A kind of shellfish antimicrobial peptide A1-β and its application

Abstract

The present invention discloses a shellfish antimicrobial peptide A1-β, and the amino acid sequence of the shellfish antimicrobial peptide A1-β is specifically: Gly-Gly-Tyr-Cys-Gly-Gly-Trp-Phe-Arg-Leu-Lys-Cys-Lys-Gly-Ile. Verified by examples, the antimicrobial peptide A1-β of the present invention has strong antibacterial activity, low hemolytic activity, no cytotoxicity, high stability, and has good advantages and application prospects; the shellfish antimicrobial peptide A1-β has no cytotoxic effect on normal mammalian red blood cells. Compared with many known marine animal antimicrobial peptides, the shellfish antimicrobial peptide A1-β has good antibacterial effect and broad antibacterial spectrum, has great application value, and has good application in the development and preparation of antibacterial agents; the shellfish antimicrobial peptide A1-β is derived from aquatic bivalve shellfish, and can be used as a feed additive in aquaculture, or can be developed into antibacterial agents and antibacterial drugs, etc., so it has broad application prospects.

Description

Technical Field

[0001] The present invention belongs to the technical field of antimicrobial peptides, and particularly relates to a shellfish antimicrobial peptide A1-β and its application. Background Art

[0002] Mussels are widely distributed globally and are a type of bivalve shellfish with important economic value. Due to their filter-feeding characteristics, shellfish will accumulate a large number of microorganisms in the water during their survival process. At the same time, as invertebrates, shellfish only have an innate immune system. In the current development of the shellfish aquaculture industry, events such as large-scale diseases and even deaths of cultured shellfish frequently occur due to high-density farming and water pollution. However, among bivalve shellfish, mussels show strong disease tolerance during the farming process. So far, there has been no report of large-scale diseases in the genus Mytilus during the farming process. In the sea areas where mussels, oysters, and clams are polycultured, a high density of Vibrio, viruses, and parasites often cause a large number of deaths of oysters and clams, but do not cause obvious harm to the mussels surviving in the same sea area. The above research results indicate that mussels have a unique and powerful immune system compared with other shellfish. Therefore, mussels have become an important object for studying the immunity of marine invertebrates. Currently, it is known that the immune system of mussels shows extremely strong tolerance to pathogenic microorganisms, indicating that the unique immune defense mechanism of mussels can effectively resist the invasion of various microorganisms in the water. Therefore, the study of the immune system of mussels and its molecular mechanism has important scientific significance.

[0003] Antimicrobial peptides (AMPs) are a class of small molecule antibacterial proteins with both important physiological significance and important application potential. Mussel antimicrobial peptides have become an important species in the study of marine biological antimicrobial peptides due to their strong antibacterial activity and rich molecular diversity. Mytilus coruscus is the main dominant mussel species in the western Pacific Ocean and also the most important cultured shellfish in the East China Sea of our country, with important economic value and research value. Moreover, Mytilus coruscus has strong environmental adaptability and disease tolerance, and the antimicrobial peptide molecules are of great significance to the immune defense of Mytilus coruscus. By sequencing the genome and polypeptide group of mussels and combining large-scale screening techniques, antibacterial peptides with novel structures can be obtained, which have broad application prospects in the fields of antibacterial agents and antibacterial drugs. Summary of the Invention

[0004] Aiming at the problems existing in the prior art, the first object of the present invention is to provide a shellfish antimicrobial peptide A1-β with strong antibacterial activity, low hemolytic activity, and no cytotoxicity.

[0005] A kind of shellfish antimicrobial peptide A1-β, and the amino acid sequence of the shellfish antimicrobial peptide A1-β is specifically: Gly-Gly-Tyr-Cys-Gly-Gly-Trp-Phe-Arg-Leu-Lys-Cys-Lys-Gly-Ile.

[0006] The second object of the present invention is to provide the application of the above shellfish antimicrobial peptide A1-β in the preparation of antibacterial drugs, and the bacteria are Gram-negative bacteria and Gram-positive bacteria. The Gram-negative bacteria include Escherichia coli, Vibrio harveyi, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis; the Gram-positive bacteria include Bacillus megaterium, Micrococcus luteus and Bacillus subtilis.

[0007] The third object of the present invention is to provide the application of the above shellfish antimicrobial peptide A1-β in aquaculture feed additives.

[0008] The fourth object of the present invention is to provide an antibacterial drug containing the above shellfish antimicrobial peptide A1-β as an active ingredient.

[0009] Compared with the prior art, the present invention has the following advantages:

[0010] (1) Verified by examples, the antimicrobial peptide A1-β of the present invention has strong antibacterial activity, low hemolytic activity, no cytotoxicity, high stability, and has good advantages and application prospects;

[0011] (2) The shellfish antimicrobial peptide A1-β is obtained by the existing solid-phase chemical synthesis method with a purity of more than 95%, and has significant antibacterial effects on both Gram-positive bacteria and Gram-negative bacteria;

[0012] (3) The shellfish antimicrobial peptide A1-β has no cytotoxic effect on normal mammalian red blood cells. Compared with many known marine animal antimicrobial peptides, the shellfish antimicrobial peptide A1-β has good antibacterial effects, a broad antibacterial spectrum, great use value, and has good applications in the development and preparation of antibacterial agents.

[0013] (4) Based on the amino acid sequence of Mytilus coruscus, the present invention artificially synthesizes an antimicrobial peptide A1-β with broad-spectrum antibacterial activity. This antimicrobial peptide is derived from aquatic bivalve shellfish and can be applied to aquaculture as a feed additive, or can be developed into antibacterial agents and antibacterial drugs, etc. Therefore, it has a wide application prospect. Description of the Drawings

[0014] Figure 1 It is the structural diagram of the shellfish antimicrobial peptide A1-β of the present invention;

[0015] Figure 2 It is the HPLC purification and molecular weight mass spectrometry identification image of the crude product of the solid-phase chemical synthesis of the shellfish antimicrobial peptide A1-β of the present invention;

[0016] Figure 3 This is the antibacterial activity table of the shellfish antimicrobial peptide A1-β of the present invention;

[0017] Figure 4 This is the hemolytic activity test value of the shellfish antimicrobial peptide A1-β of the present invention against sheep red blood cells;

[0018] Figure 5 This is the cytotoxicity value of the shellfish antimicrobial peptide A1-β of the present invention against HEK293T determined by the MTT method. Detailed implementation manners

[0019] In order to better understand the purpose, structure and function of the present invention, the following further describes in detail a shellfish antimicrobial peptide A1-β and its application of the present invention in combination with specific embodiments and drawings. Example 1

[0020] Obtaining of the shellfish antimicrobial peptide A1-β

[0021] S1. Screen sequences with defensin structural characteristics from the genome of Mytilus coruscus, predict their structures and functions through bioinformatics technology, on this basis screen the functional peptide segments related to antibacterial activity in their structures, and obtain the optimized peptide segment sequence through structure comparison;

[0022] S2. According to the obtained peptide segment sequence, use solid-phase chemical synthesis means to obtain a sample of the polypeptide fragment, use the growth curve inhibition method to carry out the functional analysis of the peptide segment, judge the antibacterial spectrum of the peptide segment, and deeply study its antibacterial activity mechanism.

[0023] As Figure 1 shown, the shellfish antimicrobial peptide A1-β of the present invention has 15 amino acid residues, and its amino acid sequence is specifically: Gly-Gly-Tyr-Cys-Gly-Gly-Trp-Phe-Arg-Leu-Lys-Cys-Lys-Gly-Ile, and the nucleotide sequence is: GGTGGTTATTGTGGAGGCTGGTTCAGATTGAAGTGCAAAGGTATT, and the single-letter abbreviation sequence of the amino acid sequence is GGYCGGWFRLKCKGI. Example 2

[0024] Solid-phase synthesis of the shellfish antimicrobial peptide A1-β

[0025] According to the designed amino acid sequence: Gly-Gly-Tyr-Cys-Gly-Gly-Trp-Phe-Arg-Leu-Lys-Cys-Lys-Gly-Ile, it was synthesized on a twelve-channel semi-automatic peptide synthesizer by solid-phase peptide chemistry synthesis. The synthesis direction was from the carboxyl terminus to the amino terminus. The crude linear peptide after synthesis was separated and purified by high-performance liquid chromatography.

[0026] The specific detection conditions were as follows:

[0027] (1) Chromatographic conditions: The chromatographic column was a C8 reverse-phase column (4.6×250 mm, 5 μm). The eluents were solution A: pure water containing 0.1% TFA, and solution B: acetonitrile containing 0.1% TFA. The elution gradient was that the proportion of solution B increased from 30% to 65% within 20 min. At 20.1 min, the proportion of mobile phase A became 100%, and the proportion of mobile phase B became 0%. Separation was carried out at a flow rate of 1 mL / min for 30 min. Detection was performed using an ultraviolet detector at a detection wavelength of 220 nm. The elution target peak was collected for mass spectrometry analysis; mass spectrometry was used to identify the molecular weight of the synthesized pure peptide.

[0028] (2) Mass spectrometry detection conditions: Pneumatically assisted electrospray ionization (ESI), capillary voltage was 2.5 kV, detector voltage was 1.5 kV, ion source temperature was 450 °C; the ion detection mode was selective ion detection, and the ion polarity was positive ion.

[0029] In summary, using the solid-phase peptide synthesis strategy, the chemical synthesis of shellfish antimicrobial peptide A1-β was completed. The purification and identification results of the synthesized product were as Figure 2 shown. After purification by high-performance liquid chromatography, the purity of shellfish antimicrobial peptide A1-β reached over 90%. Example 3

[0030] Antibacterial activity detection of shellfish antimicrobial peptide A1-β

[0031] The strains involved in this example were: Escherichia coli, Vibrio harveyi, Vibrio alginolytica, Vibrio parahaemolyticus, Vibrio fluvialis, Bacillus megaterium, Sarcina lutea, and Bacillus subtilis.

[0032] The experiment adopted the method of two-fold serial dilution to determine the minimum inhibitory concentration (MIC), which is the lowest drug concentration that can inhibit the growth and reproduction of bacteria.

[0033] Determination of MIC value: Prepare fresh bacterial liquid, use an ultraviolet spectrophotometer to detect the OD600 of the bacterial liquid. According to 1 OD600 = 1×10 9 CFU / ml, dilute and adjust the concentration of the above-mentioned bacterial liquid to 2×10 5 CFU / ml with fresh LB liquid medium; then add 100 μl of normal saline to a sterile 96-well plate in advance, add the sample to be tested into the first well, perform two-fold serial dilution on the sample to be tested in sequence, and then add 100 μl of bacterial liquid with a concentration of 2×10 5 CFU / ml to each well, pipette and mix it evenly with a pipette gun, and place it in a constant temperature incubator at 37 °C for overnight culture; finally, use an enzyme-linked immunosorbent assay (ELISA) reader to detect the light absorption value of the bacterial liquid at 600 nm, and take the average value of the sample concentrations in the wells where no bacterial growth is detected and the adjacent wells as the minimum inhibitory concentration, that is, the MIC value.

[0034] After verification, the antibacterial activity of shellfish antimicrobial peptide A1-β is as Figure 3 shown, and its MIC value is between 31.3 - 125.0 μΜ. Example 4

[0035] Determination of the hemolysis rate of shellfish antimicrobial peptide A1-β

[0036] Determination of the performance of inhibiting bacterial reproduction:

[0037] S1. Take sheep blood, centrifuge (1000 × g, 10 min, 4 °C) to collect red blood cells, wash them 3 times with PBS buffer (pH 7.4), and then resuspend the cells with PBS buffer (pH 7.4) to prepare a 1% red blood cell suspension;

[0038] S2. Synthesize shellfish antimicrobial peptide A1-β and configure it into a 1 mM concentration with PBS buffer (pH 7.4). Add the antimicrobial peptide solution and the red blood cell suspension according to a ratio of 1:9, and the final concentrations of the antimicrobial peptide are 100, 50, 25, 12.50, 6.25, 3.13, 1.56, and 0.78 μΜ concentration gradients. Use PBS buffer (containing 0 μΜ antimicrobial peptide) as the negative control and tritonX-100 as the positive control;

[0039] S3. After culturing at 37 °C for 4 h, take it out, centrifuge (1000 × g, 10 min, 4 °C), transfer the supernatant to a 96-well plate, and measure the absorbance at a wavelength of 405 nm with an ELISA reader;

[0040] S4. The hemolysis rate of the antimicrobial peptide is calculated according to (the OD of the detection well 405- OD of negative wells 405 ) / (OD of positive wells 405 - OD of negative wells 405 ) × 100% for calculation.

[0041] As Figure 4 shown, after incubation of the antimicrobial peptide solution with the sheep red blood cell suspension, the OD 405 test results showed that compared with the control group, none of the different concentrations of shellfish antimicrobial peptide A1-β could cause obvious hemolysis of red blood cells, and the hemolysis rates of different concentrations of shellfish antimicrobial peptide A1-β were all less than 5%. Example 5

[0042] Cytotoxicity determination of shellfish antimicrobial peptide A1-β

[0043] The human embryonic kidney cell line HEK293T was used to determine cytotoxicity, which specifically included:

[0044] S1. When the cells were in good growth state and the density reached 80% of the bottom of the flask, the culture medium was discarded, and the cells were washed 3 times with sterile PBS. Subsequently, the adherent cells were digested with trypsin. After termination, fresh DMEM medium containing 10% FBS was added and pipetted and mixed well, and the cell suspension concentration was adjusted to 5 × 10 5 cells / ml. The experiment used a sterile 96-well plate. 200 μl of the above cell suspension was added to each well and incubated overnight in a cell culture incubator;

[0045] S2. The next day, different concentrations of the test samples were added, and the concentration gradients were set as 500 μM, 250 μM, 125 μM, 62.5 μM, 31.3 μM, 15.6 μM, 7.8 μM, 3.9 μM, with 3 replicates for each concentration. The control group used the same volume of sterile PBS. Subsequently, it was placed in a constant temperature incubator at 37°C and 5% CO 2 and continued to be cultured for 24 hours;

[0046] S3. 10 μl of 5 mg / ml MTT solution was added to each sub-well and continued to be cultured in the incubator for 4 hours under light-proof conditions;

[0047] S4. Finally, the liquid in the wells was carefully aspirated and discarded, 100 μl of DMSO (dimethylsulfoxide) was added, and the 96-well plate was placed on a shaker and slowly shaken for 10 minutes until the crystals dissolved. The light absorption value of each well at 490 nm was detected with an enzyme-linked immunosorbent assay reader. The results were as Figure 5 shown, shellfish antimicrobial peptide A1-β had no cytotoxicity.

[0048] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A shellfish antimicrobial peptide A1-β, characterized in that, the amino acid sequence of the shellfish antimicrobial peptide A1-β is specifically: Gly-Gly-Tyr-Cys-Gly-Gly-Trp-Phe-Arg-Leu-Lys-Cys-Lys-Gly-Ile.

2. The application of the shellfish antimicrobial peptide A1-β according to claim 1 in the preparation of an antibacterial agent and / or an antibacterial drug, wherein the bacteria are Gram-negative bacteria and Gram-positive bacteria, and the Gram-negative bacteria are Escherichia coli, Vibrio harveyi, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis; the Gram-positive bacteria are Bacillus megaterium, Micrococcus luteus and Bacillus subtilis.

3. The application of the shellfish antimicrobial peptide A1-β according to claim 1 in an aquatic feed additive.

4. An antibacterial drug, characterized in that, it contains the shellfish antimicrobial peptide A1-β according to claim 1 as an active ingredient.

Images