Gene encoding MsFER1 in alfalfa and its protein and application

Abstract

The invention discloses an alfalfa MsFER1 coding gene and a protein and application thereof. The coding region of the MsFER1 gene is shown as SEQ ID NO.2, and the amino acid sequence of the protein is shown as SEQ ID NO.1. The invention first determines that the expression of the MsFER1 gene is induced by salt stress through a qRT-PCR (real-time fluorescence quantitative) experiment, and then overexpresses the MsFER1 gene in Arabidopsis thaliana, and finds that the transgenic Arabidopsis thaliana has stronger salt tolerance than the wild-type Arabidopsis thaliana. The salt tolerance research of the MsFER1 gene provided by the invention provides a new gene resource for the molecular design breeding of alfalfa salt tolerance, has a certain reference and reference value for cultivating alfalfa salt-tolerant new material, and can have a substantial impact on my country's animal husbandry, agriculture, forestry and the like.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to an alfalfa MsFER1 encoding gene and a protein and application thereof. Background Art

[0002] Alfalfa (Medicago sativa L.) is a perennial herbaceous plant of the genus Medicago in the Leguminosae family. It is one of the largest forage grasses in the world and is known as the "king of forage grasses" for its nutritional value and high aboveground biomass. Alfalfa has good palatability, high nutritional value, is rich in various trace elements, and is rich in protein. The crude protein content of alfalfa reaches 16%-22%, and the content during the bud formation period is 2.74 times that of corn, mainly distributed in the leaves. Roughage is an important feed source for ruminants. A diet using crop straw as a source of roughage can only meet the nutritional needs of a dairy cow with a unit yield of 5,000 kg. A diet using ordinary hay and silage corn as a source of roughage can maintain the nutritional needs of a dairy cow with a unit yield of 7,000 kg. Feeding high-quality alfalfa hay can reach a unit yield of more than 8,000 kg. Alfalfa is a high-quality feed that is very important to animal husbandry. It is of great significance to improve the quality and yield of alfalfa, develop the animal husbandry industry, promote the structural reform of the agricultural supply and economic side, promote the overall planning of agricultural economics and feed, and improve the competitiveness of grass products and livestock products in the market. Improving alfalfa silage storage technology can alleviate the contradiction between the supply and demand of high-quality protein feed in my country, reduce breeding costs, and improve the economic benefits of the breeding industry.

[0003] The north of my country is the main cultivation area of ​​alfalfa, and it is also an area with a large distribution of drought and saline-alkali land. In recent years, affected by global warming, the problems of seasonal drought and increased soil salinization in my country have become increasingly prominent. In the life cycle of alfalfa, the seedling growth period is a sensitive period and is easily affected by drought and salt stress. Salt stress can inhibit the growth of plants by affecting the osmotic pressure in alfalfa, the photosynthesis of plants, and the activity of some specific enzymes. With the rapid development of the domestic alfalfa industry, the domestic demand for alfalfa seeds continues to grow, and there is a large gap in the domestic seed supply. Therefore, it is very common to introduce a large number of foreign varieties for use in production. However, how to effectively evaluate the tolerance of introduced varieties to drought and salinity before use to reduce production losses caused by blind selection is a major difficulty in actual production applications.

[0004] Plant ferritin responds to abiotic stress factors such as high salt, high light intensity, high temperature, and heavy metals, and is considered to be a stress response-related protein. The ability of plants to regulate the internal redox environment and their antioxidant capacity are closely related to stress tolerance. Enzymatic detoxification and metal ion chelation balance are two important mechanisms to prevent the generation of highly toxic hydroxyl radicals and protect cells from oxidative damage. Plants participate in antioxidant pathways to respond to toxic free radicals by increasing the transcription of antioxidant genes such as SOD (superoxide dismutase), CAT (catalase), and FER (ferritin). Barley HvFER1 is strongly expressed in seedling leaves induced by PEG and salt stress, and its expression increases with the extension of stress time, reaching a peak and then rapidly decreasing, indicating that HvFER1 has a typical adverse stress response pattern.

[0005] The methods for mining abiotic stress tolerance genes in alfalfa mainly include homologous cloning, transcriptomics, proteomics, GWAS, etc. In recent years, breakthrough progress has been made in alfalfa research. Mining some genes related to abiotic stress tolerance and identifying their related functions are of great significance for increasing alfalfa yield, improving alfalfa quality, and expanding the scale of alfalfa production and planting, which will provide broader prospects for the development of feed and animal husbandry. Summary of the invention

[0006] The technical problem to be solved by the present invention is to overcome the defects of the above-mentioned technology and provide alfalfa MsFER1 encoding gene and protein and application thereof.

[0007] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0008] The invention provides an alfalfa MsFER1 gene, and the coding region of the MsFER1 gene is shown as SEQ ID NO.2.

[0009] Furthermore, the fluorescent quantitative PCR primers of the MsFER1 gene are SEQ ID No.4 and SEQ ID No.5.

[0010] The present invention also provides a protein encoded by the MsFER1 gene described in the above technical solution, and the amino acid sequence of the protein is shown in SEQ ID NO.1.

[0011] The present invention also provides the use of the alfalfa MsFER1 gene described in the above technical solution in improving the tolerance of Arabidopsis thaliana to salt stress.

[0012] Furthermore, the application includes the following steps: introducing the MsFER1 gene into Arabidopsis thaliana via a recombinant expression vector, culturing, and obtaining Arabidopsis thaliana with salt stress tolerance; the introduction is achieved via a recombinant expression vector, and the recombinant expression vector is obtained by inserting the gene into the recombination site of the enzyme cutting system vector pBIB-BASTA-35S-GWR-FLAG.

[0013] Compared with the prior art, the invention has the following advantages: the invention first determines that the expression of the MsFER1 gene is induced by salt stress through a qRT-PCR (real-time fluorescence quantitative) experiment, and then overexpresses the MsFER1 gene in Arabidopsis thaliana to find that the transgenic Arabidopsis thaliana has stronger salt tolerance than the wild-type Arabidopsis thaliana; the salt tolerance research of the MsFER1 gene provided by the invention provides a new gene resource for the molecular design breeding of salt tolerance of alfalfa, has a certain reference and reference value for cultivating new salt-tolerant materials of alfalfa, and can have a substantial impact on my country's animal husbandry, agriculture, forestry and the like. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is a comparison chart of the amino acid sequence homology between MsFER1 of the present invention and other 12 species.

[0015] Figure 2 This is a graph showing the qRT-PCR expression results of the MsFER1 gene of the present invention when it is induced by stress;

[0016] A: The expression of MsFER1 protein in the aboveground and underground parts of alfalfa at different time points under the condition of a final concentration of 80 μM;

[0017] B: Expression of MsFER1 protein in the aboveground and underground parts at different time points under the condition of NaC1 final concentration of 150 mM;

[0018] C: Expression of MsFER1 protein in the aboveground and underground parts at different time points when the final concentration of Mannito1 was 500 mM.

[0019] Figure 3 is a correlation diagram of the target gene in transgenic Arabidopsis thaliana by molecular detection of the present invention;

[0020] A: Nucleic acid electrophoresis, M is DL5000 Marker, Control is water control, 1-21 are 21 homozygous strains of T3 generation;

[0021] B: Bar graph of related protein expression, Col-0 (Colombia ecotype) is the wild type, OE1 to OE21 are 21 homozygous strains of T3 generation.

[0022] Figure 4This is a comparison result diagram of the salt tolerance of the transgenic and wild-type Arabidopsis seedlings of the present invention.

[0023] Figure 5 This is a comparison result diagram of the salt tolerance of transgenic and wild-type Arabidopsis seeds during germination;

[0024] The germination conditions of T3 lines OE2, OE15, OE16 and wild-type line Col-0 in MS medium, MS medium containing 100 mM NaCl and 150 mM NaCl were compared.

[0025] Figure 6 It is a comparison chart of the growth conditions of T3 strains OE2, OE15, OE16 and wild-type strain Col-0 of the present invention under normal water supply (Before salt treatment) and after salt stress treatment (Salt treatment 35 days). DETAILED DESCRIPTION

[0026] The alfalfa MsFER1 encoding gene and its protein and application of the present invention are further described in detail below in conjunction with the examples.

[0027] Example 1 Cloning and sequencing of the MsFER1 coding gene comprises the following steps:

[0028] Plant material: Alfalfa Zhongmu No. 1.

[0029] Under normal conditions, healthy and plump seeds were germinated in a culture dish covered with double-layer filter paper for 5 days. When the cotyledons of the seedlings unfolded, they were moved to the prepared 1 / 2MS nutrient solution (PH = 5.8). After 7 days of cultivation, NaCl was added to the 1 / 2MS nutrient solution to a final concentration of 150mM and treated for 24 hours. The above-ground and underground parts of the plants were quickly taken, frozen in liquid nitrogen, and stored at -80°C for later use.

[0030] The RNA of the sample was extracted by Trizo1 extraction method, and then reverse transcribed into cDNA using cDNA synthesis reverse transcription kit. The total volume of the PCR detection system was 20 μL, the system was primer (SEQ ID No.4) MsFER1-F (5'-3'): CTCATGGCTCTTTCTTGTTC 1 μL, primer (SEQ ID No.5) MsFER1-R (5'-3'): GATTAAACAGCATGTTCCTC 1 μL, 2×EcoTaqPCR SuperMix 10 μL, ddH2O 6 μL and cDNA 2 μL; the reaction program was: the first round: 94℃ pre-denaturation 3min; the second round: 94℃ denaturation 30s, 56℃ annealing 30s, 72℃ extension 30s, the second round cycle 38 times; the third round: 72℃ extension 7min; 16℃ termination, the reaction was completed.

[0031] The result of electrophoresis in 1% agarose was that the length of the target gene was 771 bp. The DNA fragment of the gene was recovered and double-digested with the expression vector pBIB-BASTA-35S-GWR-FLAG. BamHI and ScalI were selected as the restriction sites. The restriction results were confirmed by gel electrophoresis. Then, the DiaSpin column DNA gel recovery kit (B110092, Shanghai Shenggong Biotechnology Co., Ltd.) was used to recover the product. Finally, T4 DNA ligase (M0202, New England Biolabs Beijing Co., Ltd.) was used to connect the target fragment after restriction digestion with the expression vector, and transferred into Escherichia coli DH5a competent cells, evenly coated on LB resistance plates containing Kan, cultured overnight in a 37°C incubator, detected and selected appropriate positive clone plaques, and selected into liquid culture medium containing Kan resistance, and cultured overnight in a 37°C shaker at 200 rpm. After the bacterial solution was detected to be suitable, it was sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the colony had the nucleotide sequences in SEQ ID No.2 (DNA) and SEQ ID No.3 (cDNA), which were named MsFER1 gene, and the protein encoded by the gene was named MsFER1 protein, and the protein sequence was shown in SEQ ID No.1.

[0032] MsFER1 protein was compared with 12 other species in GeneBank ( Figure 1 ), which has the highest homology with XP_003623359.1 of Medicago truncatula.

[0033] Example 2 Example 2: qRT-PCR analysis of the expression characteristics of the MsFER1 encoding gene

[0034] The steps include:

[0035] The germination and hydroponic culture of alfalfa seeds were the same as in Example 1, and the stress treatment was performed on 12-day-old alfalfa seedlings:

[0036] Drought treatment: Mannitol was added to 1 / 2MS hydroponic nutrient solution to a final concentration of 500 mM, and the treatment time was 0, 1, 3, 6, 12 and 24 h. The above-ground and underground parts of the plants were quickly taken, and the samples were frozen in liquid nitrogen and stored at -80 °C for later use.

[0037] Salt treatment: NaCl was added to 1 / 2MS hydroponic nutrient solution to a final concentration of 150 mM, and the treatment time was 0, 1, 3, 6, 12 and 24 h. The above-ground and underground parts of the plants were quickly taken, and the samples were frozen in liquid nitrogen and stored at -80 °C for later use.

[0038] ABA treatment: ABA was added to 1 / 2MS hydroponic nutrient solution to a final concentration of 80 μM, and the treatment time was 0, 1, 3, 6, 12 and 24 h. The aboveground and underground parts of the plants were quickly taken, and 3 technical replicates were set for each sample. The samples were quickly frozen in liquid nitrogen and stored at -80 °C for later use.

[0039] The sample RNA extraction and reverse transcription cDNA method are the same as in Example 1. The cDNA is diluted to 50 ng / μL. The sample is amplified and detected with (SEQ ID No. 6) qRTMsFER1-F (5'-3'): CGGTTCCTTTGACTGGGGTT and (SEQ ID No. 7) qRTMsFER1-R (5'-3): ACGAGCCAAAGAAACTTGAGGA, and MsACTIN-F (5'-3'): GACAATGGAACTGGAATGG and MsACTIN-R (5'-3'): CAATACCGTGCTCAATGG as internal references. The total volume of the qRT-PCR detection system was 10 μL, and the system was primer qRTMsFER1-F 0.2 μL, primer qRTMsFER1-R 0.2 μL, 2xSGFastqPCR Master Mix 5 μL, DNF buffer 1 μL, ddH2O26 μL and cDNA 1 μL: the reaction procedure was: first round: 95°C pre-denaturation for 10 min; second round: 95°C denaturation for 15 s, 60°C annealing for 1 min, second round cycle 40 times, the reaction was completed. The instrument was ABI7500 real-time fluorescence quantitative PCR.

[0040] Exploit 2 -ΔΔCt Method to calculate relative expression. ΔΔCt=(C t.目的基因 -C t.内参基因 ) Timex -(C t.目的基因-C t.内参基因 ) Time0 ;Time x represents any five time points of adversity treatment, specifically 1h, 3h, 6h, 12h or 24h. Time 0 represents 0h of adversity treatment (control group). Origin 9 software was used for drawing.

[0041] The experimental results are shown in Figure 2 The results showed that MsFER1 gene was induced by Mannitol, NaCl and ABA in both the aboveground and underground parts of alfalfa, indicating that MsFER1 gene level was affected under adverse conditions, but the degree of influence aboveground and underground was different.

[0042] Example 3 Application of MsFER1 in improving stress resistance of Arabidopsis

[0043] It is worth noting that Arabidopsis thaliana is used as a model plant in the present invention to perform functional analysis and verification of the MsFER1 gene, and the conclusions thereof can be considered equivalent to the molecular mechanism of MsFER1 in alfalfa regulating plant response to salt stress.

[0044] The experimental operation of this embodiment includes the following steps:

[0045] 1. Preparation of MsFER1-transgenic Arabidopsis

[0046] 1. Construction of recombinant vector

[0047] 1) Cloning of MsFER1 gene

[0048] Primers MsFER1-GF and MsFER1-GR were designed according to the sequence of MsFER1 gene, and BamHI and ScalI restriction sites were introduced into the 5' end of the primers respectively: (SEQ ID No.8) MsFER1-GF (5'-3'): CGGGGTACCCTCATGGCTCTTTCTTGTTC (SEQ ID No.9) MsFER1-GR (5'-3'): CGCGTCGACAACAGCATGTTCCTCATGAAG.

[0049] The cDNA of alfalfa in Example 1 was used as a template, and PCR amplification was performed using MsFER1-GF and MsFER1-GR. The total volume of the PCR amplification system was 50 μL, including 10 μL of 5×Phusion HF Buffer, 4 μL of 2.5 mM dNTP, 1 μL of primers MsFER1-GF, 1 μL of MsFER1-GR, 32.5 μL of ddH2O, 0.5 μL of Phusion DNA Polymerase, and 1 μL of cDNA; the amplification conditions were as follows: first round: 98°C pre-denaturation for 30 s; second round: 98°C denaturation for 10 s, 56°C annealing for 30 s, 72°C extension for 15 s, and 32 cycles of the second round; third round: 72°C extension for 5 min; fourth round: 16°C termination.

[0050] 2) Enzyme digestion of MsFER1 gene and expression vector

[0051] The results of electrophoresis in 1% agarose gel showed that the length of the target gene was 771 bp. The DNA fragment of the gene was recovered and double-digested with the expression vector pBIB-BASTA-35S-GWR-FLAG. The restriction sites were BamHI and ScalI. The restriction results were confirmed by gel electrophoresis, and the product was then recovered using the DiaSpin column DNA gel recovery kit (B110092, Shanghai Sangon Biotechnology Co., Ltd.).

[0052] 3) Ligation of MsFER1 gene and expression vector

[0053] The target fragment after enzyme digestion was connected to the expression vector using T4 DNA ligase (M0202, New England Biolabs Beijing Co., Ltd.), and then transferred into E. coli DH5a competent cells, evenly spread on LB resistance plates containing Kan, cultured overnight in a 37°C incubator, detected and selected appropriate positive clone plaques, and selected into liquid culture medium containing Kan resistance, and cultured overnight in a 37°C shaker at 200 rpm. After the bacterial liquid was detected to be appropriate, it was sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. The positive clone colony with a completely consistent CDS sequence of the MsFER1 gene was obtained and the plasmid was extracted.

[0054] 4) Obtaining recombinant Agrobacterium

[0055] The recombinant pBIB-BASTA-35S-GWR-FLAG-MsFER1 vector was used to transform into Agrobacterium EHA105 to obtain recombinant Agrobacterium pBIB-BASTA-35S-GWR-FLAG-MsFER1. The bacterial solution was mixed with 50% glycerol in a volume ratio of 1:1, quick-frozen in liquid nitrogen, and stored at -80°C for later use.

[0056] 2. Transgenic MsFER1 Arabidopsis

[0057] Take out the recombinant Agrobacterium EHA105 / pBIB-BASTA-35S-GWR-FLAG-MsFER1 from -80°C and place it on ice. Pick out some frozen-thawed bacterial blocks and put them in 3 mL LB liquid with resistance to rifampicin and kanamycin. Shake them in a shaker at 200 rpm at 28°C for 24 h.

[0058] Take 2 mL of the activated bacterial solution of shaking culture and add it to 200 mL of LB liquid, with resistance to rifampicin and kanamycin, and shake it in a shaker at 28°C and 200 rpm for 20 h-24 h until OD600 = 1.2-2.0.

[0059] Take part of the bacterial suspension and centrifuge it at 4500g for 15 min. Pour away the LB liquid and resuspend and dilute it to OD600=0.8 in flower soaking buffer with 5% sucrose.

[0060] The Arabidopsis thaliana (Col-0) inflorescence (the fruit pods can be cut off in the first 2 days to improve transfection efficiency) was immersed in the invasion dye solution for 3-5 seconds;

[0061] After soaking, keep the plants in darkness for 24 hours, continue to cultivate in the greenhouse, and infect them for the second time after one week.

[0062] The T1 generation seeds were harvested, and the positive plants were screened with kanamycin (Kan, 10 mg / mL) and passaged until homozygous strains were obtained in the T3 generation.

[0063] The T2 generation refers to the seeds produced by self-pollination of the T1 generation and the plants grown from the seeds, and the T3 generation refers to the seeds produced by self-pollination of the T2 generation and the plants grown from the seeds.

[0064] The whole plant DNA of the T3 generation regenerated plant was used as a template, and PCR amplification was performed using the target gene primer pair (SEQ ID No. 10) 35sF (5'-3'): GATGACGCACAATCCCACTATC and (SEQ ID No. 5) MsFER1-R (5'-3'): GATTAAACAGCATGTTCCTC, and the Kan primer pair (SEQ ID No. 11) NPTII-F (5'-3'): CAATCCACATCGGCCAGAT and (SEQ ID No. 12) NPTII-R (5'-3'): AGCTGCCTGTTCCAAAGG. The PCR detection system and amplification conditions of the target gene and Kan gene were consistent. The PCR detection system was as follows: the total volume of PCR was 20 μL, including 10 μL of 2×EcoTaq PCR SuperMix, 1 μL of upstream primer, 1 μL of downstream primer, 6 μL of ddH2O and 2 μL of DNA template (50 ng / μL); the amplification conditions were as follows: (1) pre-denaturation at 94°C for 4 min; (2) denaturation at 94°C for 30 s; (3) annealing at 56°C for 30 s; (4) extension at 72°C for 30 s; (5) 35 cycles of steps 2-4; and (6) extension at 72°C for 7 min. The results were as follows: Figure 3 As shown in (A), 21 homozygous strains of the T3 generation amplified a single band at 771 bp.

[0065] The qRT-PCR system included 2xSG Fast qPCR Master Mix 10 μL, primer qRTMsFER1-F 0.5 μL, primer qRTMsFER1-R 0.5 μL, DNF buffer 2 μL, ddH2O 5 μL and cDNA 2 μL, with a total volume of 20 μL. The qRT-PCR amplification conditions were: (1) pre-denaturation at 95°C for 10 min; (2) denaturation at 95°C for 15 s; (3) annealing at 60°C for 1 min; (4) steps (2) to (3) were cycled 40 times. The results are shown in Figure 2. Figure 4 As shown in (B), MsFER1 is not expressed in the wild-type strain (Col-0), but is expressed to varying degrees in the homozygous strains. Three highly expressed strains were selected from the homozygous strains for subsequent physiological analysis.

[0066] 2. Evaluation of salt tolerance of transgenic plants

[0067] 1. Effect of salt stress on root length

[0068] After the seeds of three representative strains of T3 generation MsFER1-transgenic Arabidopsis, OE2, OE15, OE16 and wild-type Col-0, were disinfected, healthy and plump seeds were selected, and evenly spotted on the culture medium (MS culture medium, MS culture medium containing 150mmol / LNaCl) with a 10μL pipette tip, sealed with a sealing film, and moved into an incubator with a temperature of 22℃, a light duration of 16h, and a relative humidity of 60% for 7 days after vernalization. Three transgenic strains with consistent root lengths and wild-type Col-0 seedlings were selected and moved to MS culture medium and MS culture medium containing 150mMNaCl, respectively. After 10 days of cultivation, the relative root length and the number of lateral roots of each strain were counted. Three biological replicates were set for each treatment, the results were averaged, and the standard deviation was calculated.

[0069] The results are as follows Figure 4 As shown, on MS plates, the root length and lateral root number of the wild type and transgenic lines were basically the same; on 150mmol / LNaCl plates, there was no significant difference in the relative root length between the wild type and transgenic lines; and on 150mmol / LNaCl plates, the number of lateral roots of the transgenic lines was significantly greater than that of the wild type.

[0070] 2. Effect of salt stress on germination rate

[0071] After disinfection, 50 seeds of each of the three representative strains of T3 generation MsFER1-transfected Arabidopsis thaliana, OE2, OE15, OE16 and wild type Col-0, were evenly spotted on MS medium and MS medium containing 100 mmol / L and 150 mmol / L NaCl using a 10 μL pipette tip. The medium was sealed with a sealing film and treated at 4°C for 3 days. The medium was then moved into an incubator at 22°C, 16 h light, 8 h dark, and 60% relative humidity for 7 days. The germination rate was counted every day. Three biological replicates were set for each treatment. The results were averaged and the standard deviation was calculated.

[0072] The results are as follows Figure 5 As shown, on MS plates, the germination rate and germination rate of the wild type and transgenic lines were basically the same; on 100mmo1 / L and 150mmol / LNaCl plates, the germination rate and germination rate of the MsFER1-transgenic Arabidopsis lines were significantly greater than those of the wild type.

[0073] 3. Effects of soil salt stress on resistance of transgenic plants

[0074] The plant materials were three representative strains of T3 generation MsFER1 Arabidopsis thaliana, OE2, OE15, OE16 and wild type Col-0. After the seeds of each strain were sterilized, healthy and plump seeds were selected and evenly dotted on the culture medium with a 10μL pipette tip and sealed with a sealing film. After 3 days of vernalization, they were moved into an incubator with a temperature of 22°C, a light time of 16h, and a relative humidity of 60% for 14 days. The seedlings were moved to small square pots with the same soil weight in each pot. There were 4 wild-type and transgenic plants in each pot. After 14 days of normal culture, salt treatment began. Each small square pot was watered with 200mmol / L NaCl solution every 3 days. The phenotypes were observed, the survival rate was counted, and photos were taken.

[0075] The results are as follows Figure 6 As shown, before salt treatment, the growth conditions of the transgenic strains and the wild type were basically the same; after salt treatment, the growth of the transgenic strains was significantly better than that of the wild type.

[0076] The present invention provides a MsFER1 protein with stress tolerance function. First, the expression of the MsFER1 gene is determined to be induced by salt stress through qRT-PCR experiments. Then, after the MsFER1 gene is overexpressed in Arabidopsis, it is found that the transgenic Arabidopsis has stronger salt tolerance than the wild-type Arabidopsis. The salt tolerance research of the MsFER1 gene provided by the present invention provides a new gene resource for the molecular design breeding of salt tolerance of alfalfa, has reference and reference significance for cultivating and obtaining plants with salt tolerance and new varieties with enhanced functions, and has brought substantial impacts on my country's animal husbandry, agriculture, forestry, etc.

[0077] The present invention and its embodiments are described above, and such description is not restrictive. The drawings show only one embodiment of the present invention, and the actual structure is not limited thereto. In short, if ordinary technicians in the field are inspired by it, without departing from the purpose of the invention, they can design a structure and embodiment similar to the technical solution without creativity, which should belong to the protection scope of the present invention.

Claims

1. The alfalfa MsFER1 gene is characterized by: The coding region of the MsFER1 gene is shown in SEQ ID NO.

2.

2. The alfalfa MsFER1 gene according to claim 1, characterized in that: The fluorescent quantitative PCR primers of the MsFER1 gene are SEQ ID No.4 and SEQ ID No.

5.

3. The protein encoded by the alfalfa MsFER1 gene according to any one of claims 1-2, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

1.

4. Use of the alfalfa MsFER1 gene according to claim 1 or 2 in improving the tolerance of Arabidopsis thaliana to salt stress.

5. The use according to claim 4, characterized in that: The following steps are involved: The MsFER1 gene is introduced into Arabidopsis thaliana through a recombinant expression vector, and cultured to obtain Arabidopsis thaliana with salt stress tolerance; the introduction is achieved through a recombinant expression vector, and the recombinant expression vector is obtained by inserting the gene into the recombination site of an enzyme cutting system vector pBIB-BASTA-35S-GWR-FLAG.

Images