the present invention can be used to prevent and treat inflammatory diseases, autoimmune diseases, organ fibrosis diseases, neurodegenerative diseases or secondary diseases caused by pathogen infections, including: primary biliary cholangitis (PBC), primary sclerosing cholangitis (PSC), liver fibrosis, idiopathic pulmonary fibrosis, cystic fibrosis lung disease, interstitial pneumonia, pulmonary tuberculosis, inflammatory bowel disease (such as Crohn's disease and ulcerative colitis), Behcet's disease, asthma, chronic obstructive pulmonary disease, chronic bronchitis, emphysema, bronchiolitis obliterans, allergic rhinitis, chronic rhinitis, sinusitis, systemic lupus erythematosus, rheumatoid arthritis, spondyloarthritis, osteoarthritis, synovitis, tendinitis, thromboangiitis obliterans, phlebitis, intermittent claudication, keloid, psoriasis, ichthyosis, bullous pemphigoid, dermatitis, contact dermatitis, pancreatitis, chronic nephritis, cystitis, meningitis, gastritis, sepsis, pyoderma gangrenosum, uveitis, Parkinson's disease, Alzheimer's disease, α-synucleinopathy, depression, multiple sclerosis, amyotrophic lateral sclerosis, fibromyalgia syndrome, neuralgia, Down syndrome, Hallervorden-Spatz disease, Huntington's chorea or Wilson's disease, etc.
[0052] The compounds of the present invention can be used for treating and regulating mitochondrial dysfunction and disorders, including: myasthenia, myoclonus, exercise intolerance, Kearns-Sayre syndrome, chronic fatigue syndrome, Leigh syndrome, mitochondrial myopathy-encephalopathy-lactic acidosis, stroke syndrome or stroke-like attack, Duchenne muscular dystrophy, Becker muscular dystrophy or Friedreich's ataxia, etc.
[0053] The compounds of the present invention can be used for treating tumors, including: bone cancer, acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, myeloproliferative diseases, multiple myeloma, myelodysplastic syndromes, Hodgkin's lymphoma, non-Hodgkin's lymphoma, hemangioma, granuloma, xanthoma, meningeal sarcoma, glioma, astrocytoma, medulloblastoma, ependymoma, germ cell tumor (pinealoma), glioblastoma multiforme, oligodendroglioma, schwannoma, retinoblastoma, neurofibroma, sarcoma, esophageal cancer, gastric cancer, pancreatic cancer, colorectal cancer, colon cancer, rectal cancer, kidney cancer, prostate cancer, lymphoma, testicular cancer, interstitial cell cancer, lung cancer, liver cancer, skin cancer, malignant melanoma or basal cell carcinoma, etc.
[0054] In certain embodiments, the hydantoin compounds of the present invention can be used as pharmaceutical salts. The salt can be a salt formed by the compound of the present invention with metal (including sodium, potassium, calcium, magnesium, etc.) ions or pharmaceutically acceptable amines (including ethylenediamine, ethanolamine, tromethamine, diisopropylamine, metformin or berberine, etc.) or ammonium ions.
[0055] The present invention also provides a pharmaceutical composition for preventing or treating PPARα and / or PPARδ-mediated diseases, which contains a therapeutically effective amount of the hydantoin compounds of formula (I) and shown in Table 1 or their pharmaceutically acceptable salts, prodrugs, deuterated compounds or solvates as active ingredients and a pharmaceutically acceptable carrier. The carriers that can be arbitrarily mixed can be changed according to the dosage form, administration form, etc. Examples of carriers include excipients, binders, disintegrants, lubricants, flavoring agents, fragrances, coloring agents and sweetening agents, etc. The pharmaceutical composition can be in conventional pharmaceutical dosage forms such as capsules, powders, tablets, granules, pills, injections, syrups, oral liquids, inhalants, ointments, suppositories or patches, etc.
[0056] Furthermore, the compounds of the present invention can be used in combination with one or more other types of drugs for preventing or treating PPARα and / or PPARδ-mediated diseases, including but not limited to the following combination drug use situations.
[0057] Other types of drugs that can be optionally used in combination with the compounds of the present invention can be one or more anti-diabetic drugs.
[0058] Other types of prophylactic or therapeutic drugs that can be optionally used in combination with the compounds of the present invention can be one or more weight loss drugs.
[0059] Other types of prophylactic or therapeutic drugs that can be optionally used in combination with the compounds of the present invention can be one or more anti-nonalcoholic fatty liver disease drugs.
[0060] Other types of prophylactic or therapeutic drugs that can be optionally used in combination with the compounds of the present invention can be one or more anti-PBC or PSC drugs.
[0061] Other types of prophylactic or therapeutic drugs that can be optionally used in combination with the compounds of the present invention can be one or more lipid-lowering drugs.
[0062] The dosage of the compound of formula (I) of the present invention or its pharmaceutically acceptable salt, prodrug, deuterated compound or solvate can be appropriately changed according to factors such as the age, weight, symptoms and administration route of the patient. For adults, in oral administration, the lower limit of the single dose is 0.01 mg (preferably 0.1 or 1 mg), and the upper limit is 1000 mg (preferably 500 mg); in intravenous administration, the lower limit of the single dose is 0.001 mg (preferably 0.01 or 0.1 mg), and the upper limit is 500 mg (preferably 250 mg). This dosage range can also be deviated from according to the different degrees of the disease and different dosage forms.
[0063] Considering that the "α,β-unsaturated ketone" structure in the GFT505 molecule may be the reason for its poor stability in liver microsomes, the inventors of the present invention replaced the "α,β-unsaturated ketone" fragment in the GFT505 molecular structure with a "hydantoin" structural fragment, and designed and synthesized the hydantoin compounds of the present invention. By testing the agonist activity of the hydantoin compounds on PPAR, it was surprisingly found that when the "hydantoin" fragment was used to replace the "α,β-unsaturated ketone" structure, a series of compounds with much stronger agonist activities of PPARα and PPARδ than GFT505 could be obtained. Particularly surprisingly, it was found that the preferred compounds of the present invention (such as compound 1) could reach the picomolar level in terms of the agonist activity on PPARα / δ. It is worth noting that compound 1 is the first PPARα / δ dual agonist whose agonist activities on both PPARα and PPARδ can reach the picomolar level. In addition, the compounds of the present invention have much better stability in human liver microsomes than GFT505 and have excellent in vivo pharmacokinetic properties.
[0064] Beneficial effects: Compared with the prior art, the present invention has the following advantages:
[0065] (1) The present invention provides a novel hydantoin compound, which has a potent agonistic effect on both PPARα and PPARδ. For example, the EC 50 values of compound 1 for PPARα and PPARδ both reach the picomolar level, and the agonistic activity is balanced. It is the most potent and balanced PPARα / δ dual agonist to date. Under the same test system, its activity is extremely significantly superior to the PPARα / δ dual agonists reported in the literature, such as the phase III clinical trial drug GFT505 and the compound H11 with the optimal activity reported in the current literature (Journal of Medicinal Chemistry 2022, 65, 2571-2592).
[0066] (2) By analyzing the co-crystal structure of PPARδ and compound 1, it is found that in addition to the formation of key hydrogen bond interactions between the carboxylic acid group of compound 1 and three key amino acid residues His323, His449, and Tyr473 of PPARδ, there are also multiple special "water bridge" hydrogen bond interactions between the hydantoin ring structure in this compound and the amino acids Thr289, Thr292, and Cys285 of PPARδ. This brand-new binding mode may be the reason why the hydantoin derivative PPARα / δ dual agonist of the present invention has potent agonistic activity and high selectivity.
[0067] (3) Compared with the phase III clinical trial drug GFT505, the compounds of the present invention have better in vitro and in vivo pharmacokinetic properties. Therefore, the compounds of the present invention or their pharmaceutically acceptable salts can be used to prepare PPARα / δ dual agonists, and further can be used to prepare drugs for preventing or treating diseases mediated by PPARα and / or PPARδ.
[0068] (4) Compared with activating PPARγ, the compounds of the present invention show very high selectivity for activating PPARα / PPARδ, and the selectivity is significantly superior to GFT505. Among them, the selectivity of compound 1 for PPARγ is as high as 2000 times. As is well known, activating PPARγ will lead to risks such as weight gain, edema, fracture, and heart failure (Toxicol. sci., 2006, 90, 269). Therefore, the compounds of the present invention have potential advantages in terms of safety. In addition, the compounds of the present invention do not have a significant agonistic effect on other nuclear receptors, indicating their high selectivity for PPARα / δ.
[0069] (5) In NASH mouse models, cholestasis mouse models, and liver fibrosis mouse models, the compounds of the present invention (such as compound 1) exhibit superior anti-NASH, anti-cholestasis, and anti-fibrosis effects at very low doses compared to the PPARα / δ dual agonist GFT505 under clinical investigation, and have very good safety. This indicates that the compounds of the present invention have very good clinical application prospects.
[0070] (6) The hydantoin compounds of the present invention are ingeniously designed, have simple structures, use inexpensive and readily available raw materials, and have safe, environmentally friendly synthesis processes that are easy to scale up production. BRIEF DESCRIPTION OF THE DRAWINGS
[0071] Figure 1 Effect of compound 1 on serum triglycerides in mice (n = 6, compared with the control group, t-test, *p < 0.05, ***p < 0.001, compared with the compound 1 1mpk group, t-test, # p < 0.05, ## p < 0.01, ### p < 0.001);
[0072] Figure 2 Effect of compound 1 on liver morphology and serum color in ANIT-induced cholestasis in mice;
[0073] Figure 3 Effect of compound 1 on aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, total bilirubin, and total bile acid in the serum of cholestasis mice (n = 5, compared with the control group, t-test, # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the model group, one-way ANOVA, * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the model group, t-test, $ p < 0.05, $$ p < 0.01, $$$ p < 0.001);
[0074] Figure 4 Effect of compound 1 on alkaline phosphatase in the liver of cholestasis mice (n = 5, compared with the control group, t-test, ### p < 0.001, compared with the model group, one-way ANOVA, * p < 0.05);
[0075] Figure 5 HE staining diagram of liver sections of cholestasis mice treated with compound 1;
[0076] Figure 6 Effect of Compound 1 on aspartate aminotransferase and alanine aminotransferase in the serum of NASH model mice (n = 6, compared with the control group, t-test, ### p < 0.001, compared with the model group, t-test, *** p < 0.001);
[0077] Figure 7 HE staining image of liver sections of NASH model mice treated with Compound 1;
[0078] Figure 8 Sirius red staining image of liver sections of NASH model mice treated with Compound 1;
[0079] Figure 9 Oil red staining image of liver sections of NASH model mice treated with Compound 1;
[0080] Figure 10 Effect of Compound 1 on the content of intrahepatic triglyceride in NASH model mice (n = 6, compared with the control group, t-test, ### p < 0.001, compared with the model group, t-test, * p < 0.05);
[0081] Figure 11 Effect of Compound 1 on liver inflammation-related genes in NASH model mice (n = 6, compared with the control group, t-test, ### p < 0.001, compared with the model group, t-test, * p < 0.05, ** p < 0.01, *** p < 0.001);
[0082] Figure 12 Effect of Compound 1 on liver fibrosis-related genes in NASH model mice (n = 6, compared with the control group, t-test, # p < 0.05, ## p < 0.01, ### p < 0.001, compared with the model group, t-test, * p < 0.05, ** p < 0.01, *** p < 0.001);
[0083] Figure 13 Effect of Compound 1 on the content of hydroxyproline in the liver of liver fibrosis model mice (n = 6, compared with the control group, t-test, ### p < 0.001, compared with the model group, one-way ANOVA, ***p < 0.001, compared with the model group, t-test, $$ p < 0.01);
[0084] Figure 14 It is the HE staining map of the liver sections of mice with liver fibrosis model treated with Compound 1;
[0085] Figure 15 It is the Sirius red staining map of the liver sections of mice with liver fibrosis model treated with Compound 1;
[0086] Figure 16 It is the co-crystal structure diagram of Compound 1 and PPARδ protein. Detailed implementation manners
[0087] The content of the present invention will be specifically described below through examples. In the present invention, the following described examples are for better explaining the present invention and are not used to limit the scope of the present invention. Various changes and modifications can be made to the present invention without departing from the spirit and scope of the present invention.
[0088] Example 1
[0089] 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 1)
[0090] Method (1)
[0091]
[0092] Synthesis of Intermediate K-1
[0093] Dissolve 4-hydroxy-3,5-dimethylbenzaldehyde (21 g, 140 mmol) in acetonitrile (200 mL), add ethyl 2-bromoisobutyrate (100.5 g, 520 mmol), cesium carbonate (45.6 g, 140 mmol), potassium carbonate (38.6 g, 280 mmol) and potassium iodide (2.3 g, 14 mmol). Heat the reaction system to 80 °C and react for 36 hours. After the reaction is completed, filter by suction. Evaporate the solvent under reduced pressure, dilute with water (200 mL), extract with ethyl acetate (EA) (200 mL x 3). Wash the organic phase with 1N sodium hydroxide solution (200 mL x 3) and saturated brine (200 mL x 1), and dry over anhydrous sodium sulfate. Evaporate the solvent under reduced pressure, and purify the residue by silica gel column chromatography (petroleum ether / ethyl acetate = 200:1) to obtain Intermediate K-1 (yellow liquid, 16.3 g, yield 44.1%).
[0094] Synthesis of Intermediate K-2
[0095] Dissolve intermediate K-1 (3.66 g, 13.85 mmol) in ethanol (20 mL), slowly add sodium borohydride (280 mg, 7.5 mmol) under ice bath conditions, and stir at room temperature for 4 hours. After the reaction is completed, quench with water (20 mL). Evaporate the solvent under reduced pressure, dilute with water (30 mL), extract with EA (20 mL x 3), wash the organic phase with saturated sodium chloride solution (30 mL x 1), and dry over anhydrous sodium sulfate. Evaporate the solvent under reduced pressure to obtain the crude product of intermediate K-2, which is directly used in the next step without further purification.
[0096] Synthesis of intermediate M-1
[0097] Dissolve all the crude product of intermediate K-2 obtained from the previous step in dichloromethane (DCM) (20 mL), add carbon tetrabromide (13.6 g, 41 mmol), and slowly add triphenylphosphine (9.9 g, 37.8 mmol) under ice bath conditions, and stir at room temperature for 8 hours. Evaporate the solvent under reduced pressure, and purify the residue by silica gel column chromatography (petroleum ether / ethyl acetate = 20:1) to obtain intermediate M-1 (yellow liquid, 3.54 g, yield 78.0%).
[0098] Synthesis of intermediate A-2
[0099] Dissolve p-trifluoromethylaniline A-1 (1.6 g, 10 mmol) in acetonitrile (10 mL), add ethyl 2-bromoacetate (1.2 mL, 11 mmol) and cesium carbonate (3.3 g, 10 mmol), heat the reaction system to 80 °C, and react for 12 hours. After the reaction is completed, evaporate the solvent under reduced pressure, add water (50 mL), extract with EA (50 mL x 3), wash the organic phase with saturated sodium chloride solution (50 mL x 1). Evaporate the solvent under reduced pressure, and purify the residue by silica gel column chromatography (petroleum ether / ethyl acetate = 40:1) to obtain intermediate A-2 (yellow solid, 1.24 g, yield 50.2%).
[0100] Synthesis of intermediate A-3
[0101] Under argon protection, dissolve intermediate A-2 (2.4 g, 10 mmol) in acetic acid (10 mL), add a suspension of sodium cyanate (3.9 g, 60 mmol) in acetic acid (20 mL), and stir at room temperature for 12 hours. Heat the reaction system to 100 °C and stir for 12 hours. After the reaction is completed, evaporate the solvent under reduced pressure, add water (50 mL), extract with EA (50 mL x 3), wash the organic phase with saturated sodium chloride solution (50 mL x 1). Evaporate the solvent under reduced pressure, and purify the residue by silica gel column chromatography (petroleum ether / ethyl acetate = 2:1) to obtain compound A-3 (white solid, 1.1 g, yield 45.1%).
[0102] Synthesis of Compound 2
[0103] Intermediate A-3 (244 mg, 1 mmol) was dissolved in acetonitrile (3 mL), and M-1 (492 mg, 1.5 mmol) and cesium carbonate (815 mg, 2.5 mmol) were added. The mixture was stirred at room temperature for 12 h. After completion of the reaction, the solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 5:1) to obtain Compound 2 (colorless liquid, 469.8 mg, yield 95.4%).
[0104] Synthesis of Compound 1
[0105] Compound 2 (441 mg, 0.89 mmol) was dissolved in acetonitrile (3 mL), and a mixed solution of concentrated hydrochloric acid (concentration 12 M) and acetic acid (10 mL, 1:1) was added. The reaction system was heated to 100 °C and stirred for 4 h. After completion of the reaction, the solvent was removed under reduced pressure, water (20 mL) was added, and the mixture was extracted with EA (25 mL × 3). The organic phase was washed with saturated sodium chloride solution (20 mL × 1). The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (dichloromethane / methanol = 100:1) to obtain Compound 1 (white solid, 98.7 mg, yield 23.9%): 1 H NMR (300 MHz, DMSO-d6) δ 12.80 (s, 1H), 7.87 (d, J = 8.8 Hz, 2H), 7.77 (d, J = 8.8 Hz, 2H), 6.98 (s, 2H), 4.63 (s, 2H), 4.54 (s, 2H), 2.15 (s, 6H), 1.34 (s, 6H). HRMS (ESI) calcd. for C 23 H 23 F3N2O5[M+NH4] + : 482.1903, found: 482.1898。
[0106] Method (2)
[0107] Intermediate A-3 can also be synthesized according to the following route:
[0108]
[0109] p-Iodotrifluoromethylbenzene (2.7 g, 10 mmol), cuprous oxide (1.4 g, 10 mmol) and hydantoin (1.5 g, 15 mmol) were added to a three-necked flask. After gas exchange, the reaction system was protected by argon. Subsequently, anhydrous DMF (10 mL) was added, and the reaction system was heated to 150 °C and reacted for 12 hours. After the reaction was completed, the reaction solution was filtered through diatomaceous earth, water (50 mL) was added, and the mixture was extracted with EA (50 mL x 3) and washed with saturated sodium chloride (50 mL x 1). The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 4:1) to obtain compound A-3 (white solid, 949 mg, yield: 38.9%).
[0110] Method (3)
[0111] Compound 2 can also be synthesized according to the following route:
[0112]
[0113] Intermediate M-1 (3.28 g, 10 mmol) was dissolved in acetonitrile (10 mL), and hydantoin (1.5 g, 15 mmol) and cesium carbonate (4.89 g, 15 mmol) were added. The reaction was stirred at room temperature for 12 hours. After the reaction was completed, the solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 5:1) to obtain intermediate E-1 (white solid, 1.8 g, yield: 51.7%). Intermediate E-1 (1.17 g, 5 mmol), cuprous iodide (189 mg, 1 mmol), potassium carbonate (1.37 g, 10 mmol) and (1R,2R)-(-)-N,N'-dimethyl-1,2-cyclohexanediamine (284 mg, 2 mmol) were added to a three-necked flask. After gas exchange, the reaction system was protected by argon, and a toluene (15 mL) solution of p-iodotrifluoromethylbenzene (1.6 g, 6 mmol) was added. The reaction system was heated to 110 °C. After the reaction was completed, the solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 10:1) to obtain compound 2 (colorless liquid, 1.23 g, yield: 41.7%).
[0114] Example 2
[0115] Ethyl 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionate (Compound 2)
[0116]
[0117] Referring to the method of Example 1, compound 2 (colorless liquid, 469.8 mg, yield 95.4%) was prepared without hydrolysis: 1HNMR(300MHz,CDCl3)δ7.73(d,J=8.8Hz,2H),7.65(d,J=8.9Hz,2H),7.07(s,2H),4.65(s,2H),4.36(s,2H),4.29(q,J=7.1Hz,2H),2.20(s,6H),1.46(s,6H),1.36(t,J=7.1Hz,3H).MS(ESI):m / z 515.2[M+Na] + 。
[0118] Example 3
[0119] 2-(4-((2,5-dioxo-3-(4-(trifluoromethoxy)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 3)
[0120]
[0121] According to the method of Reference Example 1, p-trifluoromethylaniline was replaced with p-trifluoromethoxyaniline to obtain Compound 3 (white solid, 62.0 mg, yield 66.9%): 1 H NMR(300MHz,DMSO-d6)δ12.79(s,1H),7.76(d,J=9.1Hz,2H),7.43(d,J=8.6Hz,2H),6.97(s,2H),4.60(s,2H),4.53(s,2H),2.15(s,6H),1.35(s,6H).HRMS(ESI)calcd.for C 23 H 23 F3N2O6[M+NH4] + :498.1852,found:498.1847。
[0122] Example 4
[0123] Ethyl 2-(4-((2,5-dioxo-3-(4-(trifluoromethoxy)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 4)
[0124]
[0125] According to the method of Reference Example 1, p-trifluoromethylaniline was replaced with p-trifluoromethoxyaniline, and Compound 4 was obtained without hydrolysis (colorless liquid, 98 mg, yield 44.4%): 11H NMR (300 MHz, CDCl3) δ 7.73 (d, J = 8.8 Hz, 2H), 7.65 (d, J = 8.9 Hz, 2H), 7.07 (s, 2H), 4.65 (s, 2H), 4.36 (s, 2H), 4.29 (q, J = 7.1 Hz, 2H), 2.20 (s, 6H), 1.46 (s, 6H), 1.36 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 531.2 [M+Na] + 。
[0126] Example 5
[0127] 2-(4-((4,4-Dimethyl-2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 5)
[0128]
[0129] Referring to the method of Example 1, replace the hydantoin in the synthetic route of method (3) with 5,5-dimethylhydantoin to obtain Compound 5 (white solid, 21 mg, yield 55.5%): 1 1H NMR (300 MHz, DMSO-d6) δ 12.79 (s, 1H), 7.86 (d, J = 8.4 Hz, 2H), 7.68 (d, J = 8.3 Hz, 2H), 6.92 (s, 2H), 4.57 (s, 2H), 2.17 (s, 6H), 1.44 (s, 6H), 1.35 (s, 6H). HRMS (ESI) calcd. for C 25 H 27 F3N2O5 [M+NH4] + : 510.2216, found: 510.2211。
[0130] Example 6
[0131] Ethyl 2-(4-((4,4-dimethyl-2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 6)
[0132]
[0133] Referring to the method of Example 1, replace the hydantoin in the synthetic route of method (3) with 5,5-dimethylhydantoin and obtain Compound 6 (yellow liquid, 40 mg, yield 19.1%) without hydrolysis: 11H NMR (300 MHz, CDCl3) δ 7.71 (d, J = 8.4 Hz, 2H), 7.46 (d, J = 8.4 Hz, 2H), 7.04 (s, 2H), 4.65 (s, 2H), 4.30 (q, J = 7.1 Hz, 2H), 2.20 (s, 6H), 1.50 (s, 6H), 1.48 (s, 6H), 1.36 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 543.2 [M+Na] + 。
[0134] Example 7
[0135] 2-(4-((4,4-Dimethyl-2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 7)
[0136]
[0137] Referring to the method of Example 1, replace 4-iodotrifluoromethylbenzene in the synthetic route of method (3) with 4-(trifluoromethoxy)iodobenzene and hydantoin with 5,5-dimethylhydantoin to obtain Compound 7 (white solid, 40 mg, yield 54.5%): 1 1H NMR (300 MHz, DMSO-d6) δ 12.61 (s, 1H), 7.55 (d, J = 9.0 Hz, 2H), 7.49 (d, J = 8.9 Hz, 2H), 6.91 (s, 2H), 4.55 (s, 2H), 2.16 (s, 6H), 1.39 (s, 6H), 1.35 (s, 6H). HRMS (ESI) calcd. for C 25 H 27 F3N2O6 [M+NH4] + : 526.2165, found: 526.2159。
[0138] Example 8
[0139] Ethyl 2-(4-((4,4-dimethyl-2,5-dioxo-3-(4-(trifluoromethoxy)phenyl)imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 8)
[0140]
[0141] Referring to the method of Example 1, replace 4-iodotrifluoromethylbenzene in the synthetic route of method (3) with 4-(trifluoromethoxy)iodobenzene and hydantoin with 5,5-dimethylhydantoin, and obtain Compound 8 (colorless liquid, 80 mg, yield 29.7%) without hydrolysis: 11H NMR (300 MHz, CDCl3) δ 7.31 (s, 4H), 7.04 (s, 2H), 4.63 (s, 2H), 4.30 (q, J = 7.1 Hz, 2H), 2.20 (s, 6H), 1.48 (s, 6H), 1.46 (s, 6H), 1.36 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 559.2 [M+Na] + 。
[0142] Example 9
[0143] 2-(4-((2,5-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2-methylphenoxy)acetic acid (Compound 9)
[0144]
[0145] According to the method of Reference Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with 4-hydroxy-3-methylbenzaldehyde, and ethyl 2-bromo-2-methylpropionate was replaced with ethyl 2-bromoacetate to obtain Compound 9 (white solid, 85.2 mg, yield 66.0%): 1 1HNMR (300 MHz, DMSO-d6) δ 12.96 (s, 1H), 7.85 (d, J = 8.7 Hz, 2H), 7.76 (d, J = 8.7 Hz, 2H), 7.12 (d, J = 11.3 Hz, 2H), 6.78 (d, J = 8.3 Hz, 1H), 4.67 (s, 2H), 4.60 (s, 2H), 4.55 (s, 2H), 2.17 (s, 3H). HRMS (ESI) calcd. for C 20 H 17 F3N2O5 [M+Na] + : 445.0987, found: 445.0992。
[0146] Example 10
[0147] Ethyl 2-(4–(2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2-methylphenoxy)acetate (Compound 10)
[0148]
[0149] According to the method of Reference Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with 4-hydroxy-3-methylbenzaldehyde, and ethyl 2-bromo-2-methylpropionate was replaced with ethyl 2-bromoacetate, and Compound 10 was obtained without hydrolysis (white solid, 137.7 mg, yield 57.0%): 11H NMR (300 MHz, CDCl3) δ 7.71 (d, J = 8.8 Hz, 2H), 7.65 (d, J = 8.9 Hz, 2H), 7.27 (d, J = 6.9 Hz, 2H), 6.66 (d, J = 8.1 Hz, 1H), 4.69 (s, 2H), 4.63 (s, 2H), 4.33 (s, 2H), 4.27 (q, J = 7.1 Hz, 2H), 2.29 (s, 3H), 1.31 (t, J = 7.2 Hz, 3H). MS (ESI): m / z 573.2 [M+Na] + 。
[0150] Example 11
[0151] 2-(4–((2,5-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2-(trifluoromethyl)phenoxy)-2-methylpropanoic acid (Compound 11)
[0152]
[0153] According to the method of Reference Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with 4-hydroxy-3-trifluoromethylbenzaldehyde to obtain Compound 11 (white solid, 89 mg, yield 55.6%): 1 1H NMR (300 MHz, DMSO-d6) δ 13.37 (s, 1H), 7.85 (d, J = 8.7 Hz, 2H), 7.76 (d, J = 8.7 Hz, 2H), 7.63 (s, 1H), 7.55 (d, J = 9.2 Hz, 1H), 6.89 (d, J = 8.6 Hz, 1H), 4.65 (s, 2H), 4.59 (s, 2H), 1.53 (s, 6H). HRMS (ESI) calcd. for C 22 H 18 F6N2O5 [M+Na] + : 527.1018, found: 527.1012。
[0154] Example 12
[0155] Ethyl 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2-(trifluoromethyl)phenoxy)-2-methylpropanoate (Compound 12)
[0156]
[0157] Referring to the method of Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with 4-hydroxy-3-trifluoromethylbenzaldehyde, and compound 12 (yellow liquid, 169 mg, yield 63.4%) was obtained without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.77–7.62(m,5H),7.53(d,J=8.3Hz,1H),6.78(d,J=8.9Hz,1H),4.73(s,2H),4.36(s,2H),4.26(q,J=6.3Hz,2H),1.63(s,6H),1.28(t,J=6.3,3H).MS(ESI):m / z 555.1[M+Na] + 。
[0158] Example 13
[0159] 2-(2-Chloro-4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-6-methylphenoxy)-2-methylpropanoic acid (Compound 13)
[0160]
[0161] Referring to the method of Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with 4-hydroxy-3-methyl-5-chlorobenzaldehyde, and compound 13 (white solid, 50 mg, yield 30.7%) was obtained: 1 H NMR(300MHz,DMSO-d6)δ12.84(s,1H),7.86(d,J=8.7Hz,2H),7.77(d,J=8.8Hz,2H),7.27(s,1H),7.15(s,1H),4.62(s,2H),4.59(s,2H),2.20(s,3H),1.41(s,6H).HRMS(ESI)calcd.for C 22 H 20 ClF3N2O5[M+Na] + :507.0911,found:507.0905。
[0162] Example 14
[0163] Ethyl 2-(2-chloro-4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-6-methylphenoxy)-2-methylpropanoate (Compound 14)
[0164]
[0165] According to the method of Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with 4-hydroxy-3-methyl-5-chlorobenzaldehyde, and compound 14 (yellow liquid, 174 mg, yield 67.8%) was obtained without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.73(d,J=8.9Hz,2H),7.66(d,J=8.8Hz,2H),7.31(s,1H),7.16(s,1H),4.66(s,2H),4.38(s,2H),4.29(q,J=7.1Hz,2H),2.24(s,3H),1.53(s,6H),1.36(t,J=7.1Hz,3H).MS(ESI):m / z535.1[M+Na] + 。
[0166] Example 15
[0167] 2-(4-((2,5-Dioxo-3-(2-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 15)
[0168]
[0169] According to the method of Example 1, 4-iodobenzotrifluoride in the synthesis route of method (2) was replaced with 2-iodobenzotrifluoride to obtain compound 15 (white solid, 37.2 mg, yield 80.1%): 1 H NMR(300MHz,DMSO-d6)δ12.79(s,1H),7.90–7.76(m,3H),7.71–7.64(m,1H),6.92(s,2H),4.54(s,2H),4.42(s,2H),2.16(s,6H),1.35(s,6H).HRMS(ESI)calcd.for C 23 H 23 F3N2O5[M+Na] + :487.1457,found:487.1453。
[0170] Example 16
[0171] Ethyl 2-(4-((2,5-dioxo-3-(2-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 16)
[0172]
[0173] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (2) with 2-iodobenzotrifluoride, and compound 16 (colorless liquid, 78.7 mg, yield 39.6%) is obtained without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.79(d,J=7.5Hz,1H),7.68(t,J=7.2Hz,1H),7.56(t,J=7.7Hz,1H),7.42(d,J=7.7Hz,1H),7.05(s,2H),4.65(s,2H),4.30(q,J=7.1Hz,2H),4.26(s,2H),2.20(s,6H),1.48(s,6H),1.36(t,J=7.1Hz,3H).MS(ESI):m / z 515.2[M+Na] + 。
[0174] Example 17
[0175] 2-(2,6-Dichloro-4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)phenoxy)-2-methylpropanoic acid (Compound 17)
[0176]
[0177] Referring to the method of Example 1, replace 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3,5-dichlorobenzaldehyde to obtain compound 17 (white solid, 100.1 mg, yield 62.2%): 1 H NMR(300MHz,DMSO-d6)δ12.85(s,1H),7.87(d,J=8.7Hz,2H),7.78(d,J=8.8Hz,2H),7.48(s,2H),4.65(s,2H),4.61(s,2H),1.46(s,6H).HRMS(ESI)calcd.for C 21 H 17 Cl2F3N2O5[M+Na] + :527.0364,found:527.0358。
[0178] Example 18
[0179] Ethyl 2-(2,6-dichloro-4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)phenoxy)-2-methylpropanoate (Compound 18)
[0180]
[0181] Referring to the method of Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with 4-hydroxy-3,5-dichlorobenzaldehyde, and Compound 18 (yellow liquid, 171 mg, yield 64.0%) was obtained without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.73(d,J=9.0Hz,2H),7.67(d,J=9.0Hz,2H),7.41(s,2H),4.67(s,2H),4.40(s,2H),4.21–4.07(m,2H),1.58(s,6H),1.28(t,J=7.2Hz,3H).MS(ESI):m / z 555.1[M+Na] + 。
[0182] Example 19
[0183] 2-(2,6-Dibromo-4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)phenoxy)-2-methylpropanoic acid (Compound 19)
[0184]
[0185] Referring to the method of Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with 4-hydroxy-3,5-dibromobenzaldehyde, and Compound 19 (white solid, 120.2 mg, yield 70.3%) was obtained: 1 H NMR(300MHz,DMSO-d6)δ12.86(s,1H),7.87(d,J=8.7Hz,2H),7.78(d,J=8.8Hz,2H),7.66(s,2H),4.65(s,2H),4.61(s,2H),1.50(s,6H).HRMS(ESI)calcd.for C 21 H 17 Br2F3N2O5[M+Na] + :614.9354,found:614.9348。
[0186] Example 20
[0187] Ethyl 2-(2,6-dibromo-4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)phenoxy)-2-methylpropanoate (Compound 20)
[0188]
[0189] Referring to the method of Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with 4-hydroxy-3,5-dibromobenzaldehyde, and compound 20 (colorless liquid, 180 mg, yield 57.9%) was obtained without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.73(d,J=8.9Hz,2H),7.67(d,J=8.9Hz,2H),7.62(s,2H),4.67(s,2H),4.40(s,2H),4.30(q,J=7.1Hz,2H),1.59(s,6H),1.37(t,J=7.1Hz,3H).MS(ESI):m / z 642.2[M+Na] + 。
[0190] Example 21
[0191] 2-(4-((2,5-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2,6-difluorophenoxy)-2-methylpropanoic acid (Compound 21)
[0192]
[0193] Referring to the method of Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with 4-hydroxy-3,5-difluorobenzaldehyde, and compound 21 (white solid, 22.4 mg, yield 56.7%) was obtained: 1 H NMR(300MHz,DMSO-d6)δ12.94(s,1H),7.87(d,J=8.7Hz,2H),7.77(d,J=8.8Hz,2H),7.15(d,J=8.9Hz,2H),4.65(s,2H),4.62(s,2H),1.44(s,6H).HRMS(ESI)calcd.for C 21 H 17 F5N2O5[M+Na] + :495.0955,found:495.0946。
[0194] Example 22
[0195] Ethyl 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2,6-difluorophenoxy)-2-methylpropanoate (Compound 22)
[0196]
[0197] Referring to the method of Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with 4-hydroxy-3,5-difluorobenzaldehyde, and Compound 22 (colorless liquid, 41.9 mg, yield 16.7%) was obtained without hydrolysis: 1 H NMR (300 MHz, CDCl3) δ 7.73 (d, J = 8.6 Hz, 2H), 7.67 (d, J = 8.7 Hz, 2H), 7.03 (d, J = 8.0 Hz, 2H), 4.69 (s, 2H), 4.39 (s, 2H), 4.26 (q, J = 7.1 Hz, 2H), 1.56 (s, 6H), 1.30 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 523.1 [M+Na] + 。
[0198] Example 23
[0199] 2-(4-((2,5-Dioxo-3-(4-methylphenyl)imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 23)
[0200]
[0201] Referring to the method of Example 1, 4-iodobenzotrifluoride in the synthesis route of method (2) was replaced with 4-iodotoluene, and Compound 23 (white solid, 61.7 mg, yield 83.7%) was obtained: 1 H NMR (300 MHz, DMSO-d6) δ 12.82 (s, 1H), 7.52 (d, J = 8.5 Hz, 2H), 7.20 (d, J = 8.4 Hz, 2H), 6.97 (s, 2H), 4.55 (s, 2H), 4.52 (s, 2H), 2.28 (s, 3H), 2.15 (s, 6H), 1.35 (s, 6H). HRMS (ESI) calcd. for C 23 H 26 N2O5 [M+Na] + : 433.1739, found: 433.1727.
[0202] Example 24
[0203] Ethyl 2-(4-((2,5-dioxo-3-(4-methyltolyl)imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 24)
[0204]
[0205] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (2) with 4-iodotoluene, and obtain compound 24 (colorless liquid, 78.7 mg, yield 71.9%) without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.45(d,J=8.5Hz,2H),7.19(d,J=8.3Hz,2H),7.07(s,2H),4.63(s,2H),4.30(s,2H),4.29(q,J=7.1Hz,2H),2.34(s,3H),2.19(s,6H),1.46(s,6H),1.36(t,J=7.1Hz,3H).MS(ESI):m / z461.2[M+Na] + 。
[0206] Example 25
[0207] 2-(4-((3-(4-Fluorophenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 25)
[0208]
[0209] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (2) with p-fluoroiodobenzene, and obtain compound 25 (white solid, 87.2 mg, yield 90.6%): 1 H NMR(300MHz,DMSO-d6)δ12.81(s,1H),7.66(dd,J=8.9,4.7Hz,2H),7.38–7.17(m,2H),6.96(s,2H),4.57(s,2H),4.52(s,2H),2.15(s,6H),1.34(s,6H).HRMS(ESI)calcd.for C 22 H 23 FN2O5[M+Na] + :437.1489,found:437.1482。
[0210] Example 26
[0211] Ethyl 2-(4-((3-(4-fluorophenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 26)
[0212]
[0213] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (2) with p-iodofluorobenzene, and compound 26 (colorless liquid, 102.8 mg, yield 77.4%) was obtained without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.59–7.50(m,2H),7.11(d,J=8.2Hz,2H),7.07(s,2H),4.63(s,2H),4.31(s,2H),4.30(q,J=7.1Hz,2H),2.19(s,6H),1.47(s,6H),1.36(t,J=7.1Hz,3H).MS(ESI):m / z465.2[M+Na] + 。
[0214] Example 27
[0215] 2-(4-((3-(4-chlorophenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 27)
[0216]
[0217] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (2) with p-chloroiodobenzene, and compound 27 (white solid, 63.1 mg, yield 66.7%) was obtained: 1 H NMR(300MHz,DMSO-d6)δ12.83(s,1H),7.67(d,J=8.9Hz,2H),7.46(d,J=8.9Hz,2H),6.97(s,2H),4.57(s,2H),4.52(s,2H),2.15(s,6H),1.35(s,6H).HRMS(ESI)calcd.for C 22 H 23 ClN2O5[M+Na] + :453.1193,found:453.1191。
[0218] Example 28
[0219] Ethyl 2-(4-((3-(4-chlorophenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 28)
[0220]
[0221] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (2) with 4-chloroiodobenzene, and compound 28 (colorless liquid, 102.5 mg, yield 62.0%) was obtained without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.54(d,J=9.0Hz,2H),7.36(d,J=9.0Hz,2H),7.07(s,2H),4.63(s,2H),4.31(s,2H),4.28(q,J=7.1Hz,2H),2.20(s,6H),1.47(s,6H),1.36(t,J=7.1Hz,3H).MS(ESI):m / z481.1[M+Na] + 。
[0222] Example 29
[0223] 2-(2,6-Dimethyl-4-((3-(3-methyl-4-(trifluoromethyl)phenyl)-2,5-dioxoimidazolin-1-yl)methyl)phenoxy)-2-methylpropanoic acid (Compound 29)
[0224]
[0225] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 4-bromo-2-methylbenzotrifluoride, and compound 29 (white solid, 103.3 mg, yield 68.2%) was obtained: 1 H NMR(300MHz,DMSO-d6)δ12.80(s,1H),7.94–7.53(m,3H),6.97(s,2H),4.60(s,2H),4.53(s,2H),2.45(s,3H),2.14(s,6H),1.34(s,6H).HRMS(ESI)calcd.for C 24 H 25 F3N2O5[M+Na] + :501.1613,found:501.1612。
[0226] Example 30
[0227] Ethyl 2-(2,6-dimethyl-4-((3-(3-methyl-4-(trifluoromethyl)phenyl)-2,5-dioxoimidazolin-1-yl)methyl)phenoxy)-2-methylpropanoate (Compound 30)
[0228]
[0229] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 4-bromo-2-methylbenzotrifluoride, and obtain compound 30 (colorless liquid, 160.8 mg, yield 40.9%) without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.62(d,J=8.4Hz,2H),7.44(d,J=8.5Hz,1H),7.07(s,2H),4.64(s,2H),4.33(s,2H),4.29(q,J=7.1Hz,2H),2.52(s,3H),2.20(s,6H),1.46(s,6H),1.35(t,J=7.1Hz,3H).MS(ESI):m / z 529.2[M+Na] + 。
[0230] Example 31
[0231] 2-(2,6-Dimethyl-4-((3-(3-fluoro-4-(trifluoromethyl)phenyl)-2,5-dioxoimidazolin-1-yl)methyl)phenoxy)-2-methylpropanoic acid (Compound 31)
[0232]
[0233] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 4-bromo-2-fluorobenzotrifluoride, and obtain compound 31 (white solid, 170.3 mg, yield 69.4%): 1 H NMR(300MHz,DMSO-d6)δ12.84(s,1H),7.86–7.78(m,2H),7.68(d,J=8.6Hz,1H),6.99(s,2H),4.63(s,2H),4.55(s,2H),2.16(s,6H),1.36(s,6H).HRMS(ESI)calcd.for C 23 H 22 F4N2O5[M+Na] + :505.1363,found:505.1363。
[0234] Example 32
[0235] Ethyl 2-(2,6-dimethyl-4-((3-(3-fluoro-4-(trifluoromethyl)phenyl)-2,5-dioxoimidazolin-1-yl)methyl)phenoxy)-2-methylpropanoate (Compound 32)
[0236]
[0237] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 4-bromo-2-fluorobenzotrifluoride, and obtain compound 32 (colorless liquid, 260.5 mg, yield 65.6%) without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.74(d,J=12.5Hz,1H),7.61(t,J=8.3Hz,1H),7.30(d,J=9.0Hz,1H),7.07(s,2H),4.64(s,2H),4.33(s,2H),4.30(q,J=7.1Hz,2H),2.20(s,6H),1.46(s,6H),1.36(t,J=7.1Hz,3H).MS(ESI):m / z 533.2[M+Na] + 。
[0238] Example 33
[0239] 2-(2,6-Dimethyl-4-((3-(3-chloro-4-(trifluoromethyl)phenyl)-2,5-dioxoimidazolin-1-yl)methyl)phenoxy)-2-methylpropanoic acid (Compound 33)
[0240]
[0241] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 2-chloro-4-bromobenzotrifluoride, and obtain compound 33 (white solid, 260.1 mg, yield 85.8%): 1 H NMR(300MHz,DMSO-d6)δ12.82(s,1H),8.05–7.97(m,1H),7.88(d,J=8.8Hz,1H),7.84–7.75(m,1H),6.97(s,2H),4.63(s,2H),4.53(s,2H),2.14(s,6H),1.34(s,6H).HRMS(ESI)calcd.for C 23 H 22 ClF3N2O5[M+Na] + :521.1067,found:521.1064。
[0242] Example 34
[0243] Ethyl 2-(2,6-dimethyl-4-((3-(3-chloro-4-(trifluoromethyl)phenyl)-2,5-dioxoimidazolin-1-yl)methyl)phenoxy)-2-methylpropanoate (Compound 34)
[0244]
[0245] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 2-chloro-4-bromobenzotrifluoride, and compound 34 (colorless liquid, 321.5 mg, yield 77.7%) was obtained without hydrolysis: 1 H NMR (300 MHz, CDCl3) δ 7.90 (s, 1H), 7.69 (d, J = 8.8 Hz, 1H), 7.53 (d, J = 8.6 Hz, 1H), 7.06 (s, 2H), 4.64 (s, 2H), 4.33 (s, 2H), 4.28 (q, J = 7.1 Hz, 2H), 2.20 (s, 6H), 1.46 (s, 6H), 1.36 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 549.1 [M+Na] + 。
[0246] Example 35
[0247] 2-(4-((2,5-Dioxo-3-phenylimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 35)
[0248]
[0249] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with iodobenzene, and compound 35 (white solid, 157.2 mg, yield 75.2%) was obtained: 1 H NMR (300 MHz, DMSO-d6) δ 12.82 (s, 1H), 7.65 (d, J = 8.1 Hz, 2H), 7.46–7.33 (m, 2H), 7.18–7.10 (m, 1H), 6.97 (s, 2H), 4.58 (s, 2H), 4.53 (s, 2H), 2.15 (s, 6H), 1.34 (s, 6H). HRMS (ESI) calcd. for C 22 H 24 N2O5 [M+Na] + : 419.1583, found: 419.1573.
[0250] Example 36
[0251] Ethyl 2-(4-((2,5-dioxo-3-phenylimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 36)
[0252]
[0253] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with iodobenzene, and compound 36 (white solid, 226.9 mg, yield 63.7%) was obtained without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.59(d,J=7.9Hz,2H),7.40(t,J=8.0Hz,2H),7.46–7.35(m,2H),7.08(s,2H),4.64(s,2H),4.33(s,2H),4.29(q,J=7.9Hz,2H),2.19(s,6H),1.46(s,6H),1.35(t,J=7.1Hz,3H).MS(ESI):m / z447.2[M+Na] + 。
[0254] Example 37
[0255] 2-(4-((3-(4-Cyanophenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 37)
[0256]
[0257] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 4-iodobenzonitrile, and compound 37 (white solid, 177.1 mg, yield 83.1%) was obtained: 1 H NMR(300MHz,DMSO-d6)δ12.82(s,1H),7.88(d,J=9.0Hz,2H),7.83(d,J=9.1Hz,2H),6.97(s,2H),4.61(s,2H),4.54(s,2H),2.15(s,6H),1.34(s,6H).HRMS(ESI)calcd.for C 23 H 23 N3O5[M+Na] + :444.1535,found:444.1531。
[0258] Example 38
[0259] Ethyl 2-(4-((3-(4-cyanophenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 38)
[0260]
[0261] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 4-iodobenzonitrile, and compound 38 (yellow foamy solid, 228 mg, yield 67.7%) was obtained without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.74(d,J=9.1Hz,2H),7.69(d,J=9.0Hz,2H),7.07(s,2H),4.65(s,2H),4.35(s,2H),4.29(q,J=7.1Hz,2H),2.20(s,6H),1.46(s,6H),1.36(t,J=7.1Hz,3H).MS(ESI):m / z 472.2[M+Na] + 。
[0262] Example 39
[0263] 2-(4-((3-(4-Methoxyphenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 39)
[0264]
[0265] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 4-bromoanisole, and compound 39 (white solid, 143.2 mg, yield 72.6%) was obtained: 1 H NMR(300MHz,DMSO-d6)δ12.81(s,1H),7.54(d,J=9.0Hz,2H),7.01–6.93(m,4H),4.54(s,2H),4.51(s,2H),3.75(s,3H),2.15(s,6H),1.35(s,6H).HRMS(ESI)calcd.for C 23 H 26 N2O6[M+Na] + :449.1689,found:449.1685。
[0266] Example 40
[0267] 2-(4-((3-(4-Methoxyphenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 40)
[0268]
[0269] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 4-bromoanisole, and obtain compound 40 (white solid, 211 mg, yield 61.7%) without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.47(d,J=9.1Hz,2H),7.07(s,2H),6.93(d,J=9.1Hz,2H),4.63(s,2H),4.30(s,2H),4.28(q,J=9.6,4.6Hz,2H),3.82(s,3H),2.19(s,6H),1.47(s,6H),1.36(t,J=7.1Hz,3H).MS(ESI):m / z 477.2[M+Na] + 。
[0270] Example 41
[0271] 2-(4-((3-(4-Biphenyl-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 41)
[0272]
[0273] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 4-bromobiphenyl, and obtain compound 41 (white solid, 163.1 mg, yield 78.7%): 1 H NMR(300MHz,DMSO-d6)δ12.82(s,1H),7.79–7.73(m,4H),7.68(d,J=7.7Hz,2H),7.53–7.41(m,2H),7.39–7.19(m,1H),6.99(s,2H),4.63(s,2H),4.55(s,2H),2.16(s,6H),1.35(s,6H).HRMS(ESI)calcd.forC 28 H 28 N2O5[M+Na] + :495.1896,found:495.1883。
[0274] Example 42
[0275] Ethyl 2-(4-((3-(4-biphenyl-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 42)
[0276]
[0277] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 4-bromobiphenyl, and compound 42 (white solid, 208.5 mg, yield 53.9%) was obtained without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.67(d,J=8.8Hz,2H),7.64(d,J=6.2Hz,2H),7.59(d,J=8.0Hz,2H),7.46(t,J=7.5Hz,2H),7.36(t,J=7.3Hz,1H),7.09(s,2H),4.66(s,2H),4.37(s,2H),4.30(q,J=7.1Hz,2H),2.21(s,6H),1.47(s,6H),1.36(t,J=7.1Hz,3H).MS(ESI):m / z 523.2[M+Na] + 。
[0278] Example 43
[0279] 2-(4-((3-(4-Methylthiophenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 43)
[0280]
[0281] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 4-(iodophenylthio)methane, and compound 43 (yellow solid, 200.3 mg, yield 81.1%) was obtained: 1 H NMR(300MHz,DMSO-d6)δ12.83(s,1H),7.60(d,J=8.8Hz,2H),7.31(d,J=8.8Hz,2H),6.97(s,2H),4.56(s,2H),4.52(s,2H),2.47(s,3H),2.15(s,6H),1.36(s,6H).HRMS(ESI)calcd.for C 23 H 26 N2O5S[M+Na] + :465.1460,found:465.1455。
[0282] Example 44
[0283] Ethyl 2-(4-((3-(4-methylthiophenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 44)
[0284]
[0285] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 4-iodophenylthiomethane, and compound 44 (yellow solid, 266.5 mg, yield 74.9%) was obtained without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.52(d,J=8.7Hz,2H),7.30(d,J=10.1Hz,2H),7.07(s,2H),4.63(s,2H),4.30(s,2H),4.29(q,J=7.1Hz,2H),2.49(s,3H),2.19(s,6H),1.46(s,6H),1.36(t,J=7.1Hz,3H).MS(ESI):m / z 493.2[M+Na] + 。
[0286] Example 45
[0287] 2-(4-((2,5-Dioxo-3-(3-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 45)
[0288]
[0289] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 3-iodobenzotrifluoride to obtain compound 45 (white solid, 169.1 mg, yield 67.1%): 1 H NMR(300MHz,DMSO-d6)δ12.83(s,1H),8.14(s,1H),7.83(d,J=8.7Hz,1H),7.69–7.61(m,1H),7.49(d,J=7.8Hz,1H),6.98(s,2H),4.65(s,2H),4.54(s,2H),2.15(s,6H),1.35(s,6H).HRMS(ESI)calcd.forC 23 H 23 F3N2O5[M+Na] + :487.1457,found:487.1451。
[0290] Example 46
[0291] Ethyl 2-(4-((2,5-dioxo-3-(3-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 46)
[0292]
[0293] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 3-iodotoluene, and compound 46 (yellow liquid, 268.1 mg, yield 54.5%) was obtained without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.91(s,1H),7.77(d,J=8.0Hz,1H),7.53(t,J=8.0Hz,1H),7.42(d,J=7.6Hz,1H),7.07(s,2H),4.65(s,2H),4.36(s,2H),4.29(q,J=7.1Hz,2H),2.20(s,6H),1.47(s,6H),1.36(t,J=7.1Hz,3H).MS(ESI):m / z 515.2[M+Na] + 。
[0294] Example 47
[0295] 2-(2-Chloro-4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-6-fluorophenoxy)-2-methylpropanoic acid (Compound 47)
[0296]
[0297] Referring to the method of Example 1, replace 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-fluoro-5-chlorobenzaldehyde to obtain compound 47 (white solid, 73.3 mg, yield 64.8%): 1 H NMR(300MHz,DMSO-d6)δ12.92(s,1H),7.87(d,J=8.8Hz,2H),7.78(d,J=8.8Hz,2H),7.35(s,1H),7.27(d,J=11.6Hz,1H),4.65(s,2H),4.61(s,2H),1.46(s,6H).HRMS(ESI)calcd.for C 21 H 17 ClF4N2O5[M+Na] + :511.0660,found:511.0654。
[0298] Example 48
[0299] Ethyl 2-(2-chloro-4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-6-fluorophenoxy)-2-methylpropanoate (Compound 48)
[0300]
[0301] Referring to the method of Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with 4-hydroxy-3-fluoro-5-chlorobenzaldehyde, and compound 48 (yellow liquid, 120.6 mg, yield 46.7%) was obtained without hydrolysis: 1 H NMR (300 MHz, CDCl3) δ 7.73 (d, J = 9.0 Hz, 2H), 7.67 (d, J = 9.1 Hz, 2H), 7.29 (s, 1H), 7.13 (dd, J = 10.8, 2.0 Hz, 1H), 4.68 (s, 2H), 4.39 (s, 2H), 4.27 (q, J = 7.1 Hz, 2H), 1.57 (s, 6H), 1.33 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 539.1 [M+Na] + 。
[0302] Example 49
[0303] 2-(4-((2,5-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2-fluorophenoxy)-2-methylpropanoic acid (Compound 49)
[0304]
[0305] Referring to the method of Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with 3-fluoro-4-hydroxybenzaldehyde, and compound 49 (white solid, 47.2 mg, yield 59.0%) was obtained: 1 H NMR (300 MHz, DMSO-d6) δ 13.14 (s, 1H), 7.86 (d, J = 8.8 Hz, 2H), 7.77 (d, J = 8.8 Hz, 2H), 7.23 (d, J = 12.0 Hz, 1H), 7.09 (d, J = 8.6 Hz, 1H), 6.95 (t, J = 8.5 Hz, 1H), 4.62 (s, 4H), 1.50 (s, 6H). HRMS (ESI) calcd. for C 21 H 18 F4N2O5 [M+Na] + : 477.1050, found: 477.1044。
[0306] Example 50
[0307] Ethyl 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2-fluorophenoxy)-2-methylpropanoate (Compound 50)
[0308]
[0309] According to the method of Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with 3-fluoro-4-hydroxybenzaldehyde, and compound 50 (yellow liquid, 85.3 mg, yield 35.3%) was obtained without hydrolysis: 1 H NMR (300 MHz, CDCl3) δ 7.72 (d, J = 8.9 Hz, 2H), 7.66 (d, J = 9.0 Hz, 2H), 7.22 (dd, J = 11.3, 2.0 Hz, 1H), 7.13 (d, J = 8.4 Hz, 1H), 6.94 (t, J = 8.3 Hz, 1H), 4.70 (s, 2H), 4.36 (s, 2H), 4.26 (q, J = 7.1 Hz, 2H), 1.59 (s, 6H), 1.30 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 505.1 [M+Na] + 。
[0310] Example 51
[0311] 2-(4-((2,5-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2-chlorophenoxy)-2-methylpropanoic acid (Compound 51)
[0312]
[0313] According to the method of Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with 3-chloro-4-hydroxybenzaldehyde, and compound 51 (white solid, 21.3 mg, yield 55.7%) was obtained: 1 H NMR (300 MHz, DMSO-d6) δ 13.21 (s, 1H), 7.86 (d, J = 8.7 Hz, 2H), 7.77 (d, J = 8.8 Hz, 2H), 7.45 (d, J = 2.0 Hz, 1H), 7.24 (dd, J = 8.5, 2.0 Hz, 1H), 6.88 (d, J = 8.5 Hz, 1H), 4.61 (s, 2H), 4.60 (s, 2H), 1.53 (s, 6H). HRMS (ESI) calcd. for C 21 H 18 ClF3N2O5 [M+Na] + : 493.0754, found: 493.0749。
[0314] Example 52
[0315] Ethyl 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2-chlorophenoxy)-2-methylpropanoate (Compound 52)
[0316]
[0317] According to the method of Example 1, replace 4-hydroxy-3,5-dimethylbenzaldehyde with 3-chloro-4-hydroxybenzaldehyde, and compound 52 (yellow liquid, 40.0 mg, yield 16.0%) was obtained without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.72(d,J=8.9Hz,2H),7.66(d,J=8.9Hz,2H),7.51(d,J=2.1Hz,1H),7.29–7.21(m,1H),6.85(d,J=8.4Hz,1H),4.68(s,2H),4.36(s,2H),4.26(q,J=7.1Hz,2H),1.60(s,6H),1.29(t,J=7.1Hz,3H).MS(ESI):m / z 521.1[M+Na] + 。
[0318] Example 53
[0319] 2-(4-((2,5-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)acetic acid (Compound 53)
[0320]
[0321] According to the method of Example 1, replace ethyl 2-bromoisobutyrate with ethyl 2-bromoacetate to obtain compound 53 (white solid, 73.4 mg, yield 78.5%): 1 H NMR(300MHz,DMSO-d6)δ12.86(s,1H),7.86(d,J=8.8Hz,2H),7.77(d,J=8.7Hz,2H),7.01(s,2H),4.62(s,2H),4.54(s,2H),4.34(s,2H),2.21(s,6H).HRMS(ESI)calcd.for C 21 H 19 F3N2O5[M+Na] + :459.1144,found:459.1135。
[0322] Example 54
[0323] Ethyl 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)acetate (Compound 54)
[0324]
[0325] Referring to the method of Example 1, ethyl 2-bromoacetate was used instead of ethyl 2-bromoisobutyrate, and compound 54 (white solid, 99.4 mg, yield 42.7%) was obtained without hydrolysis: 1 H NMR (300 MHz, CDCl3) δ 7.73 (d, J = 8.8 Hz, 2H), 7.66 (d, J = 8.9 Hz, 2H), 7.12 (s, 2H), 4.67 (s, 2H), 4.38 (s, 2H), 4.36 (s, 2H), 4.32 (q, J = 7.1 Hz, 2H), 2.30 (s, 6H), 1.34 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 487.1 [M+Na] + 。
[0326] Example 55
[0327] 2-(4-((2,5-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2-(trifluoromethoxy)phenoxy)-2-methylpropanoic acid (Compound 55)
[0328]
[0329] Referring to the method of Example 1, 3-trifluoromethoxy-4-hydroxybenzaldehyde was used instead of 4-hydroxy-3,5-dimethylbenzaldehyde, and compound 55 (white solid, 143.4 mg, yield 90.5%) was obtained: 1 H NMR (300 MHz, DMSO-d6) δ 13.22 (s, 1H), 7.85 (d, J = 8.7 Hz, 2H), 7.77 (d, J = 8.7 Hz, 2H), 7.38 (s, 1H), 7.29 (d, J = 8.5 Hz, 1H), 6.91 (d, J = 8.5 Hz, 1H), 4.63 (s, 2H), 4.61 (s, 2H), 1.52 (s, 6H). HRMS (ESI) calcd. for C 22 H 18 F6N2O6 [M+Na] + : 543.0967, found: 543.0961.
[0330] Example 56
[0331] Ethyl 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2-(trifluoromethoxy)phenoxy)-2-methylpropanoate (Compound 56)
[0332]
[0333] According to the method of Example 1, replace 4-hydroxy-3,5-dimethylbenzaldehyde with 3-trifluoromethoxy-4-hydroxybenzaldehyde, and compound 56 (yellow liquid, 167.0 mg, yield 62.2%) was obtained without hydrolysis: 1 H NMR (300 MHz, CDCl3) δ 7.72 (d, J = 8.9 Hz, 2H), 7.66 (d, J = 9.0 Hz, 2H), 7.40 (s, 1H), 7.34–7.29 (m, 1H), 6.85 (d, J = 8.5 Hz, 1H), 4.71 (s, 2H), 4.36 (s, 2H), 4.24 (q, J = 7.1 Hz, 2H), 1.61 (s, 6H), 1.27 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 571.1 [M+Na] + 。
[0334] Example 57
[0335] 2-(4-((2,5-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2-(methyl)phenoxy)-2-methylpropanoic acid (Compound 57)
[0336]
[0337] According to the method of Example 1, replace 4-hydroxy-3,5-dimethylbenzaldehyde with 3-methyl-4-hydroxybenzaldehyde, and compound 57 (white solid, 139.0 mg, yield 80.3%) was obtained: 1 H NMR (300 MHz, DMSO-d6) δ 13.00 (s, 1H), 7.85 (d, J = 8.8 Hz, 2H), 7.76 (d, J = 8.7 Hz, 2H), 7.18–7.12 (m, 1H), 7.12–7.02 (m, 1H), 6.64 (d, J = 8.4 Hz, 1H), 4.61 (s, 2H), 4.55 (s, 2H), 2.14 (s, 3H), 1.50 (s, 6H). HRMS (ESI) calcd. for C 22 H 21 F3N2O5 [M+Na] + : 473.1300, found: 473.1297。
[0338] Example 58
[0339] Ethyl 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2-(methyl)phenoxy)-2-methylpropanoate (Compound 58)
[0340]
[0341] According to the method of Example 1, replace 4-hydroxy-3,5-dimethylbenzaldehyde with 3-methyl-4-hydroxybenzaldehyde, and compound 58 (yellow liquid, 184.0 mg, yield 77.0%) was obtained without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.72(d,J=8.9Hz,2H),7.65(d,J=8.9Hz,2H),7.27(s,1H),7.18(d,J=8.1Hz,1H),6.61(d,J=8.3Hz,1H),4.67(s,2H),4.33(s,2H),4.25(q,J=7.1Hz,2H),2.23(s,3H),1.58(s,6H),1.27(t,J=7.1Hz,3H).MS(ESI):m / z 501.1[M+Na] + 。
[0342] Example 59
[0343] 2-(4-((2,5-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)phenoxy)-2-methylpropanoic acid (Compound 59)
[0344]
[0345] According to the method of Example 1, replace 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxybenzaldehyde, and compound 59 (white solid, 273.4 mg, yield 89.5%) was obtained: 1 H NMR(300MHz,DMSO-d6)δ13.02(s,1H),7.85(d,J=8.8Hz,2H),7.76(d,J=8.8Hz,2H),7.26(d,J=8.5Hz,2H),6.79(d,J=8.5Hz,2H),4.61(s,2H),4.59(s,2H),1.50(s,6H).HRMS(ESI)calcd.for C 21 H 19 F3N2O5[M+Na] + :459.1144,found:459.1137。
[0346] Example 60
[0347] Ethyl 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)phenoxy)-2-methylpropanoate (Compound 60)
[0348]
[0349] Referring to the method of Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with p-hydroxybenzaldehyde, and compound 76 (white solid, 237 mg, yield 97.2%) was obtained without hydrolysis: 1 H NMR (300 MHz, CDCl3) δ 7.72 (d, J = 8.8 Hz, 2H), 7.65 (d, J = 8.9 Hz, 2H), 7.37 (d, J = 8.6 Hz, 2H), 6.81 (d, J = 8.6 Hz, 2H), 4.71 (s, 2H), 4.34 (s, 2H), 4.24 (q, 7.1 Hz, 2H), 1.60 (s, 6H), 1.27 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 487.2 [M+Na] + 。
[0350] Example 61
[0351] 2-(4-((3-(4-Bromophenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 61)
[0352]
[0353] Referring to the method of Example 1, p-trifluoromethylaniline was replaced with p-bromoaniline, and compound 61 (white solid, 225.0 mg, yield 78.9%) was obtained: 1 H NMR (300 MHz, DMSO-d6) δ 12.85 (s, 1H), 7.65–7.55 (m, 4H), 6.96 (s, 2H), 4.56 (s, 2H), 4.51 (s, 2H), 2.14 (s, 6H), 1.33 (s, 6H). HRMS (ESI) calcd. for C 22 H 23 BrN2O5 [M+Na] + : 497.0688, found: 497.0675.
[0354] Example 62
[0355] Ethyl 2-(4-((3-(4-bromophenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 62)
[0356]
[0357] Referring to the method of Example 1, p-bromoaniline was replaced with p-trifluoromethylaniline, and compound 62 (white solid, 356.0 mg, yield 48.0%) was obtained without hydrolysis: 1 H NMR (300 MHz, CDCl3) δ 7.52–7.45 (m, 4H), 7.05 (s, 2H), 4.61 (s, 2H), 4.31–4.24 (m, 4H), 2.17 (s, 6H), 1.44 (s, 6H), 1.34 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 527.1 [M+Na] + 。
[0358] Example 63
[0359] 2-(4-((2,5-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)propanoic acid (Compound 63)
[0360]
[0361] Referring to the method of Example 1, ethyl 2-bromoisobutyrate was replaced with ethyl 2-bromopropionate to obtain compound 63 (white solid, 82.3 mg, yield 58.8%): 1 H NMR (300 MHz, DMSO-d6) δ 12.86 (s, 1H), 7.86 (d, J = 8.6 Hz, 2H), 7.77 (d, J = 8.7 Hz, 2H), 6.99 (s, 2H), 4.62 (s, 2H), 4.54 (s, 2H), 4.38 (q, J = 6.7 Hz, 1H), 2.20 (s, 6H), 1.40 (d, J = 6.7 Hz, 3H). HRMS (ESI) calcd. for C 22 H 21 F3N2O5 [M+Na] + : 473.1300, found: 473.1300.
[0362] Example 64
[0363] Ethyl 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)propionate (Compound 64)
[0364]
[0365] Referring to the method of Example 1, ethyl 2-bromoisobutyrate was replaced with ethyl 2-bromopropionate, and compound 64 (colorless liquid, 160 mg, yield 66.9%) was obtained without hydrolysis: 11H NMR (300 MHz, CDCl3) δ 7.73 (d, J = 8.7 Hz, 2H), 7.66 (d, J = 8.8 Hz, 2H), 7.11 (s, 2H), 4.66 (s, 2H), 4.47 (q, J = 6.8 Hz, 1H), 4.36 (s, 2H), 4.24 (q, J = 7.0 Hz, 2H), 2.29 (s, 6H), 1.53 (d, J = 6.7 Hz, 3H), 1.29 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 501.2 [M+Na] + 。
[0366] Example 65
[0367] 2-(4-((3-(4-Isopropylphenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 65)
[0368]
[0369] Referring to the method of Example 1, 4-iodobenzotrifluoride in the synthetic route of method (3) was replaced with 4-bromoisopropylbenzene to obtain Compound 65 (white solid, 112.4 mg, yield 64.4%): 1 1H NMR (300 MHz, DMSO-d6) δ 12.82 (s, 1H), 7.54 (d, J = 8.5 Hz, 2H), 7.26 (d, J = 8.5 Hz, 2H), 6.96 (s, 2H), 4.55 (s, 2H), 4.51 (s, 2H), 3.03–2.69 (m, 1H), 2.14 (s, 6H), 1.34 (s, 6H), 1.19 (d, J = 6.9 Hz, 6H). HRMS (ESI) calcd. for C 25 H 30 N2O5 [M+Na] + : 461.2052, found: 461.2046。
[0370] Example 66
[0371] Ethyl 2-(4-((3-(4-isopropylphenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 66)
[0372]
[0373] Referring to the method of Example 1, 4-iodobenzotrifluoride in the synthetic route of method (3) was replaced with 4-bromoisopropylbenzene, and Compound 66 (yellow liquid, 185.3 mg, yield 39.7%) was obtained without hydrolysis:1 1H NMR (300 MHz, CDCl3) δ 7.49 (d, J = 8.6 Hz, 2H), 7.26 (d, J = 8.6 Hz, 2H), 7.07 (s, 2H), 4.64 (s, 2H), 4.32 (t, J = 7.1 Hz, 2H), 4.30 (q, J = 7.1 Hz, 2H), 2.91 (dt, J = 13.8, 6.9 Hz, 1H), 2.19 (s, 6H), 1.46 (s, 6H), 1.36 (t, J = 7.1 Hz, 3H), 1.25 (d, J = 6.9 Hz, 6H). MS (ESI): m / z 489.2 [M+Na] + 。
[0374] Example 67
[0375] 2-(4-((2,5-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)butyric acid (Compound 67)
[0376]
[0377] Referring to the method of Reference Example 1, ethyl 2-bromoisobutyrate was replaced with ethyl 2-bromobutyrate to obtain Compound 67 (white solid, 132.0 mg, yield 72.1%): 1 1H NMR (300 MHz, DMSO-d6) δ 12.87 (s, 1H), 7.86 (d, J = 8.6 Hz, 2H), 7.77 (d, J = 8.7 Hz, 2H), 6.99 (s, 2H), 4.63 (s, 2H), 4.54 (s, 2H), 4.30 (t, J = 5.9 Hz, 1H), 2.22 (s, 6H), 1.86 (dt, 2H), 0.96 (t, J = 7.3 Hz, 3H). HRMS (ESI) calcd. for C 23 H 23 F3N2O5 [M+Na] + : 487.1457, found: 487.1451。
[0378] Example 68
[0379] Ethyl 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)butyrate (Compound 68)
[0380]
[0381] Referring to the method of Reference Example 1, ethyl 2-bromobutyrate was used to replace ethyl 2-bromoisobutyrate, and Compound 68 (colorless liquid, 194.6 mg, yield 78.9%) was obtained without hydrolysis: 1 H NMR (300 MHz, CDCl3) δ 7.73 (d, J = 8.7 Hz, 2H), 7.65 (d, J = 8.9 Hz, 2H), 7.09 (s, 2H), 4.65 (s, 2H), 4.39 (t, J = 7.5 Hz, 1H), 4.35 (s, 2H), 4.20 (q, J = 6.1 Hz, 2H), 2.28 (s, 6H), 1.97 (dt, 2H), 1.26 (t, J = 6.6 Hz, 3H), 1.02 (t, J = 7.5 Hz, 3H). MS (ESI): m / z 515.2 [M+Na] + 。
[0382] Example 69
[0383] 2-(4-((3-(4-(tert-Butyl)phenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 69)
[0384]
[0385] Referring to the method of Reference Example 1, 4-tert-butylbromobenzene was used to replace 4-iodotrifluoromethylbenzene in the synthetic route of method (3), and Compound 69 (white solid, 81.7 mg, yield 53.8%) was obtained: 1 H NMR (300 MHz, DMSO-d6) δ 12.81 (s, 1H), 7.53 (d, J = 8.7 Hz, 2H), 7.39 (d, J = 8.7 Hz, 2H), 6.94 (s, 2H), 4.54 (s, 2H), 4.50 (s, 2H), 2.13 (s, 6H), 1.32 (s, 6H), 1.26 (s, 9H). HRMS (ESI) calcd. for C 26 H 32 N2O5 [M+Na] + : 475.2209, found: 475.2203.
[0386] Example 70
[0387] Ethyl 2-(4-((3-(4-(tert-Butyl)phenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 70)
[0388]
[0389] Referring to the method of Example 1, replace 4-iodotrifluoromethylbenzene in the synthetic route of method (3) with 4-tert-butylbromobenzene, and compound 70 (white solid, 147 mg, yield 61.2%) was obtained without hydrolysis: 1 H NMR(300MHz,DMSO-d6)δ7.54(d,J=8.7Hz,2H),7.40(d,J=8.8Hz,2H),6.96(s,2H),4.54(d,J=7.1Hz,2H),4.16(q,J=7.1Hz,2H),2.10(s,2H),1.36(s,6H),1.27(s,6H),1.23(s,9H),1.21(t,J=7.1Hz,3H).MS(ESI):m / z 503.2[M+Na] + 。
[0390] Example 71
[0391] 2-(2,6-Dimethyl-4-((3-(4-(methylsulfonyl)phenyl)-2,5-dioxoimidazolin-1-yl)methyl)phenoxy)-2-methylpropanoic acid (Compound 71)
[0392]
[0393] Referring to the method of Example 1, replace 4-iodotrifluoromethylbenzene in the synthetic route of method (3) with 4-bromobenzenesulfone, and compound 71 (white solid, 37.2 mg, yield 26.2%) was obtained: 1 H NMR(300MHz,DMSO-d6)δ12.79(s,1H),8.30–7.55(m,4H),6.96(s,2H),4.62(s,2H),4.52(s,2H),3.17(s,3H),2.13(s,6H),1.32(s,6H).HRMS(ESI)calcd.for C 23 H 26 N2O7S[M+Na] + :497.1358,found:497.1346。
[0394] Example 72
[0395] Ethyl 2-(2,6-dimethyl-4-((3-(4-(methylsulfonyl)phenyl)-2,5-dioxoimidazolin-1-yl)methyl)phenoxy)-2-methylpropanoate (Compound 72)
[0396]
[0397] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 4-bromophenyl sulfone, and compound 72 (yellow solid, 131.2 mg, yield 27.8%) was obtained without hydrolysis: 1 H NMR(300MHz,DMSO-d6)δ7.92(q,J=9.1Hz,4H),6.99(s,2H),4.64(s,2H),4.55(s,2H),4.17(q,J=7.1Hz,2H),3.34(s,3H),2.11(s,6H),1.37(s,6H),1.24(t,J=7.1Hz,3H).MS(ESI):m / z 525.2[M+Na] + 。
[0398] Example 73
[0399] 2-(2-Chloro-4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-6-methoxyphenoxy)-2-methylpropanoic acid (Compound 73)
[0400]
[0401] Referring to the method of Example 1, replace 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-chloro-5-methoxybenzaldehyde to obtain compound 73 (white solid, 100.2 mg, yield 66.7%): 1 H NMR(300MHz,DMSO-d6)δ12.45(s,1H),7.85(d,J=8.6Hz,2H),7.75(d,J=8.7Hz,2H),6.97(d,J=6.8Hz,2H),4.60(s,4H),3.69(s,3H),1.34(s,6H).HRMS(ESI)calcd.for C 22 H 20 ClF3N2O6[M+Na] + :523.0860,found:523.0854。
[0402] Example 74
[0403] Ethyl 2-(2-chloro-4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-6-methoxyphenoxy)-2-methylpropanoate (Compound 74)
[0404]
[0405] According to the method of Example 1, replace 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-chloro-5-methoxybenzaldehyde, and compound 74 (colorless liquid, 190.2 mg, yield 72.3%) was obtained without hydrolysis: 1 H NMR(300MHz,DMSO-d6)δ7.86(d,J=8.7Hz,2H),7.77(d,J=8.8Hz,2H),6.99(d,J=8.9Hz,2H),4.62(s,4H),4.15(q,J=7.1Hz,2H),3.70(s,3H),1.37(s,6H),1.23(t,J=7.2Hz,3H).MS(ESI):m / z551.1[M+Na] + 。
[0406] Example 75
[0407] 2-(4-(3-(4-Ethylphenyl)-2,5-dioxoimidazolidin-1-yl)methyl)-2,6-dimethylphenoxy-2-methylpropanoic acid (Compound 75)
[0408]
[0409] According to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 1-ethyl-4-iodobenzene to obtain compound 75 (white solid, 79.2 mg, yield 70.5%): 1 H NMR(300MHz,DMSO-d6)δ12.85(s,1H),7.54(d,J=8.5Hz,2H),7.23(d,J=8.5Hz,2H),6.96(s,2H),4.56(s,2H),4.52(s,1H),2.58(q,J,7.5Hz,2H),2.14(s,6H),1.34(s,6H),1.16(t,J=7.5Hz,3H).HRMS(ESI)calcd.for C 24 H 28 N2O5[M+Na] + :447.1896,found:447.1894。
[0410] Example 76
[0411] Ethyl 2-(4-(3-(4-ethylphenyl)-2,5-dioxoimidazolidin-1-yl)methyl)-2,6-dimethylphenoxy-2-methylpropanoate (Compound 76)
[0412]
[0413] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 1-ethyl-4-iodobenzene, and compound 76 (white solid, 120.0 mg, yield 26.4%) was obtained without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.49(d,J=8.5Hz,2H),7.23(d,J=8.5Hz,2H),7.08(s,2H),4.64(s,2H),4.32(s,2H),4.29(q,J=7.1Hz,2H),2.65(q,J=7.5Hz,2H),2.20(s,6H),1.47(s,6H),1.36(t,J=7.1Hz,3H),1.26(t,J=7.7Hz,3H).MS(ESI):m / z 475.2[M+Na] + 。
[0414] Example 77
[0415] 2-(2-Bromo-4-(2,5-dioxo-3-(4-trifluoromethyl)phenyl)imidazolidin-1-yl)methylphenoxy)-2-methylpropanoic acid (Compound 77)
[0416]
[0417] Referring to the method of Example 1, replace 4-hydroxy-3,5-dimethylbenzaldehyde with 4-hydroxy-3-bromobenzaldehyde to obtain compound 77 (white solid, 97.3 mg, yield 76.4%): 1 H NMR(300MHz,DMSO-d6)δ13.28(s,1H),7.86(d,J=8.7Hz,2H),7.77(d,J=8.9Hz,2H),7.60(s,1H),7.28(d,J=7.9Hz,1H),6.85(d,J=8.4Hz,1H),4.61(s,2H),4.60(s,2H),1.53(s,6H).HRMS(ESI)calcd.for C 21 H 18 BrF3N2O5[M+Na] + :537.0249,found:537.0243。
[0418] Example 78
[0419] Ethyl 2-(2-bromo-4-(2,5-dioxo-3-(4-trifluoromethyl)phenyl)imidazolidin-1-yl)methylphenoxy)-2-methylpropanoate (Compound 78)
[0420]
[0421] Referring to the method of Example 1, 4-hydroxy-3,5-dimethylbenzaldehyde was replaced with 4-hydroxy-3-bromobenzaldehyde, and compound 78 (white solid, 134.3 mg, yield 49.4%) was obtained without hydrolysis: 1 H NMR (300 MHz, DMSO-d6) δ 7.86 (d, J = 8.8 Hz, 2H), 7.77 (d, J = 8.8 Hz, 2H), 7.62 (s, 1H), 7.28 (d, J = 6.4 Hz, 1H), 6.79 (d, J = 8.5 Hz, 1H), 4.64–4.55 (m, 4H),, 4.19 (dd, J = 14.1, 7.1 Hz, 2H), 1.55 (s, 6H), 1.19 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 565.1 [M+Na] + 。
[0422] Example 79
[0423] 2-(4-((4-Ethyl-4-methyl-2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 79)
[0424]
[0425]
[0426] Synthesis of Intermediate O-1
[0427] 5-Ethyl-5-methylimidazolidine-2,4-dione (142 mg, 1 mmol) was dissolved in DMF (5 mL), M-1 (492 mg, 1.5 mmol) and cesium carbonate (652 mg, 2 mmol) were added, and the mixture was stirred at room temperature for 12 hours. After the reaction was completed, water (20 mL) was added, and the mixture was extracted with EA (25 mL x 3). The organic phase was washed with saturated sodium chloride solution (20 mL x 1). The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 2:1) to obtain Intermediate O-1 (yellow liquid, 150 mg, yield 38.4%).
[0428] Synthesis of Compound 80
[0429] The intermediate O-1 (150 mg, 0.4 mmol), copper(I) iodide (15 mg, 0.08 mmol), potassium carbonate (110 mg, 0.8 mmol) and (1R,2R)-(-)-N,N'-dimethyl-1,2-cyclohexanediamine (23 mg, 0.16 mmol) were added into a Schlenk tube under argon protection. A toluene (3 mL) solution of p-(trifluoromethyl)bromobenzene (107 mg, 0.48 mmol) was added, and the reaction system was heated to 110 °C. After the reaction was completed, the solvent was removed under reduced pressure. The residue was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 5:1) to obtain compound 80 (colorless liquid, 47 mg, yield 22.1%).
[0430] Synthesis of Compound 79
[0431] Compound 80 (47 mg, 0.09 mmol) was dissolved in acetonitrile (3 mL), and a mixed solution of concentrated hydrochloric acid (concentration 12 M) and acetic acid (4 mL, 1:1) was added. The reaction system was heated to 100 °C and stirred for 4 hours. After the reaction was completed, the solvent was removed under reduced pressure. Water (10 mL) was added, and the mixture was extracted with EA (15 mL × 3). The organic phase was washed with saturated sodium chloride solution (10 mL × 1). The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (dichloromethane / methanol = 100:1) to obtain compound 79 (white solid, 21 mg, yield 55.4%): 1 H NMR (300 MHz, DMSO-d6) δ 12.84 (s, 1H), 7.84 (d, J = 8.5 Hz, 2H), 7.64 (d, J = 8.3 Hz, 2H), 6.95 (s, 2H), 4.58 (s, 2H), 2.15 (s, 6H), 2.01–1.65 (m, 2H), 1.43 (s, 3H), 1.34 (s, 6H), 0.68 (t, J = 7.2 Hz, 3H). HRMS (ESI) calcd. for C 26 H 29 F3N2O5[M+NH4] + 524.2372, found 524.2370.
[0432] Example 80
[0433] Ethyl 2-(4-((4-ethyl-4-methyl-2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionate (Compound 80)
[0434]
[0435] Referring to the method of Example 79, compound 80 (white solid, 47 mg, yield 22.1%) was prepared without hydrolysis: 1 HNMR(300MHz,CDCl3)δ7.70(d,J=8.5Hz,2H),7.46(d,J=8.3Hz,2H),7.07(s,2H),4.65(s,2H),4.30(q,J=7.1Hz,2H),2.19(s,6H),2.06–1.93(m,2H),1.79–1.66(m,3H),1.46(s,6H),1.36(t,J=7.1Hz,3H),0.71(t,J=7.3Hz,3H).MS(ESI):m / z 557.2[M+Na] + 。
[0436] Example 81
[0437] 2-(4-((2,4-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 81)
[0438]
[0439] Synthesis of Intermediate B-2
[0440] Dissolve p-trifluoromethyl isocyanate (1.87 g, 10 mmol) in dichloromethane (15 mL), add triethylamine (1.66 mL, 12 mmol), and under ice bath conditions, add glycine ethyl ester hydrochloride (1.67 g, 12 mmol). Stir the reaction at room temperature overnight. After the reaction is completed, evaporate the solvent under reduced pressure, add water (50 mL), extract with EA (50 mL x 3), and wash the organic phase with saturated sodium chloride solution (50 mL x 1). Evaporate the solvent under reduced pressure, and purify the residue by silica gel column chromatography (petroleum ether / ethyl acetate = 40:1) to obtain Intermediate B-2 (white solid, 2.4 g, yield 82.7%).
[0441] Synthesis of Intermediate B-3
[0442] Dissolve Intermediate B-2 (1.45 g, 5 mmol) in tetrahydrofuran (15 mL), add sodium hydride (160 mg, 4 mmol) under ice bath conditions, and stir the reaction at room temperature for 3 hours. After the reaction is completed, quench with water (20 mL) and evaporate the solvent under reduced pressure. Add water (20 mL), extract with EA (25 mL x 3), and wash the organic phase with saturated sodium chloride solution (20 mL x 1). Evaporate the solvent under reduced pressure, and purify the residue by silica gel column chromatography (petroleum ether / ethyl acetate = 2:1) to obtain Intermediate B-3 (white solid, 486.1 mg, yield 39.8%).
[0443] Synthesis of Compound 82
[0444] Dissolve intermediate B-3 (296 mg, 1.2 mmol) in DMF (3 mL), add M-1 (492 mg, 1.5 mmol) and cesium carbonate (782 mg, 2.4 mmol), and stir the reaction at room temperature for 12 hours. After the reaction is completed, evaporate the solvent under reduced pressure. The residue is purified by silica gel column chromatography (petroleum ether / ethyl acetate = 5:1) to obtain Compound 82 (colorless liquid, 45 mg, yield 7.5%).
[0445] Synthesis of Compound 81
[0446] Dissolve Compound 82 (45 mg, 0.09 mmol) in acetonitrile (2 mL), add a mixed solution of concentrated hydrochloric acid (concentration 12 M) and glacial acetic acid (4 mL, 1:1), heat the reaction system to 100 °C, and stir the reaction for 4 hours. After the reaction is completed, evaporate the solvent under reduced pressure, add water (10 mL), extract with EA (15 mL x 3), and wash the organic phase with saturated sodium chloride solution (10 mL x 1). Evaporate the solvent under reduced pressure, and the residue is purified by silica gel column chromatography (dichloromethane / methanol = 100:1) to obtain Compound 81 (white solid, 10.3 mg, yield 25.7%): 1 H NMR (300 MHz, DMSO-d6) δ 12.84 (s, 1H), 7.89 (d, J = 8.5 Hz, 2H), 7.71 (d, J = 8.3 Hz, 2H), 7.01 (s, 2H), 4.47 (s, 2H), 4.06 (s, 2H), 2.18 (s, 6H), 1.36 (s, 6H). HRMS (ESI) calcd. for C 23 H 23 F3N2O5[M+NH4] + 482.1903, found 482.1902。
[0447] Example 82
[0448] Ethyl 2-(4-((2,4-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionate (Compound 82)
[0449]
[0450] Referring to the method of Example 81, Compound 82 (colorless liquid, 45 mg, yield 7.5%) was prepared without hydrolysis: 1HNMR (300 MHz, CDCl3) δ 7.75 (d, J = 8.5 Hz, 2H), 7.68 (d, J = 8.4 Hz, 2H), 6.93 (s, 2H), 4.54 (s, 2H), 4.31 (q, J = 7.2 Hz, 2H), 3.93 (s, 2H), 2.23 (s, 6H), 1.49 (s, 6H), 1.38 (t, J = 7.2 Hz, 3H). MS (ESI): m / z 515.2 [M+Na] + 。
[0451] Example 83
[0452] 2-(4-((4,4-Dimethyl-2,5-dioxo-3-(4-(trifluoromethoxy)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 83)
[0453]
[0454] Synthesis of Intermediate F-1
[0455] p-Iodotrifluoromethylbenzene (271 mg, 1 mmol), cuprous oxide (141 mg, 1 mmol) and 5,5-dimethylhydantoin (192 mg, 1.5 mmol) were added to a three-necked flask, and the gas was exchanged and protected by argon. Subsequently, anhydrous DMF (3 mL) was added, and the reaction system was heated to 150 °C and reacted for 12 hours. After the reaction was completed, the reaction solution was filtered through diatomaceous earth, water (10 mL) was added, extracted with EA (10 mL x 3) and washed with saturated sodium chloride (10 mL x 1). The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 5:1) to obtain Compound F-1 (pale yellow solid, 160 mg, yield: 58.2%).
[0456] Synthesis of Compound 84
[0457] Intermediate F-1 (50 mg, 0.2 mmol) was dissolved in DMF (2 mL), M-1 (98 mg, 0.3 mmol) and cesium carbonate (163 mg, 0.5 mmol) were added, and the reaction was stirred at room temperature for 12 hours. After the reaction was completed, the solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 5:1) to obtain Compound 84 (colorless liquid, 80 mg, yield 76.2%).
[0458] Synthesis of Compound 83
[0459] Compound 84 (80 mg, 0.15 mmol) was dissolved in acetonitrile (2 mL), and a mixed solution of concentrated hydrochloric acid (concentration 12 M) and glacial acetic acid (4 mL, 1:1) was added. The reaction system was heated to 100 °C and stirred for 4 hours. After the reaction was completed, the solvent was removed under reduced pressure. Water (10 mL) was added, and the mixture was extracted with EA (15 mL x 3). The organic phase was washed with saturated sodium chloride solution (10 mL x 1). The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (dichloromethane / methanol = 100:1) to obtain compound 83 (white solid, 42 mg, yield 55.5%): 1 H NMR (300 MHz, DMSO-d6) δ 12.82 (s, 1H), 7.90 (d, J = 8.6 Hz, 2H), 7.75 (d, J = 8.4 Hz, 2H), 7.06 (s, 2H), 4.50 (s, 2H), 2.17 (s, 6H), 1.36 (s, 6H), 1.35 (s, 6H). HRMS (ESI) calcd. for C 25 H 27 F3N2O5 [M+NH4] + 510.2216, found 510.2213。
[0460] Example 84
[0461] Ethyl 2-(4-((4,4-dimethyl-2,5-dioxo-3-(4-(trifluoromethoxy)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionate (Compound 84)
[0462]
[0463] Referring to the method of Example 83, Compound 84 (colorless liquid, 80 mg, yield 76.2%) was prepared without hydrolysis: 1 HNMR (300 MHz, CDCl3) δ 7.75 (d, J = 9.0 Hz, 2H), 7.71 (d, J = 9.0 Hz, 2H), 6.99 (s, 2H), 4.54 (s, 2H), 4.31 (q, J = 7.1 Hz, 2H), 2.22 (s, 6H), 1.48 (s, 6H), 1.39 (s, 6H), 1.38 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 543.2 [M+Na] + 。
[0464] Example 85
[0465] 2-(4-(2-(2,5-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)ethyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 85)
[0466]
[0467] Synthesis of Intermediate L-1
[0468] Dissolve 2,6-dimethylphenol (1.2 g, 10 mmol) in acetonitrile (15 mL), add ethyl 2-bromoisobutyrate (3.4 mL, 30 mmol) and cesium carbonate (8.1 g, 25 mmol). Heat the reaction system to 80 °C and stir overnight. After the reaction is completed, evaporate the solvent under reduced pressure, add water (20 mL), extract with EA (50 mL x 3). Wash the organic phase with 1N sodium hydroxide solution (20 mL x 3) and saturated sodium chloride solution (20 mL x 1), and dry over anhydrous Mg2SO4. Evaporate the solvent under reduced pressure, and the residue is Intermediate L-1 (yellow liquid, 1.9 g, yield 80.5%).
[0469] Synthesis of Intermediate L-2
[0470] Under argon protection and ice bath conditions, add DCM (20 mL) and bromoacetyl bromide (2.1 mL, 24 mmol) to AlCl3 (3.2 g, 24 mmol), and stir at room temperature for 1 hour. Under ice bath conditions, add Intermediate L-1 (1.9 g, 8 mmol) to the above reaction solution, and continue to stir the reaction at room temperature for 12 hours. After the reaction is completed, evaporate the solvent under reduced pressure, add water (20 mL), extract with EA (20 mL x 3). Wash the organic phase with saturated sodium chloride solution (20 mL x 1). Evaporate the solvent under reduced pressure, and the residue is Intermediate L-2 (brownish-black liquid, 1.8 g, yield 66.7%).
[0471] Synthesis of Intermediate M-2
[0472] Dissolve Intermediate L-2 (1.8 g, 5 mmol) in trifluoroacetic acid (15 mL), and add triethylsilane (1.0 mL, 7.5 mmol). Heat the reaction system to 70 °C and stir for 12 hours. After the reaction is completed, under ice bath conditions, add water (20 mL) for dilution, and stir at room temperature for 10 minutes. Evaporate the solvent under reduced pressure, extract with EA (20 mL x 3). Wash the organic phase with saturated sodium bicarbonate solution (20 mL) and saturated sodium chloride solution (20 mL x 1). Evaporate the solvent under reduced pressure, and the residue is Intermediate M-2 (colorless liquid, 1.4 g, yield 82.3%).
[0473] Synthesis of Compound 86
[0474] Intermediate A-3 (110 mg, 0.45 mmol) was dissolved in acetonitrile (5 mL), M-2 (184.7 mg, 0.54 mmol) and cesium carbonate (293.4 mg, 0.9 mmol) were added, the reaction system was heated to 80 °C, and stirred for 12 hours. After the reaction was completed, the solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 5:1) to obtain compound 86 (colorless liquid, 66.9 mg, yield 29.3%).
[0475] Synthesis of Compound 85
[0476] Compound 86 (66.9 mg, 0.13 mmol) was dissolved in acetonitrile (2 mL), concentrated hydrochloric acid (concentration 12 M) and acetic acid mixed solution (4 mL, 1:1) were added, the reaction system was heated to 100 °C, and stirred for 4 hours. After the reaction was completed, the solvent was removed under reduced pressure, water (10 mL) was added, and extracted with EA (15 mL x 3). The organic phase was washed with saturated sodium chloride solution (10 mL x 1). The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (dichloromethane / methanol = 100:1) to obtain compound 85 (white solid, 32 mg, yield 51.6%): 1 H NMR (300 MHz, DMSO-d6) δ 12.76 (s, 1H), 7.83 (d, J = 8.7 Hz, 2H), 7.76 (d, J = 8.7 Hz, 2H), 6.86 (s, 2H), 4.53 (s, 2H), 3.64 (t, J = 7.4 Hz, 2H), 2.76 (t, J = 7.5 Hz, 2H), 2.13 (s, 6H), 1.31 (s, 6H). HRMS (ESI) calcd. for C 24 H 25 F3N2O5 [M+Na] + : 501.1613, found: 501.1607.
[0477] Example 86
[0478] Ethyl 2-(4-(2-(2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)ethyl)-2,6-dimethylphenoxy)-2-methylpropionate (Compound 86)
[0479]
[0480] Referring to the method of Example 85, compound 86 (colorless liquid, 66.9 mg, yield 29.3%) was prepared without hydrolysis: 11H NMR (300 MHz, CDCl3) δ 7.71 (d, J = 9.1 Hz, 2H), 7.67 (d, J = 9.3 Hz, 2H), 6.87 (s, 2H), 4.33 (q, J = 7.1 Hz, 2H), 4.28 (s, 2H), 3.82 (t, J = 8.3 Hz, 2H), 2.88 (t, J = 8.3 Hz, 2H), 2.18 (s, 6H), 1.45 (s, 6H), 1.36 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 529.2 [M+Na] + 。
[0481] Example 87
[0482] 2-(4-(2-(2,4-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)ethyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 87)
[0483]
[0484] According to the method of Reference Example 85, replace A-3 with B-3 to obtain Compound 87 (white solid, 23 mg, yield 61.5%): 1 1H NMR (300 MHz, DMSO-d6) δ 12.69 (s, 1H), 7.87 (d, J = 8.4 Hz, 2H), 7.61 (d, J = 8.2 Hz, 2H), 6.91 (s, 2H), 4.10 (s, 2H), 3.56 (t, J = 7.3 Hz, 2H), 2.77 (t, J = 7.3 Hz, 2H), 2.14 (s, 6H), 1.32 (s, 6H). HRMS (ESI) calcd. for C 24 H 25 F3N2O5 [M+Na] + : 501.1613, found: 501.1608。
[0485] Example 88
[0486] Ethyl 2-(4-(2-(2,4-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolin-1-yl)ethyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 88)
[0487]
[0488] According to the method of Reference Example 85, replace A-3 with B-3 and obtain Compound 88 (colorless liquid, 39.3 mg, yield 26%) without hydrolysis: 11H NMR (300 MHz, CDCl3) δ 7.74 (d, J = 8.4 Hz, 2H), 7.61 (d, J = 8.5 Hz, 2H), 6.86 (s, 2H), 4.31 (q, J = 7.1 Hz, 2H), 3.85 (s, 2H), 3.71 (t, J = 7.2 Hz, 2H), 2.86 (t, J = 7.1 Hz, 2H), 2.20 (s, 6H), 1.47 (s, 6H), 1.38 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 529.2 [M+Na] + 。
[0489] Example 89
[0490] 2-(4-(3-(2,5-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)propyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 89)
[0491]
[0492] Synthesis of Intermediate K-3
[0493] Dissolve Intermediate K-1 (0.5 g, 2.25 mmol) in DMF (5 mL), add 2,2-dimethyl-1,3-dioxane-4,6-dione (0.5 g, 3.38 mmol) and triethylamine (0.4 mL, 2.7 mmol). Under ice bath conditions, add formic acid (1.2 mL) and stir at room temperature for 5 minutes. Heat the reaction system to 100 °C and stir for 12 hours. After completion of the reaction, add water (20 mL), extract with EA (50 mL x 3), wash the organic phase with saturated sodium chloride solution (20 mL x 1), and dry over anhydrous MgSO4. Evaporate the solvent under reduced pressure, and the residue is Intermediate K-3 (colorless liquid, 0.5 g, yield 71.8%).
[0494] Synthesis of Intermediate K-4
[0495] Dissolve Intermediate K-3 (0.5 g, 1.5 mmol) in tetrahydrofuran (5 mL), add borane-tetrahydrofuran complex (1 mL, 1 mmol) under ice bath conditions. Stir at room temperature for 12 hours. After completion of the reaction, add water (10 mL) and stir for 30 minutes. Extract with EA (20 mL x 3), wash the organic phase with saturated sodium chloride solution (20 mL x 1). Evaporate the solvent under reduced pressure, and the residue is Intermediate K-4 (colorless liquid, 0.2 g, yield 45.4%).
[0496] Synthesis of Intermediate M-3
[0497] Dissolve intermediate K-4 (0.2 g, 1 mmol) in dichloromethane (5 mL). Under ice bath conditions, add carbon tetrabromide (0.5 g, 1.5 mmol) and triphenylphosphine (0.5 g, 1.4 mmol). Stir the reaction at room temperature for 12 hours. After the reaction is completed, evaporate the solvent under reduced pressure. The residue is purified by silica gel column chromatography (petroleum ether / ethyl acetate = 20:1) to obtain intermediate M-3 (colorless liquid, 0.25 g, yield 70.2%).
[0498] Synthesis of Compound 90
[0499] Dissolve intermediate A-3 (123 mg, 0.5 mmol) in acetonitrile (5 mL). Add M-3 (213.6 mg, 0.6 mmol) and cesium carbonate (326 mg, 1 mmol). Heat the reaction system to 80 °C and stir the reaction for 12 hours. After the reaction is completed, evaporate the solvent under reduced pressure. The residue is purified by silica gel column chromatography (petroleum ether / ethyl acetate = 5:1) to obtain Compound 90 (colorless liquid, 58.9 mg, yield 22.6%).
[0500] Synthesis of Compound 89
[0501] Dissolve Compound 90 (58.9 mg, 0.12 mmol) in acetonitrile (2 mL). Add a mixed solution of concentrated hydrochloric acid (concentration 12 M) and acetic acid (2 mL, 1:1). Heat the reaction system to 100 °C and stir the reaction for 4 hours. After the reaction is completed, evaporate the solvent under reduced pressure. Add water (10 mL), and extract with EA (15 mL × 3). Wash the organic phase with saturated sodium chloride solution (10 mL × 1). Evaporate the solvent under reduced pressure. The residue is purified by silica gel column chromatography (dichloromethane / methanol = 100:1) to obtain Compound 89 (white solid, 43 mg, yield 72.8%): 1 H NMR (300 MHz, DMSO-d6) δ 12.78 (s, 1H), 7.85 (d, J = 8.7 Hz, 2H), 7.76 (d, J = 8.8 Hz, 2H), 6.84 (s, 2H), 4.48 (s, 2H), 3.50 (t, J = 6.9 Hz, 2H), 2.55–2.51 (m, 2H), 2.12 (s, 6H), 1.96–1.79 (m, 2H), 1.32 (s, 6H). HRMS (ESI) calcd. for C 25 H 27 F3N2O5 [M+Na] + : 515.1770, found: 515.1754。
[0502] Example 90
[0503] Ethyl 2-(4-(3-(2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)propyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 90)
[0504]
[0505] Compound 90 (colorless liquid, 58.9 mg, yield 22.6%) was prepared according to the method of Example 89 without hydrolysis: 1 H NMR (300 MHz, CDCl3) δ 7.70 (d, J = 9.2 Hz, 2H), 7.66 (d, J = 6.3 Hz, 2H), 6.81 (s, 2H), 4.28 (q, J = 7.1 Hz, 2H), 4.19 (s, 2H), 3.68 (t, J = 7.6 Hz, 2H), 2.60 (t, J = 7.6 Hz, 2H), 2.13 (s, 6H), 2.09–1.94 (m, 2H), 1.44 (s, 6H), 1.35 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 543.2 [M+Na] + 。
[0506] Example 91
[0507] 2-(4-(3-(2,4-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)propyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 91)
[0508]
[0509] Compound 91 (white solid, 28 mg, yield 75%) was prepared according to the method of Example 89 by replacing A-3 with B-3: 1 H NMR (300 MHz, DMSO-d6) δ 12.60 (s, 1H), 7.87 (d, J = 8.4 Hz, 2H), 7.65 (d, J = 8.3 Hz, 2H), 6.87 (s, 2H), 4.13 (s, 2H), 3.40 (t, J = 7.0 Hz, 2H), 2.58–2.53 (m, 2H), 2.13 (s, 6H), 1.91–1.76 (m, 2H), 1.33 (s, 6H). HRMS (ESI) calcd. for C 25 H 27 F3N2O5 [M+Na] + : 515.1770, found: 515.1764。
[0510] Example 92
[0511] Ethyl 2-(4-(3-(2,4-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)propyl)-2,6-dimethylphenoxy)-2-methylpropionate (Compound 82)
[0512]
[0513] According to the method of Example 89, replace A-3 with B-3, and Compound 92 (yellow liquid, 39 mg, yield 21%) was obtained without hydrolysis: 1 H NMR (300 MHz, CDCl3) δ 7.74 (d, J = 8.4 Hz, 2H), 7.63 (d, J = 8.4 Hz, 2H), 6.81 (s, 2H), 4.30 (q, J = 7.1 Hz, 2H), 4.00 (s, 2H), 3.54 (t, J = 7.2 Hz, 2H), 2.60 (t, J = 7.5 Hz, 2H), 2.18 (s, 6H), 2.01–1.87 (m, 2H), 1.47 (s, 6H), 1.37 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 543.2 [M+Na] + 。
[0514] Example 93
[0515] 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 93)
[0516]
[0517] Synthesis of Compound 94
[0518] Dissolve intermediate E-1 (190 mg, 0.54 mmol) in DMF (5 mL), add p-(trifluoromethyl)benzyl bromide (155 mg, 0.65 mmol), cesium carbonate (352 mg, 1.08 mmol), and stir the reaction mixture at room temperature for 12 hours. After the reaction is completed, evaporate the solvent under reduced pressure, and purify the residue by silica gel column chromatography (petroleum ether / ethyl acetate = 5:1) to obtain Compound 94 (colorless liquid, 110 mg, yield 40.8%).
[0519] Synthesis of Compound 93
[0520] Compound 94 (110 mg, 0.22 mmol) was dissolved in acetonitrile (2 mL), and a mixed solution of concentrated hydrochloric acid (concentration 12 M) and acetic acid (2 mL, 1:1) was added. The reaction system was heated to 100 °C and stirred for 4 hours. After the reaction was completed, the solvent was removed by distillation under reduced pressure. Water (10 mL) was added, and the mixture was extracted with EA (15 mL x 3). The organic phase was washed with saturated sodium chloride solution (10 mL x 1). The solvent was removed by distillation under reduced pressure, and the residue was purified by silica gel column chromatography (dichloromethane / methanol = 100:1) to obtain compound 93 (white solid, 67 mg, yield 63.8%): 1 H NMR (300 MHz, DMSO-d6) δ 12.82 (s, 1H), 7.72 (d, J = 8.0 Hz, 2H), 7.53 (d, J = 8.1 Hz, 2H), 6.92 (s, 2H), 4.62 (s, 2H), 4.46 (s, 2H), 4.03 (s, 2H), 2.15 (s, 6H), 1.35 (s, 6H). HRMS (ESI) calcd. for C 24 H 25 F3N2O5 [M+Na] + : 501.1613, found: 501.1606。
[0521] Example 94
[0522] Ethyl 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionate (Compound 94)
[0523]
[0524] Referring to the method of Example 93, Compound 94 (colorless liquid, 110 mg, yield 40.8%) was prepared without hydrolysis: 1 HNMR (300 MHz, CDCl3) δ 7.64 (d, J = 8.0 Hz, 2H), 7.39 (d, J = 8.1 Hz, 2H), 7.03 (s, 2H), 4.64 (s, 2H), 4.58 (s, 2H), 4.30 (q, J = 7.1 Hz, 2H), 3.78 (s, 2H), 2.19 (s, 6H), 1.47 (s, 6H), 1.36 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 529.2 [M+Na] + 。
[0525] Example 95
[0526] 2-(4-(3-(4-Ethoxyphenyl)-2,5-dioxoimidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 95)
[0527]
[0528] Referring to the method of Example 1, 4-iodobenzotrifluoride in the synthetic route of method (3) was replaced with p-iodophenetole to obtain Compound 95 (white solid, 60.9 mg, yield 34.6%): 1 1H NMR (300 MHz, DMSO-d6) δ 12.83 (s, 1H), 7.51 (d, J = 9.0 Hz, 2H), 6.95 (s, 2H), 6.93 (d, 2H), 4.52 (s, 2H), 4.49 (s, 2H), 3.99 (q, J = 6.9 Hz, 2H), 2.13 (s, 6H), 1.33 (s, 6H), 1.29 (q, J = 7.0 Hz, 3H). MS (ESI): m / z 463.2 [M+Na] +
[0529] Example 96
[0530] Ethyl 2-(4-(3-(4-ethoxyphenyl)-2,5-dioxoimidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 96)
[0531]
[0532] Referring to the method of Example 1, 4-iodobenzotrifluoride in the synthetic route of method (3) was replaced with p-iodophenetole, and Compound 96 was obtained without hydrolysis (white solid, 195.6 mg, yield 41.8%): 1 1H NMR (300 MHz, CDCl3) δ 7.45 (d, J = 8.9 Hz, 2H), 7.06 (s, 2H), 6.91 (d, J = 9.0 Hz, 2H), 4.61 (s, 2H), 4.28 (s, 2H), 4.28 (q, J = 7.1 Hz, 2H), 4.02 (q, J = 6.8 Hz, 2H), 2.18 (s, 6H), 1.45 (s, 6H), 1.40 (t, J = 7.0 Hz, 3H), 1.34 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 491.2 [M+Na] + 。
[0533] Example 97
[0534] 2-(4-(2,5-Dioxo-3-(4-trifluoromethylphenyl)imidazolidin-1-yl)methyl)-2-(methoxyphenoxy)-2-methylpropanoic acid (Compound 97)
[0535]
[0536] According to the method of Example 1, 3,5-dimethyl-4-hydroxybenzaldehyde was replaced with 3-methoxy-4-hydroxybenzaldehyde to obtain Compound 97 (white solid, 85.9 mg, yield 59.7%): 1 H NMR (300 MHz, DMSO-d6) δ 12.90 (s, 1H), 7.84 (d, J = 8.6 Hz, 2H), 7.75 (d, J = 8.8 Hz, 2H), 6.97 (s, 1H), 6.80 (d, J = 8.3 Hz, 1H), 6.75 (d, J = 8.2 Hz, 1H), 4.61 (s, 2H), 4.58 (s, 2H), 3.72 (s, 3H), 1.43 (s, 6H). MS (ESI): m / z 489.1 [M+Na] +
[0537] Example 98
[0538] Ethyl 2-(4-(2,5-dioxo-3-(4-trifluoromethylphenyl)imidazolidin-1-yl)methyl)-2-(methoxyphenoxy)-2-methylpropanoate (Compound 98)
[0539]
[0540] According to the method of Example 1, 3,5-dimethyl-4-hydroxybenzaldehyde was replaced with 3-methoxy-4-hydroxybenzaldehyde, and Compound 98 was obtained without hydrolysis (white solid, 158.5 mg, yield 35.3%): 1 H NMR (300 MHz, CDCl3) δ 7.72 (d, J = 8.9 Hz, 2H), 7.66 (d, J = 8.9 Hz, 2H), 7.04 (d, J = 1.7 Hz, 1H), 6.95 (dd, J = 8.2, 1.8 Hz, 1H), 6.82 (d, J = 8.2 Hz, 1H), 4.70 (s, 2H), 4.35 (s, 2H), 4.25 (q, J = 7.1 Hz, 2H), 3.84 (s, 3H), 1.57 (s, 6H), 1.29 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 517.2 [M+Na] + 。
[0541] Example 99
[0542] 2-(4-(3-(4-Formylphenyl)-2,5-dioxoimidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 99)
[0543]
[0544] Referring to the method of Example 1, replace 4-iodotrifluoromethylbenzene in the synthetic route of method (3) with 4-bromobenzaldehyde to obtain Compound 99 (white solid, 15.3 mg, yield 12.1%): 1 H NMR (300 MHz, DMSO-d6) δ 12.83 (s, 1H), 9.92 (s, 1H), 7.94 (d, J = 8.8 Hz, 2H), 7.86 (d, J = 8.7 Hz, 2H), 6.97 (s, 2H), 4.63 (s, 2H), 4.53 (s, 2H), 2.13 (s, 6H), 1.33 (s, 6H). MS (ESI): m / z 425.1 [M+Na] +
[0545] Example 100
[0546] Ethyl 2-(4-(3-(4-Formylphenyl)-2,5-dioxoimidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 100)
[0547]
[0548] Referring to the method of Example 1, replace 4-iodotrifluoromethylbenzene in the synthetic route of method (3) with 4-bromobenzaldehyde and obtain Compound 100 without hydrolysis (white solid, 135.8 mg, yield 30.0%): 1 H NMR (300 MHz, CDCl3) δ 9.97 (s, 1H), 7.92 (s, 2H), 7.79 (d, J = 8.7 Hz, 2H), 7.08 (s, 2H), 4.66 (s, 2H), 4.39 (s, 2H), 4.30 (q, J = 7.0 Hz, 2H), 2.20 (s, 6H), 1.47 (s, 6H), 1.36 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 475.2 [M+Na] + 。
[0549] Example 101
[0550] 2-(3-(4-Cyclopropylphenyl)-2,5-dioxoimidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 101)
[0551]
[0552] Referring to the method of Example 1, 4-iodotrifluoromethylbenzene in the synthetic route of method (3) was replaced with 4-bromocyclopropylbenzene to obtain compound 101 (white solid, 18.5 mg, yield 27.6%): 1 H NMR (300 MHz, DMSO-d6) δ 12.83 (s, 1H), 7.56 (d, J = 8.6 Hz, 1H), 7.49 (d, J = 8.4 Hz, 1H), 7.39 (d, J = 8.6 Hz, 1H), 7.08 (d, J = 8.6 Hz, 1H), 6.95 (s, 2H), 4.53 (s, 2H), 4.50 (s, 2H), 2.13 (s, 6H), 1.87–1.78 (m, 1H), 1.33 (s, 6H), 1.00–0.86 (m, 2H), 0.66–0.56 (m, 2H). MS (ESI): m / z 437.2 [M+Na] +
[0553] Example 102
[0554] Ethyl 2-(4-(3-(4-cyclopropylphenyl)-2,5-dioxoimidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionate (Compound 102)
[0555]
[0556] Referring to the method of Example 1, 4-iodotrifluoromethylbenzene in the synthetic route of method (3) was replaced with 4-bromocyclopropylbenzene, and compound 102 (white solid, 74.0 mg, yield 14.6%) was obtained without hydrolysis: 1 H NMR (300 MHz, CDCl3) δ 7.46 (d, J = 8.6 Hz, 2H), 7.12 (s, 2H), 7.08 (d, J = 4.1 Hz, 2H), 4.63 (s, 2H), 4.31 (s, 2H), 4.27 (q, J = 7.1 Hz, 2H), 2.29–2.21 (m, 1H), 2.19 (s, 6H), 1.47 (s, 6H), 1.37 (d, J = 7.2 Hz, 3H), 0.97 (dt, J = 13.7, 5.6 Hz, 2H), 0.68 (dt, J = 9.6, 4.7 Hz, 2H). MS (ESI): m / z 487.2 [M+Na] + 。
[0557] Example 103
[0558] 2-(4-(3-Fluorophenyl)-2,5-dioxoimidazolidin-1-yl)methyl)-2,6-dimethylphenoxy-2-methylpropanoic acid (Compound 103)
[0559]
[0560] Referring to the method of Example 1, replace 4-iodotrifluoromethylbenzene in the synthetic route of method (3) with 3-fluoroiodobenzene to obtain Compound 103 (white solid, 9.0 mg, yield 20.6%): 1 H NMR (300 MHz, DMSO-d6) δ 12.82 (s, 1H), 7.57 (d, J = 11.1 Hz, 1H), 7.43 (s, 2H), 6.99–6.94 (m, 3H), 4.56 (s, 2H), 4.51 (s, 2H), 2.13 (s, 6H), 1.33 (s, 6H). MS (ESI): m / z 437.1 [M+Na] +
[0561] Example 104
[0562] Ethyl 2-(4-(3-(3-fluorophenyl)-2,5-dioxoimidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoate (Compound 104)
[0563]
[0564] Referring to the method of Example 1, replace 4-iodotrifluoromethylbenzene in the synthetic route of method (3) with 3-fluoroiodobenzene and obtain Compound 104 (white solid, 49.5 mg, yield 10.7%) without hydrolysis: 1 H NMR (300 MHz, CDCl3) δ 7.54 (dt, J = 11.1, 2.1 Hz, 1H), 7.36 (dd, J = 14.8, 8.2 Hz, 1H), 7.24 (dd, J = 7.9, 1.1 Hz, 1H), 7.07 (s, 2H), 6.87 (td, J = 8.2, 2.2 Hz, 1H), 4.64 (s, 2H), 4.32 (s, 2H), 4.27 (q, J = 7.1 Hz, 2H), 2.20 (s, 6H), 1.47 (s, 6H), 1.36 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 465.2 [M+Na] + 。
[0565] Example 105
[0566] 2-(3-Chloro-4-fluorophenyl)-2,5-dioxoimidazolidin-1-yl)methyl-2,6-dimethylphenoxy-2-methylpropanoic acid (Compound 105)
[0567]
[0568] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthesis route of method (3) with 2-chloro-1-fluoro-4-iodobenzene to obtain compound 105 (white solid, 25.4 mg, yield 20.5%): 1 H NMR (300 MHz, DMSO-d6) δ 12.82 (s, 1H), 7.89 (d, J = 6.3 Hz, 1H), 7.61 (d, J = 9.0 Hz, 1H), 7.46 (t, J = 9.2 Hz, 1H), 6.95 (s, 2H), 4.56 (s, 2H), 4.50 (s, 2H), 2.13 (s, 6H), 1.32 (s, 6H). MS (ESI): m / z 471.1 [M+Na] +
[0569] Example 106
[0570] Ethyl 2-(4-(3-chloro-4-fluorophenyl)-2,5-dioxoimidazolin-1-yl)methyl)-2,6-dimethylphenoxy-2-methylpropionate (Compound 106)
[0571]
[0572] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthesis route of method (3) with 2-chloro-1-fluoro-4-iodobenzene and obtain compound 106 (white solid, 134.6 mg, yield 30.8%) without hydrolysis: 1 H NMR (300 MHz, CDCl3) δ 7.77 (d, J = 3.4 Hz, 1H), 7.39 (s, 1H), 7.21–7.13 (m, 1H), 7.07 (s, 2H), 4.63 (s, 2H), 4.32–4.24 (m, 4H), 2.20 (s, 6H), 1.47 (s, 6H), 1.36 (t, J = 7.1 Hz, 3H). MS (ESI): m / z 499.1 [M+Na] + .
[0573] Example 107
[0574] 2-(3-chlorophenyl)-2,5-dioxoimidazolidin-1-ylmethyl)-2,6-dimethylphenoxy-2-methylpropanoic acid (Compound 107)
[0575]
[0576] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 1-chloro-3-iodobenzene to obtain compound 107 (white solid, 10 mg, yield 16.5%): 1 H NMR (300 MHz, DMSO-d6) δ 12.84 (s, 1H), 7.79 (s, 1H), 7.56 (d, J = 7.8 Hz, 1H), 7.41 (t, J = 8.1 Hz, 1H), 7.18 (d, J = 7.9 Hz, 1H), 6.96 (s, 2H), 4.57 (s, 2H), 4.51 (s, 2H), 2.13 (s, 6H), 1.33 (s, 6H). MS (ESI): m / z 453.2 [M+Na] +
[0577] Example 108
[0578] Ethyl 2-(4-(3-chlorophenyl)-2,5-dioxoimidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionate (Compound 108)
[0579]
[0580] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 1-chloro-3-iodobenzene, and obtain compound 108 (yellow liquid, 60.7 mg, yield 12.7%) without hydrolysis: 1 H NMR (300 MHz, CDCl3) δ 7.70 (s, 1H), 7.42 (d, J = 7.5 Hz, 1H), 7.32 (t, J = 7.9 Hz, 1H), 7.13 (d, J = 6.9 Hz, 1H), 7.06 (s, 2H), 4.63 (s, 2H), 4.30 (s, 2H), 4.26 (q, J = 7.0 Hz, 2H), 2.19 (s, 6H), 1.45 (s, 6H), 1.35 (t, J = 7.0 Hz, 3H). MS (ESI): m / z 481.1 [M+Na] + 。
[0581] Example 109
[0582] 2-(4-(2,5-Dioxo-3-(3-trifluoromethoxyphenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 109)
[0583]
[0584] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 3-bromobenzotrifluoromethoxy to obtain compound 109 (white solid, 47.4 mg, yield 36.7%): 1 H NMR(300MHz,DMSO-d6)δ12.90(s,1H),7.82(s,1H),7.62–7.45(m,2H),7.25–7.07(m,1H),,6.95(s,2H),4.58(s,2H),4.51(s,2H),2.13(s,6H),1.32(s,6H).MS(ESI):m / z 503.2[M+Na] +
[0585] Example 110
[0586] Ethyl 2-(4-(3-chlorophenyl)-2,5-dioxoimidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionate (Compound 110)
[0587]
[0588] Referring to the method of Example 1, replace 4-iodobenzotrifluoride in the synthetic route of method (3) with 3-bromobenzotrifluoromethoxy, and obtain compound 110 (yellow liquid, 176.1 mg, yield 38.4%) without hydrolysis: 1 H NMR(300MHz,CDCl3)δ7.66(s,1H),7.43(d,J=4.9Hz,2H),7.08(s,2H),7.03(s,1H),4.65(s,2H),4.33(s,2H),4.29(q,J=7.1Hz,2H),2.20(s,6H),1.47(s,6H),1.36(t,J=7.1Hz,3H).MS(ESI):m / z531.2[M+Na] + 。
[0589] Example 111
[0590] 2-(4-(2,5-Dioxo-3-(4-trifluoromethylphenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionate tromethamine salt (Compound 111)
[0591]
[0592] Compound 1 (232 mg, 0.5 mmol) was dissolved in DCM (4 mL), and then tromethamine (60.5 mg, 0.5 mmol) was added. The mixture was stirred at room temperature for 12 h, and a white solid precipitated from the reaction solution. The solid was filtered by suction, and then added to acetone (0.5 mL) and n-hexane (2 mL), and stirred at room temperature for 2 h. After filtration by suction, compound 111 (white solid, 277.0 mg, yield 94.7%) was obtained: 1 H NMR (300 MHz, DMSO-d6) δ 7.86 (d, J = 8.4 Hz, 2H), 7.76 (d, J = 8.8 Hz, 2H), 6.94 (s, 2H), 6.03 (s, 3H), 4.62 (s, 2H), 4.52 (s, 2H), 3.38 (s, 6H), 2.16 (s, 6H), 1.27 (s, 6H).
[0593] Example 112
[0594] Esmolol salt of 2-(4-(2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 112)
[0595]
[0596] Referring to the method of Example 111, the tromethamine in Example 111 was replaced with esmolol to obtain Compound 112 (white solid, 27.7 mg, yield 47.1%): 1 H NMR (300 MHz, DMSO-d6) δ 7.85 (d, J = 8.6 Hz, 2H), 7.75 (d, J = 8.7 Hz, 2H), 7.11 (d, J = 7.5 Hz, 2H), 6.94 (s, 2H), 6.83 (d, J = 7.7 Hz, 2H), 4.61 (s, 2H), 4.52 (s, 2H), 4.00 (s, 1H), 3.96–3.63 (m, 3H), 3.48–2.95 (m, 7H), 2.89 (d, J = 11.2 Hz, 1H), 2.75 (d, J = 8.0 Hz, 3H), 2.14 (s, 6H), 1.30 (s, 6H), 1.24 (s, 1H), 1.10 (d, J = 5.4 Hz, 6H).
[0597] Example 113
[0598] Cinacalcet salt of 2-(4-(2,5-dioxo-3-(4-trifluoromethylphenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 113)
[0599]
[0600] Referring to the method of Example 111, replace the tromethamine in Example 111 with cinacalcet to obtain Compound 113 (white solid, 49.0 mg, yield 55.8%): 1 H NMR (300 MHz, DMSO-d6) δ 8.25 (s, 1H), 7.97–7.66 (m, 7H), 7.49 (s, 5H), 6.96 (s, 2H), 4.57 (d, J = 25.9 Hz, 5H), 3.56–3.09 (m, 7H), 2.69 (s, 2H), 2.43–2.33 (m, 2H), 2.14 (s, 6H), 1.75 (s, 1H), 1.53–1.17 (m, 9H).
[0601] Example 114
[0602] Trimetazidine salt of 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 114)
[0603]
[0604] Referring to the method of Example 111, replace the tromethamine in Example 111 with trimetazidine to obtain Compound 114 (white solid, 55.8 mg, yield 76.4%): 1 H NMR (300 MHz, DMSO-d6) δ 7.85 (d, J = 8.5 Hz, 2H), 7.75 (d, J = 8.8 Hz, 2H), 6.94 (s, 3H), 6.74 (d, J = 8.4 Hz, 1H), 4.61 (s, 2H), 4.52 (s, 2H), 3.76 (d, J = 1.6 Hz, 6H), 3.72 (s, 3H), 2.78 (s, 3H), 2.37 (s, 3H), 2.14 (s, 6H), 1.29 (s, 6H).
[0605] Example 115
[0606] Fasudil salt of 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidinyloxy-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 115)
[0607]
[0608] Referring to the method of Example 111, replace the tromethamine in Example 111 with fasudil to obtain Compound 115 (white solid, 51.8 mg, yield 63.3%): 11H NMR (300 MHz, DMSO-d6) δ 9.48 (s, 1H), 8.69 (d, J = 5.8 Hz, 1H), 8.44 (d, J = 7.8 Hz, 1H), 8.37–8.28 (m, 2H), 7.91–7.66 (m, 5H), 6.94 (s, 2H), 4.61 (s, 2H), 4.52 (s, 2H), 3.53–3.41 (m, 4H), 2.87–2.67 (m, 4H), 2.13 (s, 6H), 1.67 (d, 2H), 1.30 (s, 6H).
[0609] Example 116
[0610] 2-(2,5-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionate butylolol salt (Compound 116)
[0611]
[0612] Referring to the method of Example 111, the tromethamine in Example 111 was replaced with butylolol to obtain Compound 116 (white solid, 62.8 mg, yield 73.4%): 1 1H NMR (300 MHz, DMSO-d6) δ 9.86 (s, 1H), 7.91–7.65 (m, 7H), 7.09 (d, J = 8.9 Hz, 1H), 6.94 (s, 2H), 5.75 (s, 1H), 4.61 (s, 2H), 4.52 (s, 2H), 4.02 (d, J = 6.5 Hz, 2H), 2.96–2.80 (m, 2H), 2.73 (d, J = 7.1 Hz, 1H), 2.57 (s, 3H), 2.23 (t, J = 7.3 Hz, 2H), 2.14 (s, 6H), 1.58 (q, J = 14.7, 7.4 Hz, 2H), 1.29 (s, 6H), 1.05 (d, J = 6.2 Hz, 6H), 0.89 (t, J = 7.3 Hz, 3H).
[0613] Example 117
[0614] 2-(4-(2,5-Dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropionate bevantolol salt (Compound 117)
[0615]
[0616] Referring to the method of Example 111, replace the tromethamine in Example 111 with bevantolol to obtain Compound 117 (white solid, 62.6 mg, yield 22.4%): 1 H NMR(300MHz,DMSO-d6)δ7.85(d,J=8.6Hz,2H),7.75(d,J=8.6Hz,2H),7.14(t,J=7.8Hz,1H),6.95(s,2H),6.83(d,J=8.9Hz,2H),6.71(t,J=6.6Hz,3H),4.61(s,2H),4.52(s,2H),3.90(d,J=13.4Hz,3H),3.72(s,2H),3.70(s,3H),3.04–2.74(m,6H),2.26(s,3H),2.14(s,6H),1.32(s,6H).
[0617] Example 118
[0618] Metoprolol salt of 2-(4-(2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 118)
[0619]
[0620] Referring to the method of Example 111, replace the tromethamine in Example 111 with metoprolol to obtain Compound 118 (white solid, 52.2 mg, yield 66.8%): 1 H NMR(300MHz,DMSO-d6)δ7.85(d,J=8.7Hz,2H),7.75(d,J=8.7Hz,2H),7.12(d,J=8.4Hz,2H),6.94(s,2H),6.83(d,J=8.5Hz,2H),4.61(s,2H),4.52(s,2H),3.96(s,1H),3.89(s,2H),3.46(t,J=6.9Hz,2H),3.22(s,3H),2.97–2.88(m,1H),2.83(d,J=8.2Hz,1H),2.74–2.63(m,3H),2.15(s,6H),1.29(s,6H),1.07(d,J=6.0Hz,6H).
[0621] Example 119
[0622] Bisoprolol salt of 2-(4-((2,5-dioxo-3-(4-(trifluoromethyl)phenyl))imidazolin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 119)
[0623]
[0624] Referring to the method of Example 111, replace the tromethamine in Example 111 with carvedilol to obtain Compound 119 (white solid, 72.4 mg, yield 85.8%): 1 H NMR (300 MHz, DMSO-d6) δ 7.85 (d, J = 8.6 Hz, 2H), 7.75 (d, J = 8.6 Hz, 2H), 7.22 (d, J = 8.1 Hz, 2H), 6.94 (s, 2H), 6.90 (d, J = 8.4 Hz, 2H), 4.61 (s, 2H), 4.52 (s, 2H), 4.39 (s, 2H), 3.96 (s, 1H), 3.92 (s, 2H), 3.52 (d, J = 6.0 Hz, 1H), 3.47 (s, 4H), 2.93 (d, J = 6.2 Hz, 1H), 2.87–2.59 (m, 2H), 2.15 (s, 6H), 1.30 (s, 6H), 1.06 (d, J = 5.5 Hz, 12H).
[0625] Example 120
[0626] Carvedilol salt of 2-(4-(2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 120)
[0627]
[0628] Referring to the method of Example 111, replace the tromethamine in Example 111 with carvedilol to obtain Compound 120 (white solid, 59.8 mg, yield 64.2%): 11H NMR (300 MHz, DMSO-d6) δ 11.23 (s, 1H), 8.21 (d, J = 7.8 Hz, 1H), 7.85 (d, J = 8.5 Hz, 2H), 7.76 (d, J = 8.6 Hz, 2H), 7.43 (d, J = 7.8 Hz, 1H), 7.30 (dd, J = 19.6, 7.6 Hz, 2H), 7.12 (d, J = 7.4 Hz, 1H), 7.06 (d, J = 8.0 Hz, 1H), 6.95 (d, J = 10.7 Hz, 2H), 6.93 (s, 2H), 6.91–6.80 (m, 2H), 6.67 (d, J = 7.8 Hz, 1H), 4.61 (s, 2H), 4.53 (s, 2H), 4.15 (s, 2H), 4.13 (s, 1H), 4.03 (t, J = 5.5 Hz, 2H), 3.72 (s, 3H), 3.02–2.92 (m, 3H), 2.85 (dd, J = 11.9, 5.9 Hz, 1H), 2.14 (s, 6H), 1.33 (s, 6H).
[0629] Example 121
[0630] Labetalol salt of 2-(4-(2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 121)
[0631]
[0632] Referring to the method of Example 111, the tromethamine in Example 111 was replaced with labetalol to obtain Compound 121 (white solid, 69.1 mg, yield 81.6%): 1 1H NMR (300 MHz, DMSO-d6) δ 8.40 (s, 1H), 7.85 (d, J = 9.1 Hz, 4H), 7.75 (d, J = 8.4 Hz, 2H), 7.40 (d, J = 8.2 Hz, 1H), 7.24 (d, J = 6.5 Hz, 2H), 7.16 (d, J = 7.0 Hz, 4H), 6.95 (s, 2H), 6.84 (d, J = 8.4 Hz, 1H), 4.61 (s, 2H), 4.58 (s, 1H), 4.52 (s, 2H), 2.73 (s, 2H), 2.59 (s, 2H), 2.14 (s, 6H), 1.67 (d, J = 55.4 Hz, 2H), 1.31 (s, 6H), 1.08 (d, 3H).
[0633] Example 122
[0634] Diisopropylamine salt of 2-(4-(2,5-dioxo-3-(4-(trifluoromethyl)phenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 122)
[0635]
[0636] Referring to the method of Example 111, replacing the tromethamine in Example 111 with diisopropylamine, Compound 122 (white solid, 61.3 mg, yield 63.8%) was prepared: 1 H NMR (300 MHz, DMSO-d6) δ 7.86 (d, J = 8.8 Hz, 2H), 7.77 (d, J = 8.8 Hz, 2H), 6.94 (s, 2H), 4.63 (s, 2H), 4.53 (s, 2H), 3.11 (dt, J = 12.8, 6.5 Hz, 2H), 1.28 (s, 6H), 1.12 (s, 6H), 1.10 (s, 6H).
[0637] Example 123
[0638] Berberine salt of 2-(4,5-dioxo-3-(4-(trifluoromethylphenyl)imidazolidin-1-yl)methyl)-2,6-dimethylphenoxy)-2-methylpropanoic acid (Compound 123)
[0639]
[0640] Referring to the method of Example 111, replacing the tromethamine in Example 111 with berberine, Compound 123 (white solid, 20.3 mg, yield 4.9%) was prepared: 1 H NMR (300 MHz, DMSO-d6) δ 9.90 (s, 1H), 8.95 (s, 1H), 8.21 (d, J = 9.3 Hz, 1H), 8.01 (d, J = 9.1 Hz, 1H), 7.86 (d, J = 8.8 Hz, 2H), 7.81 (s, 1H), 7.77 (d, J = 8.7 Hz, 2H), 7.10 (s, 1H), 6.90 (s, 2H), 6.18 (s, 2H), 4.94 (t, 21H), 4.63 (s, 2H), 4.51 (s, 2H), 4.10 (s, 3H), 4.08 (s, 3H), 3.21 (t, 2H), 2.17 (s, 6H), 1.22 (s, 6H).
[0641] Example 124
[0642] Testing of the PPARα / PPARδ / PPARγ agonist activity of the compound using the GAL4 hybrid reporter gene method
[0643] In a 10-cm cell culture dish, Cos-7 cells (African green monkey kidney fibroblasts, commonly used tool cells) were cultured in DMEM complete medium containing 10% fetal bovine serum. When the cell density reached about 70%, transfection was prepared. First, a plasmid transfection working solution was prepared as follows: 15 μg of pGL4.35-9×Gal4 UAS plasmid (purchased from Promega Biotechnology Co., Ltd., Beijing) and 15 μg of pBIND-Gal4-PPARα(LBD) plasmid or pBIND-Gal4-PPARδ(LBD) plasmid or pBIND-Gal4-PPARγ(LBD) plasmid (J. Chem. Inf. Model., 2020, 60, 1717) and 60 μL of transfection reagent (HighGene, purchased from Wuhan ABclonal Technology Co., Ltd.) were added to 2 mL of Opti-MEM and left at room temperature for 15 minutes to obtain the plasmid transfection working solution. Subsequently, the above working solution was combined with 8 mL of DMEM complete medium and added to the cell culture dish for cell transfection. After 4 hours of transfection, the cells were digested and resuspended, and seeded into a 96-well plate at 25,000 cells per well. After adherent culture for 24 hours, the test compound and positive drug prepared at an appropriate test concentration in complete medium were added to the 96-well plate. In the test, the PPARα agonist activity of GW7647 (purchased from MCE) at a final concentration of 10 nM was 100%, the PPARδ agonist activity of GW501516 (purchased from MCE) at a final concentration of 10 nM was 100%, and the PPARγ agonist activity of Rosiglitazone (purchased from Adamas) at a final concentration of 1 μM was 100%. After 16 hours of drug action, the medium was removed, 100 μL of reporter gene lysis buffer (purchased from Beyotime Biotechnology Co., Ltd., Shanghai) was added, and the cells were lysed by shaking for 15 minutes. Then 10 μL of the lysate was taken and added to a white opaque 384-well plate, and then 10 μL of reporter gene detection solution (purchased from Beyotime Biotechnology Co., Ltd., Shanghai) was added. After mixing and reacting, the bioluminescence was detected using a multi-functional microplate reader, and the corresponding half-maximal effective concentration (EC 50 ) value was calculated according to the detected value. In this experiment, the PPARα / δ agonist GFT505 in phase III clinical trial and the potent PPARα / δ agonists 5c (ACS Med. Chem. Lett., 2019, 10, 1068) and H11 (Journal of Medicinal Chemistry 2022, 65, 2571-2592) reported in the literature were used as positive control compounds. The experimental results are shown in Table 2.
[0644] Table 2. Agonist activities of compounds against PPARα / PPARδ / PPARγ
[0645]
[0646]
[0647]
[0648] The experimental results (Table 2) show that the compounds of the present invention have significant PPARs agonist activities. For example, compounds 1, 3, 29, 33, 41, 43, 45, 61, 75, 101, etc. have EC 50 values for PPARα and PPARδ agonist activities all reaching the low nanomolar level. In particular, for compound 1 (PPARα: EC 50 = 0.7 nM; PPARδ: EC 50 = 0.4 nM), the EC 50 values for PPARα and PPARδ agonist activities are both at the picomolar level, and it has very good selectivity for PPARγ (selectivity exceeding 2000-fold). The above results suggest that the compounds of the present invention are potent and highly selective PPARα / PPARδ dual agonists.
[0649] Example 125
[0650] Evaluation of the metabolic stability of the compound in human liver microsomes
[0651] Prepare an acetonitrile solution of the compound at a concentration of 500 μM, and dilute it with 0.1 M potassium phosphate solution to a drug working solution of 1.5 μM. Then co-incubate the drug working solution with a human liver microsome working solution at a final concentration of 0.75 mg / mL and an NADPH solution (final concentration of 550 μM). Add acetonitrile solution to terminate the incubation at 0, 15, 30, 45, and 60 min respectively. Detect the remaining amount of the remaining compound in the system at each time point by LC / MS. Measure the absolute value k of the slope by plotting the natural logarithm of the percentage of the remaining compound amount against time, and calculate according to the formula: T 1 / 2 (half-life) = ln2 / k = 0.693 / k. The experimental results are shown in Table 3.
[0652] Table 3. Results of the metabolic stability of the compound in human liver microsomes
[0653] Compound Number <![CDATA[T 1 / 2 (min)]]> <![CDATA[C lint (mL / min / kg)]]> 1 >120 6.2 GFT505 15 116.4
[0654] The experimental results (Table 3) show that compound 1 has very good metabolic stability in human liver microsomes, and its metabolic stability in human liver microsomes is much better than that of GFT505 under the same test conditions. Other compounds of the present invention also have good metabolic stability in human liver microsomes.
[0655] Example 126
[0656] Pharmacokinetic Evaluation of Compound 1 in Rats
[0657] Animals: Six male SD rats, SPF grade, sourced from Beijing Vital River Laboratory Animal Technology Co., Ltd.
[0658] Grouping: The rats were divided into 2 groups, with 3 rats in each group. One group was the oral administration group, and the other was the intravenous injection group. The dosage for oral administration was 10 mpk, and the dosage for intravenous injection was 2 mpk.
[0659] Experimental method: After intravenous injection in the intravenous injection group, approximately 0.25 mL of blood was collected from the orbital cavity at 0.083, 0.25, 0.5, 1, 2, 4, 6, 8, and 24 hours. After blood collection, sodium heparin was quickly added for anticoagulation, and the blood samples were placed on ice. Rats in the oral administration group were fasted for 12 hours before administration and fed 4 hours after administration; after oral administration, approximately 0.25 mL of blood was collected from the orbital cavity at 0.083, 0.25, 0.5, 1, 2, 4, 6, 8, and 24 hours. After blood collection, sodium heparin was quickly added for anticoagulation, and the blood samples were placed on ice. All samples were centrifuged at 6000 r / min for 3 minutes in a low-temperature centrifuge to separate plasma. The content of the compound in the plasma was detected by LC-MS / MS-18, and relevant pharmacokinetic parameters were calculated based on the blood drug concentration data at different time points. The experimental results are shown in Table 4.
[0660] Table 4. Pharmacokinetic Parameters of Compound 1 in Rats after Intravenous Injection and Oral Administration
[0661]
[0662] The experimental results (Table 4) show that the oral half-life of Compound 1 is 6.72 ± 1.39 hours, and the bioavailability of the compound is 104.70 ± 0.17%, indicating that Compound 1 has good pharmacokinetic properties. Other compounds of the present invention also have good in vivo pharmacokinetic properties.
[0663] Example 127
[0664] Compound 1 has a high selectivity for PPARα / δ
[0665] The GAL4 hybrid reporter gene method was used to test the agonist effect of Compound 1 on common nuclear receptors.
[0666] According to the method in the reference (Journal of Medicinal Chemistry 2022, 65, 2571 - 2592), reporter gene plasmids of different nuclear receptors were constructed. Transfection working solutions of different nuclear receptors were prepared and added to COS-7 cells. The preparation method of the transfection working solution was as follows: The constructed pBIND-Gal4-PPARα(LBD) (or pBIND-Gal4-PPARδ(LBD) plasmid or pBIND-Gal4-PPARγ(LBD) plasmid or pBIND-Gal4-RARα(LBD) plasmid or pBIND-Gal4-RARγ(LBD) plasmid or pBIND-Gal4-RARβ(LBD) plasmid or pBIND-Gal4-RORα(LBD) plasmid or pBIND-Gal4-RORγ(LBD) plasmid or pBIND-Gal4-RORβ(LBD) plasmid or pBIND-Gal4-FXR(LBD) plasmid pBIND-Gal4-RXRα(LBD) plasmid or pBIND-Gal4-RXRγ(LBD) plasmid or pBIND-Gal4-RXRβ(LBD) plasmid or pBIND-Gal4-VDR(LBD) plasmid or pBIND-Gal4-LXRα(LBD) plasmid or pBIND-Gal4-LXRβ(LBD) plasmid or pBIND-Gal4-THβ(LBD) plasmid or pBIND-Gal4-PXR(LBD) plasmid or pBIND-Gal4-CAR(LBD) plasmid), 15 μg of pGL4.35-9×Gal4 UAS plasmid (purchased from Beijing Promega Biotechnology Co., Ltd.), and 60 μL of transfection reagent (HighGene, purchased from Wuhan Aibotech Co., Ltd.) were added to 2 mL of Opti-MEM and allowed to stand at room temperature for 15 minutes to obtain the working solution. The agonistic effects of test compound 1 on various nuclear receptors at a concentration of 1 μM were tested.
[0667] The experimental results (Table 5) showed that compound 1 had no obvious agonistic effect on non-PPARs nuclear receptors at a concentration of 1 μM, and the agonistic effect on PPARγ was also weak. Therefore, it was considered that compound 1 had a high selectivity for the nuclear receptors PPARα / δ. Other compounds of the present invention also had similar effects.
[0668] Table 5. Agonistic multiples of compound 1 on common nuclear receptors
[0669]
[0670]
[0671] Example 128
[0672] Compound 1 can effectively activate the expression of PPARα / δ downstream target genes in mouse liver and skeletal muscle
[0673] C57 mice were divided into a control group, a low-dose group (0.03 mg / kg), and a high-dose group (0.1 mg / kg), with 6 mice in each group. Mice in each group were given Compound 1 or a solvent control of the same volume according to the dose, and were continuously gavaged for three days. After the third day of administration, the mice were euthanized and dissected for sampling. The liver and skeletal muscle were quickly frozen in liquid nitrogen for subsequent experiments. After extracting the RNA of the liver and skeletal muscle, the upregulation fold of the expression of PPARα / δ downstream target genes was detected. It was found (Table 6) that Pdk4, Acox1, Vlcad, and Angptl4 were significantly upregulated in the liver, and Pdk4 and Angptl4 were significantly upregulated in the skeletal muscle, and there was a certain dose-dependence. This suggests that Compound 1 can play a role in dual activation of PPARα / δ in mice. Some other compounds of the present invention also have similar effects.
[0674] Table 6. Upregulation fold of the expression of PPARα / δ downstream target genes in mouse liver and skeletal muscle by Compound 1
[0675] Gene Up - regulation Fold at 0.03 mg / kg Dose Up - regulation Fold at 0.1 mg / kg Dose Liver Pdk4 62.9±7.7 282.8±28.8 Liver Acox1 3.1±0.4 5.0±0.4 Liver Vlcad 1.6±0.2 2.5±0.1 Liver Angptl4 2.1±0.2 2.6±0.2 Skeletal Muscle Pdk4 1.1±0.1 2.8±0.3 Skeletal Muscle Angptl4 1.4±0.2 5.3±0.6
[0676] Example 129
[0677] Compound 1 can effectively reduce the level of serum triglyceride in mice
[0678] Animals: 48 male C57 mice, SPF grade, 8 weeks old, weighing about 20 g, purchased from Vital River Laboratories (Beijing). All animals maintained a 12-hour alternating day-night rhythm and had free access to food and water.
[0679] Instruments: Animal weighing scale; Automatic biochemical analyzer
[0680] Reagents: Compound 1, positive drug GFT505 (a dual agonist of PPARα / δ, currently in phase III clinical trials for anti-NASH, preparation method referred to CN100548960C), positive drug fenofibrate (a PPARα agonist, a drug clinically used to treat hypertriglyceridemia, purchased from Aladdin Reagents), and positive drug pemafibrate (a PPARα agonist, a drug used to treat hypertriglyceridemia and marketed in Japan, preparation method referred to Bioorg. Med. Chem. Lett., 2007, 17).
[0681] Experimental procedure
[0682] 1. Animal grouping and administration
[0683] After 1 week of adaptive feeding of the mice, they were divided into 5 groups according to their body weight: control group, positive drug fenofibrate (30 mg / kg) group, positive drug pemafibrate (1 mg / kg) group, positive drug GFT505 (1 mg / kg) group, and compound 1 (1 mg / kg) group. The control group was given the solvent control CMC-Na every day, and the drug-administered groups were given the corresponding drugs every day. They were continuously gavaged for 5 days, during which they had free access to water and food. The mice in each group were weighed daily, and their body weight, hair, feces, and activity were carefully observed and recorded.
[0684] 2. Sample collection
[0685] 2 hours after administration on the 5th day of drug administration, blood was collected from the orbital cavity of the mice, and then they were euthanized.
[0686] 3. Measurement of serum triglyceride
[0687] The whole blood was allowed to stand at room temperature for 2 hours, centrifuged at 3000 rpm for 15 minutes, and the serum was collected. The serum was sent to Google Biotechnology Co., Ltd. for determination of the triglyceride (TG) level in the automatic biochemical analyzer.
[0688] 4. Experimental results
[0689] Figure 1 The results showed that compound 1 could significantly reduce the triglyceride level in the serum of mice. It is worth noting that at the dose of 1 mg / kg, the triglyceride-lowering effect of compound 1 was significantly stronger than that of GFT505 and pemafibrate at the same dose, and was better than the commonly used clinical lipid-lowering drug fenofibrate. This suggests that compound 1 can be used for the prevention and treatment of metabolic diseases such as hypertriglyceridemia. Other compounds of the present invention also have similar effects.
[0690] Example 130
[0691] Compound 1 has an improving effect on α-naphthyl isothiocyanate-induced cholestasis in mice
[0692] Animals: 25 male C57 mice, SPF grade, 8 weeks old, weighing about 20 g, purchased from Beijing Vital River. All animals maintained a 12-hour alternating day-night rhythm and had free access to food and water.
[0693] Instruments: Animal weighing scale; Automatic biochemical analyzer; Inverted microscope; Microtome
[0694] Reagents: Compound 1, positive drug GFT505, α-naphthyl isothiocyanate (ANIT).
[0695] Experimental procedure
[0696] 1. Animal grouping and drug administration
[0697] After 1 week of adaptive feeding of the mice, they were divided into 5 groups according to their body weights: control group, model group, positive drug GFT505 (30 mg / kg) group, low-dose compound 1 (0.03 mg / kg) group, and high-dose compound 1 (0.1 mg / kg) group. The mice had normal diet and water intake.
[0698] The procedures for modeling and drug administration were as follows: 6 hours before modeling, the corresponding doses and types of compounds were intragastrically administered to the drug administration groups, and the control group and the model group were given the same volume of solvent control. At the time of modeling, except for the control group, each group was intragastrically administered 80 mg / kg of ANIT, and the control group was given the same volume of solvent control. Subsequently, drug administration continued for two days, once a day. The mice in each group were weighed daily, and their body weights, hair, feces, and activities were carefully observed and recorded.
[0699] 2. Sample collection
[0700] 48 hours after ANIT-induced modeling, blood was collected from the orbital cavities of the mice, and then they were euthanized and the livers were removed. The right lobule tissues of the livers were fixed with 4% paraformaldehyde for HE staining sections. The remaining liver tissues were snap-frozen in liquid nitrogen for subsequent detection of other indicators.
[0701] 3. Serological detection
[0702] The whole blood was allowed to stand at room temperature for 2 hours, centrifuged at 3000 rpm for 15 minutes, and the serum was collected. The levels of aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), total bilirubin (TBil), and total bile acid (TBA) in the serum were detected.
[0703] 4. Liver tissue sections
[0704] The fixed tissues were sent to Wuhan Sevier Biotechnology Co., Ltd. for the preparation of HE staining sections.
[0705] 5. Detection of alkaline phosphatase in the liver
[0706] It was tested using a tissue and blood alkaline phosphatase (AKP / ALP) activity detection kit (BC2145) purchased from Beijing Solarbio Science & Technology Co., Ltd. The liver tissues stored at -80 °C were taken out, placed in liquid nitrogen, and approximately 0.1 g of liver tissue was quickly cut and added to 1 mL of extraction solution for thorough grinding. After centrifugation at 4 °C and 10,000 rpm for 10 minutes, the supernatant was taken for testing. Detection was carried out according to the method in the product instruction manual. The data were corrected with the sample protein concentration, and one enzyme activity unit was defined as catalyzing the production of 1 μmol of phenol per minute per milligram of protein at 37 °C.
[0707] 6. Experimental results
[0708] Figure 2The results showed that compound 1 could effectively improve ANIT-induced intrahepatic cholestasis. The liver of the model group was yellow as a whole, with a large number of bleeding points and yellow crystalline substances, and the serum was brownish-yellow. After administration of compound 1, the livers of the mice returned to a red state, without obvious bleeding points, and the serum was light yellow. It is worth noting that at a dose of 0.03 mg / kg, the ability of compound 1 to improve the gross appearance of the liver and the serum color was comparable to that of 30 mg / kg of GFT505.
[0709] Figure 3 The results of serological tests in mice are shown in the figure. Compound 1 could significantly down-regulate the levels of serum ALT, AST, TBil and TBA in ANIT-induced cholestasis model mice in a dose-dependent manner. There was also a certain downward trend in serum ALP. It is worth noting that at a dose of 0.1 mg / kg, the effect of compound 1 in reducing liver enzymes, total bilirubin and total bile acids was comparable to that of 30 mg / kg of GFT505, indicating that compound 1 could effectively reduce cholestasis and had a strong hepatoprotective effect.
[0710] Figure 4 Detection of ALP levels in the livers of mice. Since the increase multiple of serum ALP was small in the ANIT model, the levels of ALP in liver tissues were also detected. As Figure 4 shown, compound 1 could significantly down-regulate the levels of ALP in the liver. It is worth noting that at both doses, the effect of compound 1 in reducing ALP in the liver was slightly better than that of 30 mg / kg of GFT505.
[0711] In addition, the anti-cholestatic effect of compound 1 was evaluated by pathological research methods. As shown by HE staining ( Figure 5 ), compound 1 could dose-dependently reduce the number and area of necrotic areas in the liver, suggesting that compound 1 had an excellent effect in resisting liver injury.
[0712] In summary, compound 1 had a strong therapeutic effect on the mouse cholestasis model, suggesting that compound 1 had a therapeutic effect on cholestatic liver diseases and could be used to prepare drugs for the prevention and treatment of cholestatic liver diseases such as primary biliary cholangitis (PBC) and primary sclerosing cholangitis (PSC). Other compounds of the present invention also had similar effects.
[0713] Example 131
[0714] Compound 1 had an improvement effect on high-fat combined with choline-deficient and methionine-restricted diet (HF-CDAA)-induced non-alcoholic steatohepatitis (NASH) in mice
[0715] Animals: 24 male C57 mice, SPF grade, 8 weeks old, weighing about 20 g, purchased from Vital River Laboratories (Beijing). All animals maintained a 12-hour alternating day-night rhythm and had free access to food and water.
[0716] Instruments: Animal weighing scale; Slicer; Automatic biochemical analyzer; Inverted microscope
[0717] Reagents: Compound 1, positive drug GFT505; Control feed was purchased from Nantong TROPHY (TP36225MCS); Model-making feed was purchased from Nantong TROPHY (TP36225 MCD).
[0718] Experimental procedure:
[0719] 1. Animal grouping and model-making
[0720] After 1 week of adaptive feeding, the mice were randomly divided into 4 groups according to body weight: control group, model group, positive drug GFT505 (10 mg / kg) group, and compound 1 (0.1 mg / kg) group. The control group was fed with control feed (TP36225 MCS); The other groups were given model-making feed (TP36225 MCD). All mice had free access to water. The model was made for 6 weeks.
[0721] 2. Drug administration
[0722] After 4 weeks of model-making, the positive drug GFT505 group was given GFT505 10 mg / kg by gavage daily, the compound 1 group was given compound 1 0.1 mg / kg by gavage daily, and the control group and the model group were given the same volume of control solvent by gavage daily. Drug administration lasted for 2 weeks. During this period, the control group was given control feed, and the other groups were given model-making feed. All mice had free access to water. The body weight of each group of mice was measured daily, and their body weight, hair, feces, and activity were carefully observed and recorded.
[0723] 3. Sample collection
[0724] After 2 weeks of drug administration, the mice were fasted for 6 hours with free access to water, then blood was collected from the orbital sinus, and the mice were sacrificed by euthanasia to obtain the liver. The right lobule tissue of the liver was fixed with 4% paraformaldehyde for HE and oil red staining. The remaining liver tissue was divided into 2 parts, snap-frozen in liquid nitrogen for subsequent detection of other indicators.
[0725] 4. Determination of biochemical indicators
[0726] The whole blood was allowed to stand at room temperature for 2 hours, centrifuged at 3000 rpm for 15 minutes, and the serum was collected. The levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) in the serum were measured using an automatic biochemical analyzer.
[0727] 5. Liver tissue sectioning
[0728] Send the fixed and completed tissues to Wuhan Sevier Biotechnology Co., Ltd. for making HE staining sections, Sirius red staining sections, and oil red staining sections.
[0729] 6. Extraction of liver tissue RNA and q-PCR detection
[0730] Take out the liver tissue stored at -80°C, place it in liquid nitrogen, quickly cut about 10 mg of liver tissue, add about 500 μL of pre-cooled RNA extraction reagent (R401-01 of Nanjing Novoprotein Scientific Co., Ltd.), and homogenize with a tissue homogenizer. Refer to the method in the product manual to extract precipitated RNA. Dissolve the solid RNA with an appropriate amount of DEPC-treated water. Use NanoDrop to quantify the RNA concentration, and add the reverse transcription reagent of Novoprotein according to the manual. Use a common PCR instrument to reverse transcribe mRNA into cDNA. Finally, add the upstream and downstream primers of the target gene, q-PCR reagent (SYBR Green), and cDNA to a q-PCR specific 96-well plate, and use a q-PCR instrument for amplification and quantification. Select the ΔΔCt value to characterize the difference in gene expression, and use relevant software for data processing and statistical testing.
[0731] 7. Extraction and detection of triglycerides in liver tissue
[0732] Take out the liver tissue stored at -80°C, place it in liquid nitrogen, quickly cut about 10 mg of liver tissue, add 300 μL of methanol, and homogenize and lyse. Then add 600 μL of chloroform, shake overnight at room temperature to extract the lipophilic substances in the tissue. Centrifuge at 6000 rpm for 10 minutes and collect the supernatant. Test according to the triglyceride detection kit (290-63701) of WAKO Company, Japan, and finally correct the result to milligrams of triglyceride per gram of liver tissue.
[0733] 8. Experimental results
[0734] Figure 6 The results show that at a dose of 0.1 mg / kg, compound 1 downregulates the serum ALT and AST levels in NASH model mice. It is worth noting that the liver enzyme-lowering effect of compound 1 at 0.1 mg / kg is slightly better than that of GFT505 at 10 mg / kg, indicating that compound 1 has extremely strong liver protection effects in the NASH model.
[0735] By means of pathological research, the anti-NASH effect of compound 1 was observed. The results of HE staining ( Figure 7 ) showed that compound 1 could reduce the inflammatory infiltration in the hepatic lobules of mice. The results of Sirius red staining ( Figure 8 ) showed that compound 1 could reduce the collagen deposition in the livers of mice. The results of oil red staining ( Figure 9)It was shown that Compound 1 could reduce the number and area of lipid droplets in the livers of mice. Notably, Compound 1 at a dose of 0.1 mg / kg had a better effect on reducing lipid accumulation than GFT505 at 10 mg / kg.
[0736] Figure 10 This was for the detection of the triglyceride content in the livers of mice. The results showed that Compound 1 could reduce the accumulation of triglycerides in the liver tissue induced by HF-CDAA modeling. Notably, Compound 1 at a dose of 0.1 mg / kg had a better effect on reducing hepatic triglycerides than GFT505 at 10 mg / kg.
[0737] To further detect the effect of Compound 1 on reducing liver inflammation and fibrosis in NASH model mice, the mRNA expression levels of related inflammatory factors and fibrosis-related cytokines in liver tissues were measured (the primer sequences of the genes are shown in Table 7). The experimental results are shown in Figure 11 and Figure 12 .
[0738] Table 7. Primer sequences of genes
[0739] Primer Name Primer Sequence Mus_Tnf_Forward Primer CCCTCACACTCAGATCATCTTCT Mus_Tnf_Reverse Primer GCTACGACGTGGGCTACAG Mus_Ccl2_Forward Primer TTAAAAACCTGGATCGGAACCAA Mus_Ccl2_Reverse Primer GCATTAGCTTCAGATTTACGGGT Mus_Ccl5_Forward Primer GCTGCTTTGCCTACCTCTCC Mus_Ccl5_Reverse Primer TCGAGTGACAAACACGACTGC Mus_Cd11b_Forward Primer ATGGACGCTGATGGCAATACC Mus_Cd11b_Reverse Primer TCCCCATTCACGTCTCCCA Mus_Acta2_Forward Primer GTCCCAGACATCAGGGAGTAA Mus_Acta2_Reverse Primer TCGGATACTTCAGCGTCAGGA Mus_tgfb1_Forward Primer CTCCCGTGGCTTCTAGTGC Mus_tgfb1_Reverse Primer GCCTTAGTTTGGACAGGATCTG Mus_Col1a1_Forward Primer GCTCCTCTTAGGGGCCACT Mus_Col1a1_Reverse Primer CCACGTCTCACCATTGGGG Mus_Col3a1_Forward Primer CTGTAACATGGAAACTGGGGAAA Mus_Col3a1_Reverse Primer CCATAGCTGAACTGAAAACCACC
[0740] Figure 11 The results showed that Compound 1 could inhibit the increase in the mRNA expression levels of Tnf, Ccl2, Ccl5, and Cd11b induced by HF-CDAA, indicating that Compound 1 had a potent anti-inflammatory effect in the NASH model. Figure 12 The results showed that Compound 1 could inhibit the increase in the mRNA expression levels of Acta2, Tgfb1, Col1a1, and Col3a1 induced by HF-CDAA, indicating that Compound 1 had an anti-fibrotic effect in the NASH model.
[0741] The above results indicated that Compound 1 could significantly improve the pathological state of NASH mice at a dose of 0.1 mg / kg, reduce liver enzyme levels, inhibit the occurrence and development of liver inflammation and fibrosis, and had an equivalent efficacy to GFT505 at 10 mg / kg. In terms of reducing liver lipid accumulation, the effect of Compound 1 at 0.1 mg / kg was better than that of GFT505 at 10 mg / kg. It was suggested that Compound 1 had a therapeutic effect on fatty liver diseases such as NASH and could be used to prepare drugs for the prevention and treatment of chronic liver diseases such as non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), metabolic associated fatty liver disease (MAFLD), and alcoholic fatty liver disease (ALD). Other compounds of the present invention also had similar effects.
[0742] Example 132
[0743] Compound 1 has an ameliorating effect on carbon tetrachloride-induced liver fibrosis in mice
[0744] Animals: 30 male C57 mice, SPF grade, 8 weeks old, weighing approximately 20 g, purchased from Vital River Laboratories (Beijing). All animals maintained a 12-hour alternating day-night rhythm and had free access to food and water.
[0745] Instruments: Animal weighing scale; microtome; automatic biochemical analyzer; inverted microscope
[0746] Reagents: Compound 1, positive drug GFT505; carbon tetrachloride (purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.), sunflower oil (purchased from Shanghai Yuanye Bio-Technology Co., Ltd.).
[0747] Experimental procedure:
[0748] 1. Animal grouping and model establishment
[0749] After 1 week of adaptive feeding, the mice were randomly divided into 5 groups according to body weight: control group (Oil), model group (CCl4), positive drug GFT505 (10 mg / kg) group (CCl4+GFT505), compound 1 low-dose (0.03 mg / kg) group (CCl4+1lowdose), and compound 1 high-dose (0.1 mg / kg) group (CCl4+1high dose). The mice were fed normal diet and water, and the model was established for 3 weeks. The model group and each drug administration group were injected with a 25% carbon tetrachloride oil solution twice a week at a dose of 2 mL / kg, and the control group was injected with an equal volume of oil solvent.
[0750] 2. Drug administration
[0751] Drug administration started simultaneously with model establishment. The CCl4+GFT505 group was given GFT505 (10 mg / kg) by gavage daily; the CCl4+1lowdose group was given compound 1 (0.03 mg / kg) by gavage daily; the CCl4+1high dose group was given compound 1 (0.1 mg / kg) by gavage daily; the control group and the model group were given an equal volume of control solvent by gavage daily. Drug administration lasted for 3 weeks, and the mice were fed normal diet and water. The mice in each group were weighed daily, and their body weight, hair, feces, and activity were carefully observed and recorded.
[0752] 3. Sample collection
[0753] Twenty-four hours after the sixth injection of carbon tetrachloride, dissection and sample collection were performed. Blood was collected from the orbital cavity, and the mice were sacrificed by euthanasia to obtain the liver. The right lobule tissue of the liver was fixed with 4% paraformaldehyde for HE and Sirius red staining sections. Part of the liver tissue was divided into 3 parts, snap-frozen in liquid nitrogen for subsequent detection of other indicators.
[0754] 4. Liver tissue section
[0755] The preprocessed tissues were sent to Wuhan Sevier Biotechnology Co., Ltd. for making HE staining sections and Sirius red staining sections.
[0756] 5. Detection of hydroxyproline in liver tissues.
[0757] The liver tissues stored at -80 °C were taken out, placed in liquid nitrogen, and approximately 200 mg of liver tissues were quickly cut. The hydroxyproline in the liver tissues was detected according to the method in the product instruction manual (Beijing Solarbio Science & Technology Co., Ltd., BC0255).
[0758] 6. Experimental results
[0759] Figure 13 The results showed that carbon tetrachloride-induced modeling could significantly increase the hydroxyproline content in the liver, while administration of Compound 1 could dose-dependently reduce the hydroxyproline content in the liver of model mice, and the effect of Compound 1 at the dose of 0.1 mg / kg was better than that of GFT505 at 30 mg / kg.
[0760] Through pathological research methods, the anti-hepatic fibrosis effect of Compound 1 was observed. The results of HE staining ( Figure 14 ) showed that Compound 1 could reduce the inflammatory infiltration in the liver of mice. The results of Sirius red staining ( Figure 15 ) showed that Compound 1 could significantly reduce the collagen deposition in the liver of mice. It should be noted that the improvement effect of Compound 1 at the dose of 0.1 mg / kg on collagen deposition in the liver of mice was better than that of GFT505 at 10 mg / kg.
[0761] In summary, Compound 1 has a protective effect on the hepatic fibrosis mouse model, suggesting that Compound 1 has a therapeutic effect on hepatic fibrosis-related diseases and can be used to prepare drugs for the prevention and treatment of hepatic fibrosis-related diseases and cirrhosis and other diseases. Other compounds of the present invention also have similar effects.
[0762] Example 133
[0763] Co-crystal structure of the complex of Compound 1 and PPARδ protein
[0764] The plasmid expressing the protein containing the PPARδ-LBD region (Reference: Journal of Medicinal Chemistry 2022, 65, 2571-2592) was transformed into Escherichia coli BL21. After culturing and amplification, IPTG was added at 4 °C to induce protein expression. After lysing Escherichia coli, the supernatant was collected and purified via a nickel column. The purified protein was dissolved in a solution of 20 mM Tris, pH 8.0, 150 mM NaCl and 10% glycerol. A DMSO solution of compound 1 with a final concentration of 2 mM was added to the protein solution with a concentration of 7 mg / mL. The co-crystal of compound 1 and PPARδ protein grew at 16 °C, and the crystallization solvent was a mixed solvent of 0.5 M sodium citrate, pH 5.5, 19% PEG3350 and 20% glycerol. The crystal was quickly frozen in liquid nitrogen and used for data collection. With the help of the X-ray crystallography facility platform of the National Facility for Protein Research (Tsinghua University), X-ray diffraction data were collected on the beamline BL02U of the Shanghai Synchrotron Radiation Facility. The data were processed with HKL2000 and solved by molecular replacement using the Phenix program, and the search model was the PDB code 3SP9. Modeling and refinement were performed using the coot software and the PHENIX software. The experimental results are as Figure 16 shown. The results showed that the binding mode of compound 1 to the PPARδ protein was similar to that of the endogenous ligand fatty acid, and there were hydrogen bond interactions between the carboxylic acid part of compound 1 and His323, His449 and Tyr473 of the protein. Different from other small molecule ligands, the hydantoin ring part of compound 1 could form hydrogen bond interactions with Cys285, Thr289 and Thr292 of the PPARδ protein respectively through multiple "water molecule bridges". This special interaction between the agonist and the PPARδ protein might be an important reason for the potent agonist activity and high selectivity of compound 1.
[0765] Example 134
[0766] Tablet
[0767] Compound 1 (50 g) prepared in Example 1, hydroxypropyl methylcellulose E (150 g), starch (200 g), an appropriate amount of polyvinylpyrrolidone K30 and magnesium stearate (1 g) were mixed, granulated and tabletted. In addition, according to the conventional preparation method in the 2015 edition of the Pharmacopoeia, the compounds prepared in Examples 1 to 123 can be formulated into capsules, powders, granules, pills, injections, syrups, oral liquids, inhalants, ointments, suppositories or patches, etc. with different pharmaceutical excipients.
Claims
1. A hydantoin compound represented by formula (I) or a pharmaceutically acceptable salt thereof: A is selected from: R 1 Selected from: H or a straight-chain or branched alkyl group having 1 to 6 carbon atoms; R 2 and R 3 each independently selected from: H or a straight-chain or branched-chain alkyl group having 1 to 4 carbon atoms; R 4 、R 5 、R 6 and R 7 each independently selected from: H, halogen, OR 18 、hydroxyl, a straight-chain or branched alkyl having 1 to 4 carbons, trifluoromethyl, or trifluoromethoxy R 18 Selected from: straight-chain or branched-chain alkyl groups having 1 to 4 carbon atoms; X is selected from: CH2; m is selected from: any integer from 0 to 4; n is selected from: any integer from 0 to 2; R 8 and R 9 each independently selected from: H; R 10 and R 11 are each independently selected from: H, halogen, cyano, a straight-chain or branched alkyl group having 1 to 4 carbons, trifluoromethyl, methylthio, trifluoromethoxy, trifluoromethylthio, methylsulfonyl, ethylsulfonyl, a straight-chain or branched alkoxy group having 1 to 4 carbons, a cycloalkyloxy group having 3 to 6 carbons, a cycloalkyl group having 3 to 6 carbons or phenyl; R 12 and R 13 are each independently selected from: H, or a straight-chain or branched alkyl group having 1 to 4 carbons.
2. The hydantoin compound or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that A is selected from: R 1 selected from: H or a straight-chain or branched alkyl group having 1 to 4 carbon atoms; R 2 and R 3 are each independently selected from: H or a straight-chain or branched-chain alkyl group having 1 to 4 carbon atoms; R 4 、R 5 、R 6 and R 7 are each independently selected from: H, halogen, trifluoromethyl, trifluoromethoxy, OR 18 、a straight-chain or branched-chain alkyl having 1 to 4 carbons; R 18 Selected from: straight-chain or branched-chain alkyl groups having 1 to 4 carbon atoms; X is selected from: CH2; m is selected from: any integer from 0 to 2; n is selected from: 0 or 1; R 8 and R 9 each independently selected from: H; R 10 and R 11 are independently selected from: H, halogen, cyano, straight-chain or branched alkyl having 1 to 4 carbons, trifluoromethyl, methylthio, trifluoromethoxy, trifluoromethylthio, methylsulfonyl, ethylsulfonyl, straight-chain or branched alkoxy having 1 to 4 carbons, cycloalkyloxy having 3 to 6 carbons, cycloalkyl having 3 to 6 carbons or phenyl; R 12 and R 13 each independently selected from: H, or a straight-chain or branched-chain alkyl group having 1 to 4 carbon atoms.
3. A hydantoin compound or a pharmaceutically acceptable salt thereof, characterized in that, The compound or a pharmaceutically acceptable salt thereof is any one of the following compounds:
4. Use of a hydantoin compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 - 3 in the preparation of a dual PPARα / δ agonist.
5. Use of a hydantoin compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 - 3 in the preparation of a drug for preventing or treating a disease mediated by PPARα and / or PPARδ.
6. The use according to claim 5, characterized in that, The disease mediated by PPARα and / or PPARδ is selected from metabolic diseases, cardiovascular and cerebrovascular diseases, inflammatory diseases, autoimmune diseases, organ fibrosis diseases, neurodegenerative diseases, secondary diseases caused by pathogen infections, mitochondrial dysfunction and disorder diseases, or tumors.
7. A salt of a hydantoin compound, characterized in that, The salt of the hydantoin compound is selected from salts formed by a hydantoin compound according to any one of claims 1 - 3 and a metal ion, or a pharmaceutically acceptable amine or ammonium ion.
8. A pharmaceutical composition for preventing or treating a disease mediated by PPARα and / or PPARδ, which contains a hydantoin compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 - 3 as an active ingredient and a pharmaceutically acceptable carrier.
9. The pharmaceutical composition according to claim 8, wherein The pharmaceutical composition is a capsule, powder, tablet, granule, pill, injection, syrup, oral liquid, inhalant, ointment, suppository or patch.
Citation Information
Patent Citations
Substituted 1,3-diphenylprop-2-en-1-one derivatives and preparation and uses thereof
CN100548960C