Application of CROT in the preparation of diagnostic reagents and therapeutic drugs for paclitaxel-resistant ovarian cancer
By discovering that CROT is related to the survival of ovarian cancer and paclitaxel resistance, CROT is provided as a diagnostic marker and therapeutic target, solving the problem of difficulty in early diagnosis of ovarian cancer and reversing paclitaxel resistance in the prior art, and achieving the effect of improving the efficacy of chemotherapy and early detection rate.
Patent Information
- Application Number
- CN202210950971.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-09
- Publication Date
- 2025-03-18
- Estimated Expiration
- 2042-08-09
AI Technical Summary
The prior art is difficult to effectively diagnose ovarian cancer in the early stage and reverse paclitaxel resistance, resulting in poor treatment effect and poor patient outcomes.
Through experimental detection such as high-throughput sequencing, qPCR and WB, it was found that CROT is related to the survival of ovarian cancer and paclitaxel resistance, providing CROT genes or proteins as diagnostic markers and therapeutic targets, and preparing reagents and drugs for diagnosis and treatment.
The reduced expression level of CROT is related to the proliferation, invasion and migration of ovarian cancer cells and is related to paclitaxel resistance. By restoring the expression of CROT, the sensitivity of ovarian cancer cells to paclitaxel can be increased, the efficacy of chemotherapy can be improved, and a new diagnostic method can be provided to improve the early detection rate.
Smart Images
Figure CN115896283B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of biomedical technology, in particular to the application of preparing and detecting CROT molecules to diagnose ovarian cancer and to improve CROT expression in treating paclitaxel-resistant ovarian cancer. Background Art
[0002] The global incidence of ovarian cancer ranks second among malignant tumors of the female reproductive system. The most common pathological type of ovarian cancer is epithelial ovarian cancer, which is difficult to treat clinically because the ovaries are located deep in the pelvic cavity. Early epithelial ovarian cancer has no specific symptoms, resulting in these patients often having ascites or abdominal masses when they seek medical treatment, which is a late stage. Currently, 70% of patients are already in the late stage when they seek medical treatment, and are often accompanied by recurrence and drug resistance. The incidence of this type of cancer ranks third among gynecological malignancies, but its mortality rate ranks first, which shows that it is related to its late discovery and poor prognosis. Therefore, early diagnosis and resolution of recurrence and drug resistance have become urgent problems to improve the prognosis of patients with epithelial ovarian cancer.
[0003] The current standard first-line treatment is a chemotherapy regimen of platinum combined with paclitaxel after tumor reduction surgery. The mechanism of paclitaxel is to promote microtubule polymerization, making it impossible for them to depolymerize, so they cannot connect with the microtubule organizing center, so they cannot form spindles, making it impossible to complete the normal cell division cycle, leading to cell death. In the mechanism of paclitaxel resistance, studies on changes in tubulin mediating paclitaxel resistance have found that acetylation modification of microtubules will lead to reduced stability of microtubules, thereby promoting the occurrence of paclitaxel resistance. In addition, mutations in β-tubulin weaken the lateral reinforcement of microtubules and reduce stability, leading to the occurrence of paclitaxel resistance, but this has only been confirmed in in vitro experiments, and the existence of this mutation has not yet been confirmed in humans. In this way, there are also changes in the expression of other microtubule-related proteins, which ultimately affect the sensitivity of paclitaxel by affecting the stability of microtubules.
[0004] Among them, for paclitaxel resistance in ovarian cancer, researchers have explored a variety of mechanisms that mediate paclitaxel resistance in ovarian cancer, including: 1. Changes in microtubules; 2. Upregulation of p-gp; 3. Overexpression of anti-apoptotic proteins or inhibition of apoptotic proteins; 4. Changes in cytokines and signaling pathways; 5. Detoxification of GSH. Upregulation of p-gp has been shown to mediate resistance to a variety of chemotherapeutic drugs. P-gp is a transmembrane glycoprotein. As a drug transporter, its upregulation will lead to increased excretion of paclitaxel, weakened drug efficacy, and poor treatment effect. Overexpression of anti-apoptotic proteins or inhibition of apoptotic proteins mainly inhibits paclitaxel-mediated cell apoptosis, reduces cell death, and weakens drug efficacy. The study of changes in cytokines and signaling pathways mediating paclitaxel resistance is relatively broad. For example, the phosphoinositide 3-kinase / protein kinase B (PI3K / Akt) signaling pathway has been shown to play a key driving role in a variety of cancers, and its overactivation has also been shown to mediate the occurrence of paclitaxel resistance. The detoxification of glutathione (GSH) also plays a role in paclitaxel resistance. Paclitaxel not only affects the normal division of cells by stabilizing microtubules, but also, as a cytotoxic drug, causes stress responses in cells. At this time, the production of reactive oxygen species (ROS) in cells increases, which plays an oxidative damage role. There are many antioxidant molecules in cells, and the known classic function of GSH is to resist oxidative damage. It can offset the increase of reactive oxygen species in cells caused by paclitaxel, thereby weakening the killing effect of paclitaxel, and is also called a "detoxification agent". For this reason, several methods for reversing ovarian cancer resistance to paclitaxel have been proposed.
[0005] The standard treatment for ovarian cancer is surgery assisted by platinum-based chemotherapy combined with paclitaxel. Most patients achieve significant results in the early stages of treatment, but most will relapse within 2 years. Recurrent ovarian cancer is resistant to almost all chemotherapy drugs, which greatly limits the clinical efficacy and application scope of chemotherapy and is also the main reason for the failure of ovarian cancer treatment. Currently, there is no effective adjuvant drug available clinically to reverse paclitaxel resistance in ovarian cancer.
[0006] CROT is a carnitine O-octanoyltransferase that catalyzes the reversible transfer of fatty acyl groups between acetyl-coenzyme A (CoA) and carnitine. It is responsible for regulating the decomposition of very long-chain fatty acids, mainly playing a key role in the process of transferring medium-length acyl chains from peroxidases to the cytoplasm and mitochondria for further decomposition. The current research results show that CROT has the function of promoting fatty acid metabolism and mitochondrial dysfunction. The results of high-throughput sequencing and bioinformatics analysis show that CROT is correlated with the prognosis of prostate cancer and paclitaxel resistance in breast cancer. In addition, through the analysis of high-throughput sequencing, it was found that CROT is correlated with paclitaxel resistance in breast cancer, but there is no relevant biological function experimental conclusion to support it.
[0007] At present, there are no reports that CROT inhibits the survival of epithelial ovarian cancer cells and increases the sensitivity of ovarian cancer to paclitaxel. However, it is necessary to confirm through experiments that CROT has the effect of inhibiting the growth, invasion and metastasis of epithelial ovarian cancer cells and increasing the sensitivity of ovarian cancer to paclitaxel. Summary of the invention
[0008] The inventors of the present application used high-throughput sequencing, qPCR, WB and other experimental tests to find that CROT is associated with the drug resistance of paclitaxel-resistant ovarian cancer and the survival of epithelial ovarian cancer, and completed the present invention based on this.
[0009] In a first aspect, the present invention provides the use of CROT gene or protein as a diagnostic marker in the preparation of an epithelial ovarian cancer or epithelial ovarian cancer prognosis or paclitaxel-resistant ovarian cancer diagnostic reagent or kit.
[0010] In a second aspect, the present invention provides the use of a reagent for detecting the content of CROT gene or protein in the preparation of a diagnostic reagent or kit for epithelial ovarian cancer or epithelial ovarian cancer prognosis or paclitaxel-resistant ovarian cancer.
[0011] As another preferred example of the present invention, the reagent for detecting the CROT gene or protein content is selected from primers that specifically amplify the CROT gene; or probes that specifically recognize the CROT gene or its transcript; or antibodies that specifically resist the CROT protein.
[0012] As a preferred example of the present invention, the kit further comprises a primer pair for detecting CROT gene or protein, and the primer pair is shown as SEQ ID NO:1 and SEQ ID NO:2.
[0013] As another preferred example of the present invention, the epithelial ovarian cancer or epithelial ovarian cancer prognosis or paclitaxel-resistant ovarian cancer diagnostic reagent or kit includes: nucleic acid extraction reagent; and / or polymerase chain reaction reagent; and / or protein immunoblotting reagent; and / or enzyme-linked immunosorbent assay reagent.
[0014] As another preferred example of the present invention, the diagnostic samples of the epithelial ovarian cancer or epithelial ovarian cancer prognosis or paclitaxel-resistant ovarian cancer diagnostic reagent or kit are tissues, serum, plasma and urine.
[0015] In a third aspect, the present invention provides the use of CROT proteins or their enhancers in the preparation of drugs for treating epithelial ovarian cancer or epithelial ovarian cancer prognosis or paclitaxel-resistant ovarian cancer.
[0016] As a preferred example of the present invention, the synergist is selected from small molecule compounds or biomacromolecules.
[0017] As another preferred embodiment of the present invention, the synergist is selected from agonists, upregulators or stabilizers. CROT synergist and its use.
[0018] The "CROT enhancer" includes agonists, upregulators, stabilizers, etc., and refers to any substance that can increase the activity of CROT, increase the stability of CROT, upregulate the expression of CROT, and increase the effective action time of CROT. These substances can be used in the present invention. They can be compounds, small chemical molecules, biological molecules, etc. The biological molecules can be at the nucleic acid level (including DNA, RNA), at the protein level, or can be viral products that upregulate CROT expression, etc.
[0019] The present invention has the advantages that:
[0020] The present invention uses a variety of experimental detection methods such as high-throughput sequencing, qPCR and WB to confirm that the expression of CROT is reduced in epithelial ovarian cancer cells / paclitaxel-resistant ovarian cancer cells, and the upregulation of CROT in ovarian cancer cells will inhibit the proliferation, invasion and migration of ovarian cancer cells and promote the apoptosis of ovarian cancer cells. The expression amount of CROT is positively correlated with the sensitivity of paclitaxel-resistant ovarian cancer cells to paclitaxel, and can reverse the drug resistance of paclitaxel-resistant ovarian cancer cells to paclitaxel, and increase the clinical chemotherapy efficacy of paclitaxel. At the same time, the different degrees of decrease in CROT expression levels can allow the kit to detect whether it is paclitaxel-resistant ovarian cancer or ovarian cancer, thereby improving the early detection rate of paclitaxel-resistant ovarian cancer and ovarian cancer patients, facilitating early prevention and treatment, and improving the survival rate of patients. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Attached Figure 1 These are the results of qPCR, bioinformatics analysis, WB and immunohistochemistry experiments.
[0022] Attached Figure 2 qPCR and WB experiments verified the knockdown and overexpression effects of CROT.
[0023] Attached Figure 3 It is a cell cycle experiment.
[0024] Attached Figure 4 It is an invasion, migration and colony formation assay.
[0025] Attached Figure 5 This is an ovarian cancer cell apoptosis experiment.
[0026] Attached Figure 6 It is the analysis of sequencing results and qPCR experiments.
[0027] Attached Figure 7 It is a cytotoxicity assay.
[0028] Attached Figure 8 It is an apoptosis experiment of paclitaxel-resistant ovarian cancer cells. DETAILED DESCRIPTION
[0029] The specific embodiments provided by the present invention are described in detail below in conjunction with the accompanying drawings. If not otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and can be carried out with reference to the third edition of "Molecular Cloning Experiment Guide" or related products, and the reagents and products used are also commercially available. Various processes and methods not described in detail are conventional methods known in the art, and the sources, trade names, and components of the reagents used are indicated when they first appear, and the same reagents used thereafter are the same as those indicated for the first time unless otherwise specified.
[0030] Example 1 Cell experiment
[0031] 1. Cell culture:
[0032] IOSE-80 is a normal ovarian epithelial cell, SK-OV3, OVCAR-3 and A2780 are epithelial ovarian cancer cells, A2780-PTX is a paclitaxel-resistant ovarian cancer cell constructed based on the parental mother cell A2780, wherein the culture medium used for IOSE-80 and OVCAR-3 cells is PRIM-1640 supplemented with 10% fetal bovine serum, the culture medium used for A2780 and A2780-PTX is DMEM culture medium supplemented with 10% fetal bovine serum, and SK-OV-3 is McCoys-5A culture medium supplemented with 10% fetal bovine serum.
[0033] 2. Construction of plasmid overexpressing CROT:
[0034] 1) PCR amplification and product purification: For the full-field CDS amplification of CROT, high-fidelity enzyme amplification was used. 2xPrimeSTARMax Premix 12.5uL, 10pmol of each of the front and rear primers and 0.5ul of 50ng / ul template cDNA, and the rest was supplemented to 25ul with DEPC water. After the reaction was completed, the PCR product was purified and recovered using the kit.
[0035] The primers used to construct the plasmid are as follows:
[0036] F: ttaaacttaagcttGGTACCATGGAAAATCAATTGGCTAAATC (SEQ ID NO: 3);
[0037] R: agtttttgttcgaaCCGCGGAAGATGAGTAGAGTTCATCAGCTG (SEQ ID NO: 4).
[0038] 2) Plasmid vector double digestion and gel purification: KpnI (Invitrogen 15232-010) and SacII (Invitrogen 15240-901) were used to double digest the PCR product and vector. The reaction system was 10xBuffer 6ul, KpnI and SacII 8ul each, template (PCR product) 8ug, and DEPC water was added to 60ul. The digestion was carried out at 37 degrees overnight. The digested product was purified the next day.
[0039] 3) Ligation reaction of purified products: The PCR products recovered by restriction digestion were connected to the large vector fragment (pCDNA4.0) using ligase (Invitrogen 15224-017), and the total reaction volume was 20ul.
[0040] 4) Transformation: Take out the competent cells DH5ɑ from the -80 refrigerator and thaw them on ice for 10 minutes; gently mix 2ul of the ligation product with 100ul of the competent cells and let them stand on ice for 30 minutes; put the EP tube into a 42-degree water bath to activate it for 90 seconds; transfer the EP tube to ice and cool it for 2 minutes; spread the transformed competent cells onto an LB plate with ampicillin and place it upside down in a 37-degree incubator for 12-16 hours.
[0041] 5) Plasmid identification: Randomly pick single clones and inoculate them into LB ampicillin medium, shake and culture overnight; the next day, extract the recombinant plasmid and send it for first-generation Sanger sequencing.
[0042] Large-scale extraction of plasmid: After sequencing is correct, use the kit to prepare the plasmid in large quantities and determine the concentration and purity of the plasmid.
[0043] 3. siRNA and plasmid transfection experiments:
[0044] siRNA was purchased from Shanghai Jima Pharmaceutical Technology Co., Ltd. The company designed two sequences, which were verified to knock down CROT, as shown in Table 1. First, the cells to be transfected were plated in a 6-well plate and cultured for 24 hours, then the transfection reagent and 2.5 μg plasmid or 5 ul siRNA were added, and the old culture medium was removed after standing in the incubator for 6 hours, and the new culture medium was added and cultured for another 48 hours before subsequent experiments.
[0045] Table 1 Sequences of CROT-siRNA
[0046] name sequence Location CROT-siRNA-1 GCCUGUUCAUAAAGUUGGAAAtt 648-668 CROT-siRNA-2 CCAUCCUUAUUGGAGAUCCAAtt 1102-1123 NC-siRNA UUCUCCGAACGUCGUCAGUtt Nonsense sequence
[0047] The GenBank sequence number of CROT is NM_021151.4.NC, negative control.
[0048] 4. Western blot:
[0049] Prepare the cell protein sample that has been extracted with SDS in advance, perform electrophoresis on 8% SDS-PAGE gel, transfer to PVDF membrane, and incubate with the corresponding protein antibody at 4°C overnight. The next day, incubate with the corresponding HRP-labeled secondary antibody at room temperature for 1 hour and expose to light for development.
[0050] 5. Cytotoxicity assay:
[0051] 48h after transfection, the cells were plated in a 96-well plate at a density of 7000 cells / well. After 6h of attachment, the cells were starved for 6h with 5% serum-supplemented culture medium. Paclitaxel at concentrations of 0, 0.001, 0.01, 0.1, 1, 2.5, 5, 10, 25, and 50uM was added to the 96-well plate at a volume of 200ul per well. After waiting for 48h, 100ul Cell Counting Kit-8 (CCK-8) reagent was added to each well. After incubation at 37 degrees incubator for 2h, the absorbance at 450nm was read on an enzyme reader, and the results were statistically analyzed.
[0052] 6. Apoptosis experiment:
[0053] 24 hours after transfection, paclitaxel or no paclitaxel was added to the corresponding groups respectively. After 48 hours, the cells were collected and washed twice with PBS. The 10x binding buffer in the BD apoptosis kit was configured to 1x. 100ul of cells were resuspended and transferred to a flow cytometer. 1ul of Annexin V and 2ul of PI were added. After incubation for 15 minutes, 400ul of 1x binding buffer was added to make up to 500ul, and the apoptosis rate was detected by flow cytometry.
[0054] 7. Cell viability experiment:
[0055] 24 hours after transfection, the cells were plated in a 96-well plate at a density of 7000 cells / well. After 6 hours of attachment, 100ul Cell Counting Kit-8 (CCK-8) reagent was added to each well. After incubation in a 37-degree incubator for 2 hours, the absorbance at 450nm was read on a microplate reader. Thereafter, CCK8 reagent was added at 24 hours, 48 hours, 72 hours and 96 hours, respectively, and the cells were incubated for 2 hours. The absorbance was detected and the results were statistically analyzed.
[0056] 8. Cell invasion and migration:
[0057] After collecting the cells 24 hours after transfection, resuspend the cells in serum-free medium, place the Transwell chamber in a 24-well plate, add 100ul of cell suspension containing 80,000 cells to the upper chamber, and add 700ul of 20% fetal bovine serum-supplemented medium to the lower chamber. For the invasion experiment, Matrigel matrix gel needs to be spread into the upper chamber of the Transwell chamber 12 hours in advance and incubated at 37 degrees for 12 hours. After 48 hours, take out the chamber, fix it with 4% paraformaldehyde for 30 minutes, then add crystal violet staining for 25 minutes, aspirate the liquid in the upper chamber, wash the lower chamber with PBS 3 times, gently wipe the cells and residual liquid in the upper chamber with a cotton swab, randomly select 3 fields of view under a light microscope to take pictures, count the number of cells in the field of view, and calculate the statistics.
[0058] 9. Colony formation:
[0059] 24 hours after transfection, cells were plated into six-well plates at 1000 cells / well, and the culture medium was changed every 3-4 days. When cell colonies visible to the naked eye were formed, the culture medium was removed, and the cells were fixed with 4% paraformaldehyde for 30 minutes. Crystal violet was then added for staining for 25 minutes. After the crystal violet was removed, the residual crystal violet was washed with PBS, and the plates were allowed to dry naturally. The plates were photographed, and the number of colonies in each well was counted and statistically analyzed.
[0060] 10. Cycle:
[0061] The cells were collected 48 hours after transfection, washed twice with pre-cooled PBS, resuspended in 70% ethanol, fixed at 4 degrees for 4 hours, washed on both sides with PBS, added with 500ul of ethidium bromide, stained for 15 minutes in the dark, detected by flow cytometry, and the results were processed with ModFit.
[0062] 11. qPCR:
[0063] Collect cells, extract total RNA from cells using RNA extraction kit, perform qPCR after reverse transcription. The reagent used is BeyoFast TM Probe qPCR Mix (2X, Low ROX), take 7.5ul, DEPC water 5.1ul, front primer 0.45ul, rear primer 0.45ul (as shown in Table 2), add 1.5ul of reverse transcription product, use qPCR machine to collect ct value, and analyze and process data.
[0064] Table 2 Sequences of RT-PCR primers
[0065] Gene sequence CROT-F GTGGTGGCTGAATGTTGCCTA See SEQ ID NO:1 CROT-R TTGGAGGCCAGTAGTGTTCAA See SEQ ID NO:2
[0066] F, front primer; R, rear primer.
[0067] 12. Bioinformatics analysis:
[0068] The data set was downloaded from the GEO database, the expression values of each sample were extracted, the expression values of CROT in normal ovarian cancer epithelial and epithelial ovarian cancer tissues were compared, the clinical information of each sample was extracted, and the relationship between the expression value of CROT and the patient's prognosis was analyzed.
[0069] 13. Immunohistochemistry:
[0070] 1) Dewaxing: Place the tissue sections on a slice rack and bake them in a 60°C oven for 30 minutes. Then place the slice rack with the tissue sections in a xylene solution (there are two xylene specimen cylinders, xylene I and xylene II). Soak the tissue sections in the xylene I and xylene II specimen cylinders for 8 minutes in turn to complete dewaxing.
[0071] 2) Rehydration: After taking the slice holder out of the xylene B specimen tank, place it in a gradient ethanol solution for rehydration. The ethanol gradient is: 100% ethanol for 8 minutes, 95% ethanol for 8 minutes, 85% ethanol for 8 minutes, and 75% ethanol for 8 minutes (make sure that the specimens on the tissue slices are completely immersed). Then wash the slices with 0.01M PBS for 5 minutes, and repeat the washing 3 times.
[0072] 3) Antigen repair: Antigen repair uses the sodium citrate microwave antigen method. Fill the antigen repair box with 0.1 mol / L, pH=6.0 sodium citrate antigen repair solution, place it in a microwave oven and heat for 3 minutes until boiling, then quickly place the slices and slice racks into the boiling sodium citrate solution, and make sure that the liquid level exceeds the slices, cover the lid tightly, and quickly return to the microwave oven, and continue heating at medium-high heat for 12 minutes. (Place the slices that have completed the rehydration process on a plastic slice rack, put them into the antigen repair box (containing 0.1M sodium citrate antigen repair solution), cover the lid tightly to make it sealed, and then place the antigen repair box in a microwave oven to heat. Heat at high heat for 2 to 3 minutes, then change to medium heat after the repair solution boils, and continue heating for 12 minutes) to maintain the temperature above 90°C. After the microwave heating stops, place the antigen repair box at room temperature and wait for natural cooling.
[0073] 4) Inactivation of endogenous peroxidase: Add 0.3% hydrogen peroxide to the specimen and ensure that the tissue is completely covered to inactivate endogenous peroxidase. After standing at room temperature for 15 minutes, wash the slides with PBS for 5 minutes × 3 times.
[0074] 5) Membrane permeabilization: After cooling to room temperature, take out the slices and wash them with PBS for 5 minutes*3 times, then lay them flat in a light-proof humid box for immunohistochemistry. Prepare the membrane permeabilization solution and drop it on the slice tissue, about 50uL per slice, so that the tissue is completely covered. After standing at room temperature for 15 minutes, rinse with PBS for 5 minutes×3 times.
[0075] 6) Use absorbent paper to wipe off the PBS on the periphery of the tissue, and lay the slices flat in a wet box. Prepare a blocking solution (0.01M PBS: 10% bovine serum: tritonX-100, the ratio is 270:30:1), and drop the permeabilization solution on the sliced tissue, about 50uL per slice, so that the tissue is completely covered, cover the wet box, and place the whole in a 37℃ water bath for 1 hour.
[0076] 7) Primary antibody incubation: Pour off the blocking solution on the slices, do not wash, use absorbent paper to absorb the liquid around the tissue, add a certain dilution ratio of primary antibody (CROT: rabbit-derived antibody, 1:200), about 30uL per slice, then cover the wet box, incubate in a 37℃ water bath for 1h, take out, and store in a 4℃ refrigerator overnight. Set up a negative control, that is, replace the primary antibody with 0.01M PBS.
[0077] 8) Secondary antibody incubation: Take the wet box out of the 4℃ refrigerator, rinse with 0.01M PBS for 5min×3 times, wipe off the PBS around the slice with absorbent paper. Add 50ul of secondary antibody (immunochromogen, Shanghai Jiehao, universal for mice and rabbits) and incubate at room temperature for 30min (labeled with streptomycin and peroxidase-affinity), and wash with PBS for 5min×3 times.
[0078] 9) DAB staining and photography under a microscope.
[0079] Results and Analysis
[0080] By analyzing the sequencing data of ovarian cancer patients, we found that the expression level of CROT in the ovarian tissue of ovarian cancer patients was lower than that in normal ovarian tissue, and patients with high expression of CROT had a better prognosis. The mRNA and protein expression levels of CROT in normal ovarian epithelial cells and epithelial ovarian cancer cells were detected by qPCR and WB, confirming the above analysis results. The immunohistochemical results confirmed that the staining of CROT in the cancerous tissue of clinical epithelial ovarian cancer patients was weaker than that in normal ovarian tissue ( Figure 1 ).
[0081] Based on the above conclusions, we constructed epithelial ovarian cancer cells with low and high CROT expression by using siRNA and pCDNA4.0-CROT plasmid ( Figure 2 ), cell viability assays, cell cycle, apoptosis, invasion and migration, and cell colony formation assays confirmed that CROT downregulation promoted the proliferation, invasion, and migration of epithelial ovarian cancer cells and inhibited the apoptosis of epithelial ovarian cancer cells, while CROT upregulation played the opposite role ( Figure 3 , Figure 4 , Figure 5 ). The above experiments confirmed that the decreased expression level of CROT in epithelial ovarian cancer cells plays a role in promoting the progression of epithelial ovarian cancer.
[0082] Afterwards, we performed high-throughput sequencing on paclitaxel-resistant ovarian cancer cells and parental cell lines. The analysis results showed that CROT expression was reduced in paclitaxel-resistant ovarian cancer cells, and qPCR results showed that after the expression level was treated, the expression value in epithelial ovarian cancer dropped to about 0.6, and in drug-resistant cells to about 0.02 (the expression value of normal ovarian epithelial cells was 1 as a reference). And through bioinformatics analysis, it was predicted that there was a negative correlation between CROT and paclitaxel IC50 ( Figure 6 ).
[0083] The expression level of CROT in paclitaxel-resistant ovarian cancer cell lines was restored by transfection with pCDNA4.0-CROT plasmid. Figure 7 ) and found that after the expression of CROT increased, the IC50 of paclitaxel-resistant cells decreased, indicating that CROT has the ability to reverse the resistance of ovarian cancer cells to paclitaxel ( Figure 8 ). To further illustrate the effect of CROT on the killing of paclitaxel on ovarian cancer, we conducted an apoptosis experiment. After overexpressing CROT in paclitaxel-resistant ovarian cancer cells, paclitaxel was added and not added respectively. It was found that when paclitaxel was not added, simply restoring the expression level of CROT in paclitaxel-resistant ovarian cancer cells did not affect the apoptosis level of paclitaxel-resistant ovarian cancer cells; however, after adding paclitaxel, the apoptosis rate of paclitaxel-resistant ovarian cancer cells in the CROT-overexpressing group increased, indicating that restoring the expression level of CROT in paclitaxel-resistant ovarian cancer cells can reduce their resistance to paclitaxel.
[0084] From the above results, it can be seen that the expression level of CROT is reduced in paclitaxel-resistant ovarian cancer cells, and restoring the expression level of CROT can reduce its resistance to paclitaxel. If gene therapy is designed to supplement the expression level of CROT, it may increase the sensitivity of paclitaxel-resistant ovarian cancer patients to paclitaxel.
[0085] The above is only a preferred embodiment of the present invention. It should be pointed out that ordinary technicians in this technical field can make several improvements and supplements without departing from the method of the present invention. These improvements and supplements should also be regarded as the scope of protection of the present invention.
Claims
1. Use of a reagent for detecting the content of CROT gene or protein in the preparation of a diagnostic reagent or kit for epithelial ovarian cancer or epithelial ovarian cancer prognosis or paclitaxel-resistant ovarian cancer.
2. The use according to claim 1, characterized in that: The reagent for detecting the content of CROT gene or protein is selected from primers for specific amplification of CROT gene or antibodies against specific CROT protein.
3. The use according to claim 1, characterized in that: The epithelial ovarian cancer or epithelial ovarian cancer prognosis or paclitaxel-resistant ovarian cancer diagnostic reagent or kit comprises: nucleic acid extraction reagent; polymerase chain reaction reagent; protein immunoblotting reagent; enzyme-linked immunosorbent assay reagent.