A new strain of Ganoderma lucidum with high triterpenoid production HMGIM-D150696 and its molecular marker and artificial cultivation method

Abstract

The present invention discloses a new strain of high-yield triterpenoid Ganoderma lucidum HMGIM-D150696, its molecular marker and artificial cultivation method. Ganoderma lucidum (Ganoderma lucidum) HMGIM-D150696, the deposit number is GDMCC No: 62403; the nucleotide sequence of its molecular marker is shown in SEQ ID NO.1 or SEQ ID NO.2; its artificial cultivation method includes mycelium culture, Ganoderma management and harvesting. Compared with the traditional method of amplification using random primers, the method of obtaining differential sites in the present invention has the advantages of high efficiency and rich specific sites, and can more effectively protect the strain. In addition, because the strain is collected from the wild, it has rich genetic variations and is distantly related to the varieties circulating in the market, it can provide valuable germplasm resources for the breeding of excellent new varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural microorganisms, and specifically relates to a new strain of high-yield triterpenoid ganoderma lucidum and its molecular marker, specific primer pair and artificial cultivation method. Background Art

[0002] Ganoderma lucidum (Curtis) P. Karst. is a fungus of the Agaricus class, Polyporaceae family, and Ganoderma genus. According to the "Shennong's Herbal Classic", Ganoderma has the effects of "calming the spirit, increasing wisdom, benefiting the heart, strengthening the bones and muscles, improving complexion, and making the body light and immortal if eaten for a long time". Modern pharmacological and clinical studies have shown that Ganoderma has multiple pharmacological activities and has been widely used to prevent and treat various diseases, especially in immunomodulation, hypoglycemia and anti-tumor. It has been determined that Ganoderma fruiting bodies contain more than 400 metabolites, and the physiologically active components include Ganoderma polysaccharides, triterpenoids, proteins, polypeptides, nucleosides, furans, sterols, alkaloids and amino acids. Ganoderma triterpenoids are an important class of active substances in the secondary metabolism of Ganoderma, and have a wide range of pharmacological activities such as anti-aging, anti-virus, anti-tumor, anti-inflammatory, blood pressure lowering, blood sugar lowering, blood lipid lowering, immunomodulation, analgesia, and liver protection. Corresponding medicines and edible products have been developed for the pharmacological activity of triterpenes in Ganoderma lucidum. At present, some high-quality Ganoderma lucidum products on the market will separately mark the content of triterpenes in Ganoderma lucidum. Spore oil products with a triterpenoid content of more than 10% in Ganoderma lucidum are considered to have reached the industry level. Some high-quality spore oil products of Ganoderma lucidum can have a triterpenoid content of more than 20%. The United States Pharmacopoeia also lists the triterpenoid content of Ganoderma lucidum as a standard for evaluating the quality of Ganoderma lucidum. However, the low content of triterpenoid compounds in Ganoderma lucidum has led to high prices for related processed products, limiting their promotion and application. Therefore, breeding high-yield triterpenoid strains of Ganoderma lucidum can be an effective way to promote the development of the Ganoderma lucidum processing industry.

[0003] Since the realization of artificial cultivation of Ganoderma lucidum, it has been mainly cultivated by covering the soil with logs. With the sharp increase in labor costs, shortage of raw materials, tight land resources, and increasingly serious safety issues such as heavy metals, pests and diseases caused by covering the soil, the traditional cultivation method has been severely challenged, and factory cultivation is an inevitable trend for the sustainable development of society. However, when Ganoderma lucidum matures, it will spray a large number of spores, which can easily pollute the environment and equipment of the cultivation workshop and cause respiratory diseases in the staff. Studies have shown that the yield of immature fruiting bodies obtained by multiple harvests is equivalent to that of mature fruiting bodies harvested once, and the content of triterpenoid compounds in immature fruiting bodies is higher than that in mature fruiting bodies. Multiple harvesting requires the strain to have a strong primordium regeneration ability. In summary, the selection of strains with good primordium growth and strong regeneration ability can help solve the problems encountered in the factory cultivation of Ganoderma lucidum and accelerate the process of factory cultivation of Ganoderma lucidum.

[0004] Variety selection is a systematic and long-term work, and Ganoderma lucidum can reproduce production seeds through asexual reproduction, which has greatly dampened the enthusiasm of breeders, affected the development of the entire industry, and caused confusion among species with the same name and the same name. Traditional identification of edible fungi species mainly relies on mycelium antagonism, fruiting body morphology and other methods. The judgment of mycelium antagonism is greatly affected by human factors, and the antagonism line between closely related strains is not obvious and cannot be effectively distinguished. The appearance of the fruiting body is greatly affected by environmental factors (temperature, humidity, light, oxygen), and it takes several months to obtain the fruiting body, which is not conducive to rapid and effective identification of strains. With the development of molecular biology technology, DNA molecular marker technology is widely used in genetic breeding and species relationship identification due to its advantages of simplicity, rapidity, and not being restricted by developmental period and environmental factors. Summary of the invention

[0005] The invention aims to provide a ganoderma lucidum strain HMGIM-D150696 with high triterpene production, a molecular marker and an artificial cultivation method thereof.

[0006] Ganoderma lucidum HMGIM-D150696 was deposited in the Guangdong Microbiological Culture Collection Center (GDMCC) on April 21, 2022, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is GDMCC No: 62403.

[0007] The present invention adopts whole genome resequencing technology to obtain the genome sequence information of HMGIM-D150696 strain, obtains the InDel variation site set through bioinformatics analysis, designs specific primers in a targeted manner, and obtains the specific DNA fragment of wild Ganoderma lucidum strain HMGIM-D150696 through PCR amplification, which is the molecular marker of Ganoderma lucidum strain HMGIM-D150696.

[0008] The nucleotide sequence of the molecular marker of the Ganoderma lucidum strain HMGIM-D150696 is shown as SEQ ID NO.1 or SEQ ID NO.2.

[0009] The present invention also provides a primer set for identifying the Ganoderma lucidum strain HMGIM-D150696:

[0010] Include any of the following primer pairs:

[0011] D696-F1: TCTCGCAAAATCAAATTCGCAG and D696-R1: TGGTTTGACTGGGATAACG ATGT;

[0012] D696-F2: GATGTGAAGCGCCCTGAGAA and D696-R2: CCGGGTAAAGGTGGTTGAA GTT.

[0013] D696-YF:GACGTCTGCAGTGATTCTGGAAC and D696-YR:TCATTATCTTATGGCGTTA GCAGG

[0014] The present invention also provides a molecular marker of the ganoderma lucidum strain HMGIM-D150696 or an application of the identification primer set in identifying the ganoderma lucidum strain HMGIM-D150696.

[0015] The present invention also provides a method for identifying the Ganoderma lucidum strain HMGIM-D150696, comprising extracting genomic DNA of the Ganoderma lucidum to be tested, performing PCR amplification with the D696-F1 / R1 primer pair, and if a specific DNA fragment can be amplified, the strain is the Ganoderma lucidum strain HMGIM-D150696, otherwise it is not; or performing PCR amplification with the D696-F2 / R2 primer pair, and if two specific DNA fragments can be amplified, the strain is the Ganoderma lucidum strain HMGIM-D150696, otherwise it is not; or performing qPCR amplification with the D696-YF / YR primer pair, and if fluorescence can be excited when the cycle number is less than 30, the strain is the Ganoderma lucidum strain HMGIM-D150696, otherwise it is not.

[0016] Specifically, the size of the specific DNA fragment is 250-300 bp.

[0017] Specifically, the sizes of the two specific DNA fragments are 100-250 bp and 300-400 bp.

[0018] The present invention also provides a cultivation method of the above-mentioned Ganoderma lucidum strain HMGIM-D150696, comprising the steps of: mycelium cultivation, Ganoderma lucidum strain HMGIM-D150696 management and harvesting.

[0019] Preferably, the specific steps are:

[0020] 1. Culture medium formula

[0021] Mother culture medium: by mass fraction, including 20% ​​potato + 2% glucose + 1% peptone + 2% agar + 0.3% potassium dihydrogen phosphate + 0.15% magnesium sulfate + 0.001% vitamin B1;

[0022] Production seed culture medium: by mass fraction, including 98-99% sorghum + 1-2% calcium carbonate, natural pH;

[0023] Cultivation material: by mass percentage, including 50% sawdust, 38% cottonseed hulls, 10% wheat bran, 2% calcium carbonate, water content 60-65%, natural pH;

[0024] 2. Cultivation Process

[0025] Mycelium culture: Under aseptic operation conditions, take HMGIM-D150696 preserved seed blocks and inoculate them into the mother seed culture medium, with a humidity of 50%-60%, and culture them in the dark for 8-12 days until the mycelium grows all over the slope; transfer the mother seed mycelium to the production seed culture medium for expansion culture, and culture them in the dark until the mycelium grows all over the bag; then inoculate the production seed mycelium into the cultivation material, culture them in the dark, with a humidity of 60%-70%, and ventilate them regularly to keep the carbon dioxide concentration below 4000ppm, culture them for 18-20 days until the mycelium grows all over the bag, and then culture them under the same conditions for 7-10 days for post-ripening period culture;

[0026] Management of mushroom production: After the mycelium matures, buds are promoted. The lids of the cultivation bags are opened and placed vertically. The temperature is 26-28℃, the relative humidity is 90%-95%, and the scattered light is 8h / d. After the management of mushroom production, primordia begin to form at the opening of the cultivation material. The humidity is adjusted to 80-90%. When the mushroom cap begins to differentiate, fresh air is replaced every day. When the growth points on the edge of the fruiting body disappear, adjust the air humidity to 80% before spraying.

[0027] Harvesting: Harvest the fruiting bodies when spores are ejected in large quantities from the back of the cap.

[0028] Further preferably, the cultivation process is:

[0029] Mycelium culture: Under aseptic operation conditions, take HMGIM-D150696 preserved seed blocks and inoculate them into the mother seed culture medium, with a humidity of 50%-60%, and culture them at a constant temperature of 25°C in the dark for 8-12 days until the mycelium grows all over the slope; transfer the mother seed mycelium to the production seed culture medium for expansion culture, and culture them at a constant temperature of 25°C in the dark until the mycelium grows all over the bag; then inoculate the production seed mycelium into the cultivation material, culture them at a constant temperature of 25°C in the dark, with a humidity of 60%-70%, and ventilate them regularly to keep the carbon dioxide concentration below 4000ppm, culture them for 18-20 days until the mycelium grows all over the bag, and then culture them under the same conditions for 7-10 days for post-ripening period culture;

[0030] Management of mushroom production: After the mycelium matures, buds are promoted. The lids of the cultivation bags are opened and placed vertically. The temperature is 26-28℃ and the relative humidity of the air is maintained at 90%-95%. The scattered light is used for 8h / d. After about 6 days of management of mushroom production, primordia begin to form at the opening of the cultivation material. The humidity is adjusted to 80-90%. When the mushroom cap begins to differentiate, fresh air is exchanged twice a day for 1h each time. The growth points on the edge of the fruiting body disappear. The air humidity is adjusted to 80% before spraying.

[0031] Harvesting: The fruiting bodies are harvested when a large number of spores are ejected from the back of the cap. The fresh weight of each bag is 46.83-61.77g, the cap diameter is 7.75-11.40cm, the stem height is 1.32-3.02cm, and the cap thickness is 8.90-10.81mm.

[0032] Compared with the traditional method of random primer amplification, the method of obtaining differential sites of the present invention has the advantages of high efficiency and rich specific sites, and can more effectively protect the fungus species. Compared with the conventional fruiting body morphology and mycelium antagonistic line observation, the detection method of the present invention has the advantages of short detection time, objective and true detection results, and high accuracy.

[0033] The Ganoderma lucidum strain HMGIM-D150696 is a wild Ganoderma lucidum strain. After separation and purification, domestication and cultivation research, and evaluation of the content of active ingredients by our team, it was found that it has strong primordium differentiation and regeneration capabilities, and has high triterpenoid content in mature fruiting bodies. The triterpenoid content of fruiting bodies cultivated with substitute materials can reach 25.1 mg / g, which can provide raw materials for the development of medicines or medicinal and edible products with Ganoderma lucidum triterpenoids as the main ingredients, and has good edible and medicinal development value. In addition, since the strain was collected from the wild, it has rich genetic variation and is distantly related to the varieties circulating in the market, which can provide valuable germplasm resources for the selection and breeding of excellent new varieties.

[0034] Ganoderma lucidum HMGIM-D150696 was deposited on April 21, 2022 at the Guangdong Microbiological Culture Collection Center (GDMCC), address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is GDMCC No: 62403. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a picture of the Ganoderma lucidum strain HMGIM-D150696 (Ganoderma lucidum) collected in the wild.

[0036] Figure 2 This is the phylogenetic tree result of HMGIM-D150696 and other species of Ganoderma based on ITS sequences, based on the neighbor-joining method and maximum likelihood method from left to right respectively.

[0037] Figure 3 It is the domesticated fruiting body phenotype of Ganoderma lucidum strain HMGIM-D150696.

[0038] Figure 4 The figure shows the amplification results of the primer pair D696-F1 / R1 in HMGIM-D150696 (D696) and the market species.

[0039] Figure 5 The figure shows the amplification results of the primer pair D696-F2 / R2 in HMGIM-D150696 (D696) and the market species.

[0040] Figure 6 It is the amplification result diagram of the primer pair D696-YF / YR in HMGIM-D150696 (D696) and market species. DETAILED DESCRIPTION

[0041] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.

[0042] Example 1: Acquisition and identification of wild Ganoderma lucidum strains

[0043] On August 4, 2015, researchers from the Edible Fungi Research and Development Center of the Guangdong Institute of Microbiology collected a specimen of Ganoderma lucidum in a national nature reserve in Hunan Province. The fungus grew on a dead tree facing the sun ( Figure 1 ). After separation and purification, it was identified as Ganoderma lucidum HMGIM-D150696, and was deposited in Guangdong Microbiological Culture Collection Center (GDMCC) on April 21, 2022, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is GDMCC No: 62403.

[0044] 1. Tissue separation and purification

[0045] Wipe the surface of the Ganoderma lucidum fruiting bodies collected in the wild with 75% alcohol, tear open and clamp the internal fungus tissue of 0.2-0.5mm×0.2-0.5mm in a sterile environment and inoculate it into the enriched comprehensive PDA medium. Place it in a 25℃ incubator for constant temperature and dark culture, and take the tip mycelium for purification culture after the mycelium has grown all over the slope.

[0046] 2. Identification

[0047] 2.1 Traditional Identification - Macroscopic and Microscopic Identification

[0048] The fruiting body of wild HMGIM-D150696 has lateral stalks, which are corky when fresh and corky when dried. The cap is flat and cap-shaped, with a diameter of about 3.6 cm and a stipe length of about 9 cm. The cap is mostly reddish brown, with a light yellow surface on the tube mouth, nearly round, with 5-6 pores per millimeter, brown flesh, the upper flesh is lighter in color, and the lower flesh is darker in color, corky, and the pores are darker than the flesh. The basidiospores are oval, flat-topped, double-walled, transparent and smooth outer wall, brown or light brown inner wall, with small thorns, non-starchy, with an oil droplet in the center, 8.5-10.7 microns × 5.5-7.5 microns.

[0049] 2.2 Molecular identification

[0050] 2.2.1 ITS identification method

[0051] The purified mycelium was transferred to a PDA plate medium with a surface covered with a film of serofen, and placed in a constant temperature of 25°C and dark culture. After the mycelium grew all over the plate, fresh mycelium was collected and ground at room temperature. The DNA genome was extracted using a magnetic bead genomic DNA extraction kit (Guangzhou Maibao Biotechnology Co., Ltd., catalog number DNF628-05B) with a fully automatic nucleic acid extractor. The obtained DNA solution (DNA template) was refrigerated at -20°C for use. ITS-PCR experiments were performed using the universal primers ITS1 / ITS4 of the fungal ribosomal gene spacer region (ITS1: TCCGTAGGTGAACCTGCGG, ITS4: TCCTCCGCTTATTGAT ATGC, synthesized by Sangon Biotech (Shanghai) Co., Ltd.), and amplification was performed on a BioRad PCR instrument. The composition of the PCR reaction solution (30 μl in total) is shown in Tables 1 and 2.

[0052] Related reagents (product number P111-01) were purchased from Nanjing Novozymes Biotech Co., Ltd. PCR products were directly sent to BGI for bidirectional sequencing.

[0053] Table 1 Fungal ITS PCR system

[0054]

[0055] Table 2 Fungal ITS PCR amplification procedures

[0056]

[0057] 2.2.2 Determination of taxonomic status

[0058] The sequencing results (TGCACTTACTGTGGGCTTCAGATTGCGAGGCACGCTCTTTACCGGGCTTGCGGAGCATATCTGT GCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACACATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCCTCAACCTACAAGCTTTTGTGGTTTGTAGGCTTGGACTTGGAGGCTTGTCGGCCGT) were compared with the NCBI GenBank. The ITS identification result indicated that the strain was a Ganoderma lingzhi strain. To further confirm its species, the maximum likelihood method (ML) and neighbor-joining method (NJ) were used to construct phylogenetic trees, with Trametes versicolor as the outgroup. In the phylogenetic trees constructed by the two algorithms, HMGIM-D150696 and Ganoderma lingzhi were in the same branch, clustered into one category, and had a close relationship. It can be determined that HMGIM-D150696 is a strain of Ganoderma lingzhi ( Figure 2). The Ganoderma lucidum recorded in the Chinese Pharmacopoeia is the dried fruiting body of the Polyporaceae fungus G. lucidu m or G. sinense. However, with the development of phylogenetic research, the research of Professor Dai Yucheng, a Chinese taxonomy expert in 2013, showed that the Ganoderma lucidum widely distributed and cultivated in my country is different from G. lucidum produced in Europe. Wasser et al. (2006) and Wasser (2011) also pointed out that the name G. lucidum was incorrectly used for the medicinal fungus Ganoderma lucidum. In fact, Chinese Ganoderma lucidum (commonly known as red ganoderma) is a new species: Ganoderma lingzhi S.H.Wu, Y.Cao & Y.C.Dai (Cao et al. 2012), so the Latin name of red ganoderma recorded in the Chinese Pharmacopoeia should be G.lingzhi, not G.lucidum. The strain protected by this patent is a wild strain of G.lingzhi native to China, but since the current pharmacopoeia still uses G.lucidum as the Latin name of Ganoderma lucidum, the species name of the strain protected by this patent is tentatively set as G.lucidum, which will be corrected after the pharmacopoeia is revised. It is named Ganoderma lucidum HMGIM-D150696 and deposited in Guangdong Microbiological Culture Collection Center (GDMCC) on April 21, 2022, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is GDMCC No: 62403.

[0059] Example 2: Domestication and systematic breeding of wild Ganoderma lucidum strains

[0060] (I) Domestication and cultivation of wild Ganoderma lucidum strains

[0061] 1. Culture medium formula and configuration

[0062] 1.1 Mother culture medium (enriched comprehensive PDA): by mass fraction, including 20% ​​potato + 2% glucose + 1% peptone + 2% agar + 0.3% potassium dihydrogen phosphate + 0.15% magnesium sulfate + 0.001% vitamin B1, the balance is water. The preparation method is: first wash and peel the potatoes, then weigh 200g of potatoes and cut them into small pieces, add water and cook until soft (boil for 20 to 30 minutes, glass rod can pierce), filter with eight layers of gauze, add 20g glucose, 10g peptone, 20g agar, 3g potassium dihydrogen phosphate, 1.5g magnesium sulfate, vitamin B1 to the filtrate. 0.01g, stir evenly, add water to 1000 ml after cooling slightly, and divide into glass test tubes (18×180mm), sterilize at 0.11MPa, 121℃ high temperature and high pressure wet heat for 30min, and place on the slope to cool and shape before the culture medium solidifies after sterilization. After cooling, sterile operation is performed to inoculate the successfully isolated Ganoderma lucidum strain HMGIM-D150696. Place in a 25℃ incubator for constant temperature dark culture, and transfer after the mycelium has covered the slope (about 8-12 days).

[0063] 1.2 Production seed culture medium: by mass fraction, including 99% sorghum + 1% calcium carbonate, natural pH. Weigh the required proportion of sorghum, soak overnight and cook until thoroughly cooked, remove and filter to discard excess water, add calcium carbonate in proportion and mix well, put into a 13cm×25cm high temperature resistant transparent polypropylene bag, equivalent to 200-250g of dry material per bag. 0.11MPa, 121℃ high temperature and high pressure wet heat sterilization for 30min. Take out and cool, then aseptically inoculate the production mother seed. Make sure the mother seed block is buried in the production seed material during inoculation. Place the inoculated production seed in a 25℃ incubator for constant temperature dark culture. After the mycelium has eaten the material (about 8-12 days), it can be used as a production seed and inoculated into the cultivation bag.

[0064] 1.3 Production of cultivation bags: by mass fraction, including 50% sawdust, 38% cottonseed hulls, 10% wheat bran, 2% calcium carbonate, pH natural. Take the above formula and mix thoroughly and add water to a moisture content of 60-65%. After stacking overnight, turn the pile again and mix well, adjust the moisture content to 60-65% again, and put it into a 17cm×35cm high temperature resistant transparent polypropylene spawn bag, equivalent to 400-420g of dry material per bag. After loading the material, use a punching rod to punch holes in the bag material, the hole is as deep as the bottom of the bag, then put a plastic ring on the bag mouth, buckle the matching lid, and you will get a prepared cultivation bag material. Sterilize under 0.147MPa atmospheric pressure and 128℃ high temperature and high pressure wet heat for 90min, take out and cool, aseptically transfer to production seeds, culture in the dark at 25℃ constant temperature, humidity 60%-70%, ventilate regularly to keep carbon dioxide concentration below 4000ppm, culture for 18-20 days until the mycelium fills the bag, and then culture under the same conditions for 7-10 days for the after-ripening period, and the full growth time is about 18-20d.

[0065] 2. Cultivation management

[0066] After the cultivation bag is inoculated, it is cultured in a dark room at 25℃±1℃ and relative air humidity of 60-70%. When the mycelium in the cultivation bag is full of the cultivation material in the bag, open the lid of the cultivation bag, remove the fungus ring, and place the cultivation bags vertically (there should be gaps between bags), place them at 26-28℃, relative air humidity of 90-95%, and irradiate with scattered light for 8h / d. Primordia will begin to form in about 6 days. After the cap is formed, fresh air is replaced every day, once in the morning and once in the evening, each time for 1h, and the air humidity is adjusted to 85%-90%. The growth point on the edge of the fruiting body disappears. Before starting to spray powder, adjust the air humidity to 80%, and harvest when a large number of spores are ejected from the back of the cap.

[0067] (II) Systematic breeding to obtain excellent strains and their fruiting body characteristics

[0068] After the fruiting bodies are formed, the healthy fruiting bodies are selected for tissue separation and purification again to obtain the candidate Ganoderma lucidum strains, which are preserved and prepared in sequence as mother strains and production strains, and cultivated for fruiting. According to the growth cycle, anti-bacterial ability and fruiting body formation ability of the candidate strains during the cultivation process, the tissue separation is selected to obtain purified mycelium, and this is a cycle to select stable, fast-growing and antibacterial strains. The excellent strains finally preserved are cultivated and managed. The primordium can be formed after 6 days of scattered light irradiation in the bag, and the number of primordia is large and the growth is good. Under the same cultivation conditions, the market variety Hanzhi 203 needs 8-10 days to begin to form primordia. Pruning is carried out at the young fruiting body stage. After pruning, the incision can form primordia and grow complete fruiting bodies, indicating that HMGIM-D150696 has a strong regeneration ability and is suitable for factory-scale multiple harvesting mode. Traits of domesticated fruiting bodies: Fruiting bodies are round kidney-shaped, with a cap diameter of 7.75-11.40cm, a stipe height of 1.32-3.02cm, and a cap thickness of 8.90-10.81mm. Before spores are ejected, the front of the cap is yellow, with obvious concentric rings and radial longitudinal ridges. After maturity, the fruiting body is yellow-brown, shiny, with a light yellow ventral surface, obvious fungus tubes, and a reddish-brown stipe ( Figure 3 ). The fresh weight of a single fruiting body is 46.83-61.77g, and the dry weight is 19.67-24.77g.

[0069] The triterpenoid content of the Ganoderma lucidum fruiting bodies obtained by domestication and cultivation was determined by high performance liquid chromatography. There were 45 standard products, including triterpenoid compounds such as ganoderic acid, ganoderic alcohol, ganoderic ene acid, ganoderic aldehyde, ganoderic ketone, and ganoderic lactone. The detection method was based on the detection process established by Dr. Feng Na of the Institute of Edible Fungi of Shanghai Academy of Agricultural Sciences (CN202011236775.0, CN202111210687.8). The results showed that the content of triterpenoid compounds in the fruiting bodies of HMGIM-D150696 was 1.7-1.9 times that of the market-circulating varieties Shanghai Agricultural No. 1 and Hanzhi 203, indicating that the strain has a high yield of triterpenoid substances (see Table 3), which can provide raw materials for the development of medicinal and health foods with Ganoderma lucidum triterpenoids as the main ingredients, and has good edible and medicinal development value.

[0070] Table 3 Comparison of triterpenoid content between HMGIM-D150696 and other strains

[0071]

[0072] Considering the outstanding advantages of HMGIM-D150696, such as strong primordium differentiation and regeneration ability and high content of triterpenoid compounds, it is expected that more excellent new strains can be bred through mutagenesis breeding, hybrid breeding, protoplast fusion breeding and other methods.

[0073] Example 3: Development of strain-specific molecular markers

[0074] The widely used commercial strains Shanghai Agricultural No. 1, Hanzhi 203 and wild Ganoderma lucidum strain HMGIM-D150696 were inoculated on a plate culture medium (enriched comprehensive PDA), the mycelium was collected and the total DNA was extracted. After the genomic DNA test was qualified, the DNA was fragmented by ultrasound, and then the fragmented DNA was purified, the end repaired, 3′ end A was added, and the sequencing adapter was connected. Then, the fragment size was selected by agarose gel electrophoresis, and PCR amplification was performed to form a sequencing library. The constructed library was first subjected to library quality inspection. The qualified library was sequenced with Illumina double-end sequencing, and the sequencing sequence read length was 150bp, generating more than 5G data. The raw sequencing sequence (Raw Reads) obtained by sequencing contained low-quality Reads with adapters. In order to ensure the quality of information analysis, the Raw Reads were filtered to obtain Clean Reads for subsequent information analysis. The main steps of data filtering are as follows: (1) remove reads with adapters; (2) filter reads with N content exceeding 10%; (3) remove reads with bases with quality values ​​below 10 exceeding 50%. Use BWA software to locate the obtained clean reads to the Ganoderma lucidum genome tested by our team, and use the HaplotypeCaller (local haplotype assembly) algorithm of GATK to detect InDel mutations and obtain the final set of mutation sites. Select mutation sites with more than 20bp fragment insertion in HMGIM-D150696 and Shanghai Agricultural No. 1 and Hanzhi 203 consistent with the reference genome, and select the sites with high coverage and genotype quality values ​​of the mutation sites for primer design. The primer information is as follows: D696-F1: TCTCGCAAAATCAAATTCGCAG and D696-R1: TGGTTTGACTGGGATAACGATGT. D696-F2: GATGTGAAGACGCCCTGAGAA and D696-R2: CCGGGTAAAGGTGGTTGAAGTT. The primer pair was synthesized by Shanghai Biotech Co., Ltd. Longzhi and Izumizhi bred in China were added during PCR amplification. PCR amplification was performed on a BioRad PCR instrument, and the composition of the PCR reaction solution (30 μl in total) is shown in Table 4:

[0075] Table 4 HMGIM-D150696 molecular marker PCR system

[0076]

[0077] The PCR program is: 95℃ pre-denaturation, 95℃ denaturation for 30sec, 58℃ annealing for 30sec, 72℃ extension for 30sec, GOTOstep2, execute 35 cycles, 72℃ extension for 5min, 12℃ storage to end the program. The PCR product was electrophoresed on a 1-1.5% agarose gel (5v / cm) for 25min, and photographed in a gel imaging system. The results are shown in Figure 4 and Figure 5 shown.

[0078] The primer pair D696-F1 / R1 was only effective in amplifying HMGIM-D150696 (D696) ( Figure 4 ). The nucleotide fragment amplified by the primer pair is 250-300 bp in size, and the specific DNA fragment of 250-300 bp is the InDel molecular marker of the new strain HMGIM-D150696 of Ganoderma lucidum of the present invention. The PCR product was sent to BGI for double-end sequencing to obtain specific sequence information, and the specific sequence is shown in SEQ ID NO.1.

[0079] The primer pair D696-F2 / R2 can amplify two bands in HMGIM-D150696 (D696), with sizes of 100-250 bp and 300-400 bp ( Figure 5 ), the other Ganoderma lucidum strains can only amplify a 100-250bp band, and the specific nucleotide fragment of 300-400bp is the InDel molecular marker of the new Ganoderma lucidum strain HMGIM-D150696 of the present invention. The 300-400bp PCR product was sent to BGI for forward single-end sequencing to obtain specific sequence information, and the specific sequence is shown in SEQID NO.2.

[0080] According to the sequence information obtained by sequencing the PCR product amplified by the D696-F1 / R1 primer pair, a specific primer pair for quantitative detection of HMGIM-D150696 was designed using an online primer design website (https: / / primer3.ut.ee / ), with the following information: D696-YF / YR (5'->3') GACGTCTGCAGTGATTCTGGAAC / TCATTATCTTATGGCGTTAGC AGG. The primer pair was synthesized by Sangon Biotech (Shanghai) Co., Ltd. A fluorescence quantitative PCR reaction was performed using the qPCR SYBR Green Master Mix kit (Nanjing Novogene Biotech Co., Ltd., Cat. No.: Q111). The genomic DNA of HMGIM-D150696, Hunong No. 1, Longzhi, Hanzhi, and Quanzhi was used as a template, and the primer pair D696-YF / YR was used for amplification, respectively, with 3 technical replicates for each reaction. The total volume of the reaction system was 20 μL: qPCR SYBR Green Master Mix 10 μL, PCR primer 1 (10 μmol / L) 1 μL, PCR primer 2 (10 μmol / L) 1 μL, template DNA 2 μL, add ddH2O to 20 μL. The reaction procedure was 95°C 2 min pre-denaturation, 95°C 15 s, 58°C 15 s, 72°C 20 s, 36 cycles. The reaction was performed using a fluorescent quantitative PCR instrument (Applied Biosystems QuantStudio 6&7 Real Time PCR System, Thermo Fisher). The results are shown in Figure 2. Figure 6 As shown, the amplification curves indicate that when the cycle number is less than 30, D696-YF / YR excites the fluorescence signal only in the presence of HMGIM-D150696 DNA, and other Ganoderma lucidum strains show weak fluorescence or no fluorescence at 30-34 cycles.

[0081] In summary, D696-F1 / R1, D696-F2 / R2 and D696-YF / YR can achieve specific detection of HMGIM-D150696 by agarose gel electrophoresis and fluorescence PCR, respectively.

[0082] SEQ ID NO.1

[0083] TCTCGCAAAATCAAATTCGCAGTCTTGGTAGAGCCGATCACGGCCGGTGATGACGACGA

[0084] ATGGAGATTGATTGGTATAGTACAAAGCAGAGAAAATGTTCGGCACAAGAAGGAACGAT

[0085] CTTCGTGTGCATACGACAGCAACAGGATGAAGACGTCTGCAGTGATTCTGGAACACGT

[0086] GCACCGACGACGCCAATGTCATCAGGCGATGGATGTGAAGACGCCCTGAGAAGACTATT

[0087] ACTACCTGCTAACGCCATAAGATAATGAGAAACATACGACATCGTTATCCCAGTCAAACC

[0088] A

[0089] SEQ ID NO.2

[0090] GGGGCATTGGATTTGAGTTGAGCGCTGTCCTAACGTTTGGGAGCCAACTAGTTCGATATT

[0091] GGGTCTCGCATGCCGCCCGGGTAGTATATGCCCGCACGCCATCTCAGCGAGTACTAACCT

[0092] AGTATACTATGTAACTAAGTAATCAAAGCGAAAAACGTTTTGAACCTATAATATGTATA

[0093] TGAGGGCGCGGTGGCTGTGAACGATGATAATACTTACATACTTGCTTAGTCAGCTCAGTT

[0094] GCTAGCTCTCGCTCGCGGCGACTCAGAGGCGTCCGTCCCGTCAGCCTTTCAACTTCAAC

[0095] CACCTTTACCCGG

Claims

1. Lingzhi strains ( Ganoderma lucidum ) HMGIM-D150696, the deposit number is GDMCC No: 62403.

2. A method for cultivating the Ganoderma lucidum strain HMGIM-D150696 according to claim 1, characterized in that: The steps include: mycelium cultivation of Ganoderma lucidum strain HMGIM-D150696, ganoderma management and harvesting; The specific steps are:

1. Culture medium formula Mother culture medium: by mass fraction, including 20% ​​potato + 2% glucose + 1% peptone + 2% agar + 0.3% potassium dihydrogen phosphate + 0.15% magnesium sulfate + 0.001% vitamin B1; Production seed culture medium: by mass fraction, including 98-99% sorghum + 1-2% calcium carbonate, natural pH; Cultivation material: by mass fraction, including 50% sawdust, 38% cottonseed hulls, 10% wheat bran, 2% calcium carbonate, water content 60-65%, natural pH; 2. Cultivation Process Mycelium culture: Under aseptic operation conditions, take HMGIM-D150696 preserved seed blocks and inoculate them into the mother seed culture medium, with a humidity of 50%-60%, and culture them in a constant temperature and dark at 25°C for 8-12 days until the mycelium grows all over the slope, to obtain the mother seed mycelium; transfer the mother seed mycelium to the production seed culture medium for expansion culture, and culture them in a constant temperature and dark at 25°C until the mycelium grows all over the bag, to obtain the production seed mycelium; then inoculate the production seed mycelium into the cultivation material, culture them in a constant temperature and dark at 25°C, with a humidity of 60%-70%, and ventilate regularly to keep the carbon dioxide concentration below 4000 ppm, culture them for 18-20 days until the mycelium grows all over the bag, and then culture them under the same conditions for 7-10 days for post-ripening period culture; Management of mushroom production: After the mycelium matures, buds are promoted. The lids of the cultivation bags are opened and placed vertically. The temperature is 26-28℃ and the relative humidity of the air is maintained at 90%-95%. The diffuse light is illuminated for 8 h / d. After 6 days of management, primordia begin to form at the opening of the cultivation material. The humidity is adjusted to 80-90%. When the mushroom cap begins to differentiate, fresh air is exchanged twice a day for 1 h each time. The growth points on the edge of the fruiting body disappear. The air humidity is adjusted to 80% before spraying. Harvesting: The fruiting bodies are harvested when a large number of spores are ejected from the back of the cap. The fresh weight of each bag is 46.83-61.77 g, the cap diameter is 7.75-11.40 cm, the stem height is 1.32-3.02 cm, and the cap thickness is 8.90-10.81 mm.

Images